|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 91 No. 4 (February 15), 1998:
pp. 1216-1224
Stage-Specific Expression of Polycomb Group Genes in Human
Bone Marrow Cells
By
Julie Lessard,
Soheyl Baban, and
Guy Sauvageau
From the Laboratory of Molecular Genetics of Hemopoietic Stem Cells,
Clinical Research Institute of Montréal, Montréal,
Québec, Canada; the Département de Médecine,
Université de Montréal, Montréal, Québec,
Canada; and the Department of Experimental Medecine, McGill University,
Montréal, Québec, Canada.
 |
ABSTRACT |
Mammalian Polycomb group (Pc-G) genes, constituting some 5 subfamilies based on their identity to the Drosophila genes
Pc, Psc, ph, esc, and E(z), appear to play critical
roles in maintaining the transcriptional repression state of
Hox/HOM-C genes during development. Despite increasing evidence
of the important role of Hox genes in both normal hematopoiesis
and leukemic transformation, little is known about the expression and
possible function played by Pc-G genes in hematopoietic cells.
To address this, we first examined the expression of Pc genes
in purified CD34+ human bone marrow cells by reverse
transcriptase-polymerase chain reaction (RT-PCR), using
degenerate primers that specifically amplify the majority of Pc
genes. This analysis showed the expression of 8 different Pc
genes in CD34+ bone marrow cells, including
HP1Hs , HP1Hs , the heterochromatin
p25 protein, the human homologue of the murine M32 gene, and 4 novel members of this family. To assess whether Pc-G mRNA
levels change during differentiation of bone marrow cells, a
quantitative RT-PCR method was used to amplify the total cDNA
originating from three purified subpopulations of CD34+
bone marrow cells known to differ in their ability to grow in long-term
or semisolid cultures. In sharp contrast to Hox gene expression, which is highest in the most primitive bone marrow cells,
these studies show that the expression level of 8 of the 9 Pc-G
genes studied (ie, HP1Hs ,
HP1Hs , M31, M32, M33, Mel-18,
Mph1/Rae-28, and ENX-1) markedly increases with
differentiation of bone marrow cells. Interestingly,
BMI-1 exhibits a strikingly different pattern of expression,
with high expression levels in primitive cells and very little
expression in mature CD34 cells. Together, these results
document for the first time that differentiation of human bone marrow
cells is accompanied by profound changes in Pc-G gene
expression levels.
 |
INTRODUCTION |
IN DROSOPHILA, the homeotic
(HOM-C) genes of the ANT-C and BX-C complexes
encode highly conserved transcription factors involved in cell fate
determination.1 During embryogenesis, the spatial and
temporal expression of these genes is collinear relative to their
3 5 position on the chromosome. Although this
unique expression pattern is established by segmentation genes of the pair-rule (activators) and gap (repressors) families, the maintenance of HOM-C gene expression during later stages of development is dependent on the trithorax (trx-G) and Polycomb
group (Pc-G) gene products (reviewed in Simon et al2).
For the Pc-G genes, this repressive function appears to be
achieved initially by direct interaction with the transiently expressed
gap proteins and, later, by contributing to the formation and stable
transmission of heterochromatin.
The Drosophila Polycomb (Pc) gene was one of
the first members of the Pc-G family to be identified based on
its ability to maintain segment-specific expression of the
HOM-C genes.3 At least 12 other mutations leading
to a phenotype similar to Pc (or to its enhancement) have been
described. These include: Posterior sex combs
(Psc)4; polyhomeotic
(ph)5; Polycomblike
(Pcl)6; extra sex combs
(esc)7; Additional sex combs
(Asx)4; Enhancer of zeste
[E(z)],8 also known as polycombeotic
(pco)9; l(4)102EFc,10 recently
renamed pleihomeotic11; Sex combs extra
(Sce)12; Sex combs on midleg
(Scm)4; super sex combs
(sxc)13; multi sex combs
(mxc)14; and Enhancer of Polycomb
[E(Pc)].15 These various Pc-G names originate from the ectopic expression of organs called sex combs on the
second and third legs of male mutants.16
Recent studies have provided evidence for the existence of mammalian
Pc-G genes and their involvement in repressing the
transcription of homeotic (Hox) genes.17
M31, M32, M33 (murine), the heterochromatin p25
protein (the human homologue of M31),
HP1Hs , and HP1Hs (human)
are all homologues of the Drosophila Pc
gene18; bmi-1 and mel-18 are both murine
and human homologues of the Drosophila Posterior sex
combs (Psc) gene19; Enx-1 (human and
mouse), eed and Mph1/Rae-28 (mouse), and HPH1 and HPH2 (human) likely represent the mammalian counterparts of the Drosophila E(z), esc, and ph genes,
respectively.20,21
An important clue to Pc-G gene function in contributing to the
formation of heterochromatin came from the finding that a conserved region called the chromodomain (for chromatin organizer domain) is
shared between Pc and the heterochromatin-associated protein HP1.22 Furthermore, it has been recently shown that both
Drosophila and mammalian Pc-G proteins interact with chromatin
as heterogeneous multimeric complexes.20,23,24 The exact
mechanisms by which these complexes repress transcription of their
target genes are not yet fully understood. The chromatin accessibility
model predicts that the cooperative interaction of Pc-G protein
complexes interacting with Pc-G response elements (PREs)
regionally compacts the chromatin structure, thus eliminating the
accessibility of DNA to transcriptional regulators.25-29
However, several pieces of evidence suggest that the
mechanism of Pc-G gene-mediated silencing may not be solely achieved by the general inaccessibility of regulatory sequences. For
example, it was shown that Pc proteins can inhibit Gal-4- but not
T7-dependent transcription in Drosophila embryos.30 Thus, other models by which Pc-G genes might be acting have
been proposed. For example, Pc-G genes could act as
transcriptional repressors,6,31-35 they could interact with
specific molecules required for pol II transcription, or,
alternatively, they could block looping interactions between promoters
and enhancers.36
The pleiotropic phenotypes observed in many Pc-G mutants
indicate their participation in numerous cellular processes such as
anterio-posterior segmentation, dorso-ventral patterning, neural development, oogenesis, and hematopoiesis.11-13,37-40 In
support of the importance of Pc-G genes in hematopoiesis,
severe hypomorphic alleles of the multi sex comb (mxc)
gene in Drosophila were shown to result in premature hemocyte
differentiation and tumorous overgrowth of the larval hematopoietic
organs.14,41,42
Recent studies in mice also support a critical role for Pc-G
genes in hematopoiesis. B and T cell populations in
M33 / mice exhibit a decreased proliferative
response to plant agglutinin.23 Mice lacking bmi-1
display a progressive aplastic disease characterized by replacement of
bone marrow space by adipocytes, as well as a smaller spleen and thymus
than control littermates. Although all thymocyte populations are
initially normal in newborn bmi-1 /
mice, a progressive loss of CD4+CD8+ cells is
observed such that adult thymi contain more than 90% CD4 CD8 cells. B-cell development
is also abnormal, with bone marrow pro-B and pre-B cells being most
affected. In addition, bone marrow macrophage colony-stimulating factor
(M-CSF) and interleukin-7 (IL-7), but not IL-3, responsive clonogenic
progenitors are decreased in numbers. Interestingly, erythropoiesis
does not appear to be altered in these mice. Together, these data
suggest that bmi-1 function in hematopoietic cells is lineage-
and stage-specific, displaying a redundant role during embryogenesis
but being essential for proliferation of certain adult hematopoietic
lineages.43 Similarly, targeted disruption of the other
mammalian Psc gene, mel-18, leads to B- and T-cell
developmental defects caused by an insufficient response to IL-7
stimulation of the lymphoid precursors.20 An additional
line of evidence further suggesting a role for Pc-G proteins
in hematopoietic cell function is provided by the finding of a direct
interaction between the Pc-G protein Enx-1 and Vav, a proto-oncogene
expressed predominantly in hematopoietic cells.44
Interestingly, perturbation in expression levels of certain
Pc-G and Hox genes produce comparable phenotypes in
hematopoietic cells. Similarly to what has been observed in bmi-1
and mel-18 / mice, retroviral
overexpression of HOXA10 or HOXB3 in murine bone marrow
cells causes a block in differentiation of early B and T cells,
respectively.45,46 These observations underscore the
importance of preserving the downregulation of Hox gene
expression that occurs during normal differentiation of primitive
hematopoietic cells47 and suggest that Pc-G gene products
play a key role in assuming this function. Furthermore, inactivation of
Pc-G genes may lead to leukemic growth as a consequence of
Hox gene overexpression.45,48-51
In this work, we have investigated the expression of mammalian
Pc-G genes in purified subpopulations of human bone marrow cells and in leukemic cell lines. We document the existence of a highly
regulated program of Pc-G gene expression with mature bone
marrow subpopulations showing much higher Pc-G gene mRNA levels
relative to less differentiated precursors. These results contrast with
previously documented Hox gene expression profiles and thus
suggest a role for Pc-G proteins in regulating differentiation and/or proliferation of human hematopoietic cells by silencing Hox gene expression.
 |
MATERIALS AND METHODS |
PCR amplification of the chromodomains of the Polycomb
(Pc) subfamily of Pc-G genes.
A set of degenerate oligonucleotides was designed to match all the
different sequences of the conserved 5 -end
[5 -CAT-GAA-TTC-(GATC)GA-(GA)AA-(GA)AA-(GA)G-T(GATC) (TC)-T(GATC)GA-(TC)(AC)G-3 ] and 3 -end
[5 -TCT-AGA-TCT-(TC)T-C(GATC)G-G(TC)T-CCC-A(GATC)GT-(GA)T-T-3 ] of the chromodomains of most members (from Drosophila to
mammals; Table 1) of the Polycomb
(Pc) subfamily of Pc-G genes. These primers were used
to polymerase chain reaction (PCR)-amplify the conserved chromodomain
of Pc genes from a phage cDNA library made from purified
CD34+ human bone marrow cells originating from a single
donor.46 Briefly, phage DNA was obtained by 2 successive
phenol-chloroform extractions and approximately 0.1 µg of this DNA
introduced in a PCR mixture containing 200 pmol of each degenerate
primer (see above), 250 µmol of each four deoxyribonucleotides (dNTP;
Pharmacia, Uppsala, Sweden), 1.5 mmol of
MgCl2, 10 mmol of Tris-HCl, pH 8.9, 50 mmol of KCl, 5 U of
Taq polymerase (Life Technology, Burlington, Ontario, Canada), and
water to 50 µL. Parameters for PCR amplification were 30 seconds at
94°C, 2 minutes at 50°C, and 2 minutes at 72°C for 35 cycles. A unique 115-bp fragment was obtained and subcloned into the
EcoRV site of Bluescript KS (Stratagene, La Jolla,
CA) as described.47
View this table:
[in this window]
[in a new window]
|
Table 1.
Alignment of the Chromodomains of the
Pc Genes and Generation of a Consensus Sequence to
Design the Degenerate Oligonucleotides Used in These
Studies
|
|
DNA sequencing and sequence analysis.
DNA sequencing was performed by the dideoxy chain termination method
using [35S] dATP and a T7 sequencing kit (Pharmacia)
according to the manufacturer's recommendations. Either the universal,
reverse, T3, or T7 primers complementary to sequences within the
cloning vector were used. Nonredundant nucleotide sequence databases
(GenBank, EMBL) were screened for homologous sequences using the search
algorithms BLAST and FastA of the GCG program (Genetic Computer Group,
Madison, WI). The BestFit program was used to obtain the
similarities and identities of the Pc-G genes of the Pc
subfamily.
Purification of CD34+ human bone marrow cell
subpopulations.
Low-density cells (<1.077 g/mL) obtained from 3 different healthy
bone marrow (BM no. 1, 2, and 3) donors were isolated by centrifugation
on Ficoll-Paque (Pharmacia LKB, Uppsala, Sweden) and kept
frozen in Iscove's medium containing 10% fetal calf serum (FCS) and
7.5% dimethyl sulfoxide. For fluorescence-activated cell sorting
(FACS) experiments, cells were thawed in the presence of DNase I
(Sigma, St Louis, MO) to avoid clogging; stained with a series of
directly conjugated fluorescent antibodies to CD34 (8G12-Cy5), CD45RA
(8d2-R-phycoerythrin), and CD71 (OKT9-fluorescein isothiocyanate); and
washed twice (propidium iodide at 1 µg/mL was included in the last
wash [Sigma]) before sorting on a FACStarplus (Becton Dickinson
Immunocytometry, San Jose, CA) as described.47 Cells were
sorted in three phenotypically and functionally distinct subpopulations: subpopulation I
(CD34+CD45RA CD71 ),
IIM (CD34+CD45+CD71lo),
and IIIE
(CD34+CD45RA-CD71hi), as
characterized before.47 Cells from bone marrows were also stained with 8G12-Cy5 alone and separated into total CD34+
and CD34 subpopulations. Aliquots from each
subpopulation were analyzed and found to be greater than 98% pure.
cDNA generation and amplification.
A previously described method for generating representative amplified
total cDNA from small numbers of hematopoietic cells using an
oligodT-based primer and polyA tailing strategy was used, with
modifications designed to improve cDNA yield of even rare transcripts
and to provide amplified sequences extending up to 2 kb 5 of the
polyadenylation site.47 In brief, 1,500 to 10,000 cells of
each subpopulation were pelleted and then lysed in a 5 mol/L guanidium
isothiocyanate solution containing 20 mmol/L dithiothreitol. Nucleic
acids were precipitated by adding 25 µL of 7.5 mol/L ammonium
acetate, 20 µg of glycogen as a carrier, and 2 vol of 95% ethanol.
The washed pellets were dried at room temperature and resuspended in
9.5 µL of a solution containing 6.1 µL of diethyl
pyrocarbonate-treated water, 2 µL of 5× RT buffer (Life
Technology), 1 µL of 0.1 mol/L dithiothreitol, 0.2 µL of 25 mmol/L
dNTPs (Pharmacia), 0.2 µL of a special 60-mer oligo(dT) primer [1
µg/µL;
5 -CAT-GTC-GTC-CAG-GCC-GCT-CTG-GAC-AAA-ATA-TGA-ATT-CT(24)-3 ], and 0.5 µL of Moloney murine leukemia virus (MMLV)
SuperScript II reverse transcriptase (200 U/µL; Life Technology). The
samples were left at 40°C for 1 hour, heated to 75°C for 10 minutes, and ethanol-precipitated with ammonium acetate and a linear
polyacrylamide carrier, as described.47 The pellet was
washed once; resuspended in 5 µL of a tailing solution containing 1 µL of 5× terminal deoxynucleotidyl transferase (TdT) buffer
(Life Technology), 0.5 µL of 100 mmol/L dATP (Pharmacia), 3.5 µL of
water, and 0.5 µL of TdT enzyme (15 U/µL; Life Technology), and
incubated for 15 minutes at 37°C. After heat
inactivation (75°C for 10 minutes), this solution was directly
added to a PCR amplification mixture consisting of 25 µL of a
2× buffer (20 mmol/L Tris, pH 8.8, 100 mmol/L KCl, 9 mmol/L MgCl2), 4 µL of the 60-mer primer (same as described
above), 0.5 µL of nuclease-free bovine serum albumin (10 mg/mL;
Sigma), 5.25 µL of water, and 2 µL of d(GCT) deoxynucleotides
adjusted at 25 mmol/L each. Four micrograms of gene 32 protein
(Pharmacia) and 5 U of Taq polymerase (Life Technology) were added to
each tube and total cDNA was amplified with an Ericomp thermal cycler
(Ericomp, San Diego, CA) using the following parameters: 94°C for 1 minute; 55°C for 2 minutes except for the first cycle, which was
performed at 37°C; and 72°C for 10 minutes for 44 cycles.
Southern blot analysis of total amplified cDNA.
One-fifth of the total amplified cDNA prepared from each purified
subpopulation or cell line was electrophoresed in a 1% agarose gel and
transferred to an ionic nylon membrane (Zeta-probe; Bio-Rad, Hercules,
CA). Probes were labeled with 32P-dCTP by
random priming and purified on Sephadex-G50 columns (Pharmacia). Blots
were prehybridized and hybridized at 65°C in 4.4× SSC, 7.4%
formamide, 0.74% sodium dodecyl sulfate (SDS), 1.5 mmol/L EDTA, 0.74%
skim milk, 370 µg/mL salmon sperm DNA, and 7.5% dextran sulphate.
Membranes were washed three times for 30 minutes at 65°C in 0.3%
SSC, 0.1% SDS, and 1 mg/mL sodium pyrophosphate and exposed to Kodak
BioMax MS films (Interscience Inc, Markham, Ontario, Canada). Blots
were stripped in a 1% SDS solution at 95°C for 30 minutes and
tested for the absence of signals by overnight exposure to Kodak BioMax
MS films (Eastman Kodak, Rochester, NY) using appropriate
intensifying screens (Interscience Inc).
Most probes used in these studies were generated by PCR amplification
of cDNA or genomic DNA obtained from various sources and were all
sequenced as described above. These probes included (1) a 264-bp
fragment of the human HP1Hs gene (nucleotides
416-679; accession no. S62077; 5 primer CTCAAACAGTGCCGATGACA and
3 primer TCCGCATCCTCAGGATATGC) located downstream of the
chromodomain; (2) a 222-bp fragment of the human HP1Hs gene (or p25 heterochromatin
gene) also located downstream of the conserved chromodomain
(nucleotides 558-779; accession no. U35451; 5 primer
GAAAGCTGGCGGGCACTAT and 3 primer GAGCGTTAGTTCTTGTCATC); (3) a
326-bp fragment corresponding to the untranslated exon 7 of the
3 UTR of the murine M31 gene (nucleotides 68-393;
accession no. X95397; 5 primer TGTCTTGACACCATAGAGGT and 3
primer CTACACACATGCTAGGCTGT); (4) a 268-bp fragment of the murine
M32 gene located downstream of the chromodomain (nucleotides
252-519; accession no. X56683; 5 primer ATCTGACAGTGAATCTGAT and
3 primer TTGTGCTTCATCT TCAGGAC); (5) a 322-bp fragment of the
murine M33 gene located downstream of the chromodomain
(nucleotides 1346-1667; accession no. X62537; 5 primer
AGCTGACTTGCAAGGCAACG and 3 primer GACTCCTTCACGGTGACAGT); (6) a
329-bp fragment of the human BMI-1 gene located in the 3 UTR (nucleotides 1938-2248; accession no. L13689; 5 primer GATGAATTCGTCACTGTGAATAACGATTT and 3 primer
TCTAGATCTACAATCATTTCTGAATGCAT); (7) a 287-bp fragment of the human
Mel-18 gene located downstream of the RING finger domain
(nucleotides 876-1168; accession no. D13969; 5 primer
CAAGTACCGTGTCCAGCCAG and 3 primer TCTGCAGGCAGTTCAAGCTA); (8) a
228-bp fragment of the human ENX-1 gene located downstream to
the SET domain (nucleotides 2338-2565; accession no. U52965; 5
primer CTGAAGTATGTCGGCATCGA and 3 primer ACACTTTGCAGCTGGTGAGA); and (9) a 251-bp fragment of the murine Mph1/Rae-28 gene
located in the 3 UTR (nucleotides 3190-3440; accession no.
U63386; 5 primer GTGCTACATGGTGACAGCTT and 3 primer
AGCTAGGAAAGCTGACCTCT). Probes for HP1Hs ,
HP1Hs , and ENX-1 were isolated from cDNA
obtained from CD34+ human bone marrow cells; M31
and M32 were obtained from a pool of total RNA extracted from
the Ba/F3, 32D, FEL, and FDC-P1 murine hematopoietic cell lines;
M33 and Mph1/Rae-28 were obtained from murine genomic
DNA; and BMI-1 and Mel-18 were obtained from human genomic DNA isolated from K562 cells. Probe for the full-length human
HP1Hs coding cDNA (519 bp) was isolated as a
BamHI/EcoRI fragment of pGEX-2T (kindly provided by Dr
H.J. Worman, College of Physicians & Surgeons of Columbia University,
New York, NY). Probes for -actin, human
CD34, Multi-Drug Resistance (MDR), and
-globin were isolated as described.47
After database searches, probes were designed to minimize any
cross-hybridization between the various Pc-G genes and other related sequences. To determine whether these probes recognized single
copy gene, Southern blot analysis was performed on genomic DNA isolated
from mouse thymus and human leukemic cell lines (K562, HL-60) using the
same hybridization conditions as described above. A single band was
detected with the following probes: M31, M33, Mel-18, BMI-1, Mph1/Rae-28, and ENX-1. However,
M32 and HP1Hs hybridized to 5 to 10 different DNA fragments digested with either of the following
restriction enzymes: EcoRI, HindIII, Bgl II, Kpn I, BamHI, and Xho I. The probe used to
detect HP1Hs also showed a single band. However,
by using a different probe, it has been shown that this gene is part of
a larger family18 and highly similar sequences to
HP1Hs are found in different EST databases.
Cell lines.
Hematopoietic cell lines used in this study were obtained from the
American Type Culture Collection (ATCC; Rockville, MD), unless specified otherwise. They included the HL-60 cells derived from
a patient suffering from acute myeloid leukemia, the K562 cells
obtained from pleural effusion of a patient suffering from blast phase
chronic myelogeneous leukemia, the MOLT-4 cells established from the
peripheral blood of a patient suffering from acute T-cell lymphoblastic
leukemia, the KG-1a cells obtained from a patient suffering from acute
myeloid leukemia, the TF-1 human erythroleukemic cell line, the 32D
murine mast cell line, the FDC-P1 myeloid cell line derived from
long-term bone marrow cultures of DBA-2 mice, the Ba/F3 murine cell
line (a gift from A. Miyajima, DNAX Research Institute, Palo Alto, CA),
the FEL-745 Friend murine erythroleukemic cell line, and the murine
Rat-1 fibroblasts. All cell lines were maintained in RPMI 10% FCS
(GIBCO/BRL) except for FDC-P1, 32D, and Ba/F3, which grow in the
presence of 5 ng/mL of mIL-3 and TF-1 cells that were maintained in the
presence of 5 ng/mL of human granulocyte-macrophage colony-stimulating
factor (hGM-CSF). All growth factors were used as diluted
COS-cell supernatants produced at Institut de Recherches Cliniques de
Montréal (IRCM).
Northern blot analysis.
Total cellular RNA from 1 × 107 cells of the murine
FEL, FDC-P1, 32D, and Ba/F3 and human K562, HL-60, TF-1, MOLT-4, and
KG-1a hematopoietic cell lines was isolated with TRIzol (Life
Technology). Approximately 5 µg of each sample was size fractionated
by electrophoresis on a 1% agarose gel containing 1× Na-MOPS and
5% deionized formaldehyde and transferred to Zeta-probe nylon
membranes. Blots were prehybridized and hybridized at 45°C in 48%
deionized formamide, 4.8% SDS, 480 mmol/L phosphate buffer
(Na2HPO4/NaH2PO4, pH
7), 960 µg/mL of nuclease-free bovine serum albumin, and 400 µg/mL
of salmon sperm DNA. Membranes were washed twice in 0.2× SSC,
0.1% SDS and once in 0.1× SSC, 0.1% SDS for 30 minutes at
55°C. Total RNA loading was verified by hybridization of membranes
with radiolabeled oligonucleotides (ACG-GTA-TCT-GAT-CGT-CTT-CGA-ACC)
specific to 18S ribosomal RNA.
 |
RESULTS |
Expression of known and novel Pc genes in
CD34+ human bone marrow cells.
To obtain an initial indication of the range and expression pattern of
known and potentially novel Pc genes that might be expressed in
human bone marrow cells, a set of degenerate oligonucleotides spanning
a region of the conserved chromodomain of most Pc genes was
synthesized (Table 1) and used to PCR-amplify cDNA isolated from a
CD34+ human bone marrow cDNA library. A PCR fragment of 115 bp presumably containing several different chromobox sequences was
subcloned and the nucleotide sequences of 73 independent clones was
compared with known Pc-G genes.
The results from this analysis showed that at least 8 different Pc
genes are expressed in human bone marrow cells
(Table 2). The HP1Hs
and HP1Hs genes were most represented,
with 31 (42%) and 15 (21%) of the 73 clones corresponding to these 2 genes. Three Pc subfamily members having a chromobox highly
similar to that of HP1Hs were identified in 2 independent PCR reactions, suggesting that they represent novel
Pc genes. They were named HP1Hs -like A,
B, and C. DNA and protein sequence comparison of these clones to
HP1Hs is shown in Table 2.
View this table:
[in this window]
[in a new window]
|
Table 2.
Pc Gene Sequences Obtained From cDNA
Isolated From Purified CD34+ Human Bone Marrow Cells With
Degenerate Oligonucleotides Designed Based on Conserved Sequences of
Pc
Genes
|
|
Three additional sequences were identical to the human
heterochromatin p25 protein and one clone, referred to as
p25-like, was most similar to p25 but contained 3 mismatches (Table 2). Two clones, each obtained from independent PCR
reactions, had a single mismatch to the murine M32 gene and
likely represent its human homologue. Finally, seven additional
sequences containing a single nucleotide mismatch to either
HP1Hs or HP1Hs were
identified. It is impossible at this point to ascertain whether any of
these represent distinct genes or reflect PCR artifacts.
Together, the data obtained with this approach show the presence of at
least 8 different Pc genes in human bone marrow cells, 4 of
which are potentially novel genes, and one is the human homologue of
the murine M32 gene.
Quantitative analysis of Pc-G gene expression in functionally
distinct subpopulations of human bone marrow cells.
We next assessed the variation in expression levels of Pc-G
genes during differentiation of bone marrow cells. This was performed by generating PCR-amplified total cDNA from functionally and
phenotypically distinct FACS-purified human bone marrow subpopulations,
using antibodies directed against CD34, CD45RA, and CD71 surface
antigens (Fig 1). In total, 5 different
subpopulations were purified from 3 healthy bone marrow donors: (1)
total CD34+ cells, which phenotypically represent 1% to
5% of bone marrow cells and contain all types of progenitors; (2)
CD34+CD45 CD71 cells
(subpopulation I), which are highly enriched for very primitive long-term culture-initiating cells (LTC-IC); (3)
CD34+CD45 CD71hi, which are
enriched in erythroid (ie, burst-forming unit-erythroid [BFU-E])
clonogenic progenitors (subpopulation IIIE); (4)
CD34+CD45+CD71lo cells, which are
highly enriched in granulocyte-macrophage progenitors (colony-forming
unit-granulocyte-macrophage [CFU-GM]; subpopulation IIM); and (5)
total CD34 subpopulation, which contains mature bone
marrow cells with no progenitor activity. Detailed functional
characterization of each of these purified populations has been
described elsewhere.47,52

View larger version (20K):
[in this window]
[in a new window]
| Fig 1.
FACS profiles of the CD34+ subpopulations
isolated from donor no. 1: subpopulation I,
CD34+CD45RA CD71 (highly
enriched in LTC-IC); subpopulation IIM,
CD34+CD45RA+CD71lo (highly
enriched in CFU-GM); subpopulation IIIE,
CD34+CD45RA CD71hi (highly
enriched in BFU-E ). FITC, fluorescein isothiocyanate; PE,
phycoerythrin.
|
|
Total cDNA isolated from each purified subpopulation was PCR-amplified
using a method previously shown to preserve quantitative differences in
mRNA abundance using limited cell numbers.47,53 To assess
both the sensitivity and the ability of this procedure to measure
quantitative differences of Pc-G messages in hematopoietic cells, various numbers of the human K562 cells, which express HP1Hs , were mixed with Rat-1 fibroblasts that
do not express this gene. Total cDNA amplified from each cellular
preparation was blotted and hybridized with a probe specific for
HP1Hs and showed linearity of expression in a
range between 40 and 20,000 K562 cells (Fig
2).

View larger version (30K):
[in this window]
[in a new window]
| Fig 2.
Representative amplification of mRNA by quantitative
RT-PCR. Expression of HP1Hs in total amplified
cDNA obtained from various cellular preparations of K562 (which express
HP1Hs ) and Rat-1 cells
(HP1Hs negative) by Southern blot analysis.
Exposure times are as indicated.
|
|
Total amplified cDNA from each of the 5 purified subpopulations
obtained from one bone marrow donor was analyzed for the expression of
the majority of mammalian Pc, Psc, ph, and E(z) genes
characterized to date (Fig 3). Probes were
carefully designed to minimize the presence of conserved or repetitive
domains within the various Pc-G genes. All Pc-G genes
analyzed to date are expressed at some levels in at least one of the
purified subpopulations shown in Fig 3. Interestingly, and in contrast
to Hox gene expression, which is predominantly observed in
primitive subpopulations of CD34+ human bone marrow
cells,47 the expression of most Pc-G genes is
higher in cells lacking the CD34 surface antigen (compare the signals
shown in lane 3 [CD34 cells] with those in lane 2 [CD34+]; Fig 3). The detailed analysis of these results
suggests a progressive increase in Pc-G gene expression with
bone marrow cell differentiation (Fig 3). Some important variations in
expression levels were observed within each subfamily. For the
Pc subfamily, M31, M32, and M33 had a
similar pattern of expression, with very high expression levels in
CD34 cells, moderate levels in subpopulations IIM
and IIIE, and little (M31) or no detectable expression
(M32, M33) in the most primitive subpopulation I. The
expression pattern of HP1Hs differed
significantly from the other Pc genes with similar abundance in
CD34+ and CD34 cells (Fig 3). Expression
also differed between the 2 known members of the Psc family
BMI-1 and Mel-18. Whereas Mel-18 expression was
most prominent in mature cells (CD34 and
subpopulation IIM), that of BMI-1 was highest in the most primitive subpopulation and minimal in CD34 cells.
The expression of ENX-1 [a mammalian E(z) gene] was
similar to that of HP1Hs and the expression of
Mph1/Rae28 (a ph gene) paralleled that of
Mel-18. Interestingly, Mph1/Rae28 expression was not
observed in the 3 cell lines shown in Fig 3, whereas Mel-18
expression was detected only in human K562 and murine Rat-1 cells.

View larger version (37K):
[in this window]
[in a new window]
| Fig 3.
Expression of mammalian Pc-G genes in purified
bone marrow CD34+ subpopulations. Five to ten thousand
cells were isolated from each subpopulation (>98% purity upon
reanalysis) and their total RNA was reverse-transcribed and
PCR-amplified as described in the Materials and Methods. From
primitive to mature subpopulations: subpopulation I,
CD34+CD45RA CD71 ;
subpopulation IIM,
CD34+CD45RA+CD71lo;
subpopulation IIIE,
CD34+CD45RA CD71hi and
CD34 cells. Exposure times (all at 70°C unless
specified) were as follows: HP1Hs , 6.5 hours at
room temperature; HP1Hs , 1.2 hours; M31,
6 days; M32, 27 hours; M33, 26 hours; Mel-18, 24 hours; BMI-1, 8 days; Mph-1/Rae-28, 3 days;
ENX-1, 4.5 hours; -globin, 5 minutes; and -actin and
CD34, 5 hours each.
|
|
Several control probes were hybridized to the membranes containing the
amplified cDNA obtained from each subpopulation. Actin showed
comparable loading in each of the 9 lanes, except for lane 4, which was
moderately underloaded, and lane 5 (subpopulation IIM), in which a
clear distinct signal could be detected only upon prolonged exposure
(not shown). Expression of CD34 in these subpopulations correlated with
the expression of this antigen as determined by FACS analysis, with a
progressive decrease in expression levels from subpopulation I to IIM
and IIIE (data not shown and Sauvageau et al47). Expression
of CD34 could not be detected in the CD34 cDNA even
upon prolonged exposure (Fig 3). As might be expected, -globin
expression was only detected in populations containing mature red blood
cell precursors (total unseparated bone marrow and
CD34 cells). Finally, consistent with the findings
of our previous studies,47 the expression of the multidrug
resistance gene (MDR-1) was highest in subpopulation I and was also
abundant in K562 cells (data not shown).
The reproducibility of these data was examined in identical bone marrow
subpopulations isolated from 2 additional donors. Probes for
HP1Hs , HP1Hs , and
ENX-1 were hybridized to membranes containing total amplified cDNA, and the results from these experiments were superimposable to
those shown in Fig 3 (data not shown). Together, these data highlight
the complexity of the regulation of Pc-G gene expression during
differentiation of human bone marrow cells and suggest the existence of
diverse Pc-G protein complexes during hematopoietic cell
differentiation.
Several Pc-G genes are expressed as multiple alternative
transcripts in primary cells and in leukemic cell lines.
Previous studies have shown that one of the hallmarks of Pc-G
genes is their expression as several alternative transcripts. To
evaluate whether hematopoietic cells also express multiple Pc-G
gene transcripts, total RNA isolated from 5 different human (K562,
HL-60, MOLT-4, TF-1, and KG1-a) and 4 murine (FEL, FDC-P1, 32D, and
Ba/F3) hematopoietic cell lines, representing different lineages and
stages of differentiation, was assessed for Pc-G gene
expression by Northern blot (Fig 4).

View larger version (33K):
[in this window]
[in a new window]
| Fig 4.
Northern blot analysis showing the expression of selected
members of the Pc-G family in human and murine hematopoietic
cell lines. Five micrograms of total RNA isolated from each cell line was hybridized to probes specific to HP1Hs (14 hours of exposure), HP1Hs (5.5 hours),
M31 (96 hours), M32 (6 days), BMI-1 (14 hours), and 18S rRNA (4 minutes).
|
|
This analysis showed the presence of multiple transcripts for 3 of the
5 Pc-G genes examined. These include
HP1Hs , which had a human and a mouse-specific
transcript of 9.9 and 8.7 kb, respectively, and shared a transcript of
1.2 kb in all cell lines examined (Fig 4). Different transcripts of the
M31 gene were detected in human versus murine cell lines, the
former expressing transcripts of 10.7 and 2.4 kb and the latter
expressing transcripts of 2.4 and 1.1 kb. The probe for
HP1Hs also detected 2 distinct species (2.1 and
1.1 kb) in human cell lines, whereas murine cells only expressed a
transcript of 2.1 kb.
Two of the 5 genes examined expressed a single transcript. These
include the M32 gene, whose expression could only be detected in cell lines of murine origin (Fig 4). The lack of expression of
M32 in human cell lines contrasts with its relative abundance in primary bone marrow cells (Fig 3), suggesting either the presence of
different transcripts specifically recognized by our probe in primary
cells or its complete absence in the immortalized lines examined here.
Similarly, M33 and Mph1/Rae-28 expression could not be
detected in any hematopoietic cell line examined, although both were
easily detectable in the purified subpopulations shown in Fig 3.
Finally, although Mel-18 expression could not be detected by
Northern blot analysis of total RNA (data not shown), RT-PCR analysis
showed its presence at low levels in K562 but not in HL-60 cells (Fig
3). These results were confirmed using polyA mRNA isolated from the
same cell lines. Two different transcripts for Mel-18 (1.8 and
3.4 kb) were detected in all the cell lines examined, except in HL-60
cells (data not shown).
To test whether the transcripts identified in the human cell lines
reflect those present in primary isolates, mononuclear cells were
isolated from 2 different human bone marrow specimens and total RNA
hybridized to probes specific for the HP1Hs and
HP1Hs genes. In both cases, the transcripts
observed in primary cells corresponded to those found in human cell
lines, except for the 1.2-kb transcript of HP1Hs
whose presence in primary cells remains unclear (data not shown). Together, these data suggest that alternative transcription patterns for the majority of Pc-G genes represent an additional level
for regulation of the Pc-G gene action during hematopoietic
cell differentiation.
 |
DISCUSSION |
These studies report the expression of at least 13 different
Pc-G genes in human bone marrow cells, including 4 potentially novel homologues of the Drosophila Pc gene. Moreover,
our data suggest the existence of a highly defined program of Pc-G
gene expression in phenotypically distinct subpopulations of human bone marrow cells representing various stages of differentiation. In
contrast to the preferential expression of Hox genes in the early hematopoietic cells,47 our study showed that the
expression levels of 8 of the 9 Pc-G genes studied is much
higher in the more mature bone marrow cells than in the primitive
subpopulations. For some of the Pc-G genes, such as
ENX-1, M31, HP1Hs , and
HP1Hs , this upregulation seems to appear in the
earliest stages of hematopoietic differentiation, whereas for others
(ie, M32, M33, Mel-18, and Mph1/Rae-28), increase in
their expression levels coincides with later stages of differentiation
(summarized in Fig 5). This suggests that
Pc-G protein complexes present in primitive hematopoietic cells (ie,
population I) differ from those found in mature bone marrow cells.
These results document, for the first time, changes in Pc-G
gene expression levels with cellular differentiation. This
contrasts with their ubiquitous expression in Drosophila syncytial blastoderms24 and thus point to an additional
level for regulating Pc-G gene functions in mammalian cells.

View larger version (24K):
[in this window]
[in a new window]
| Fig 5.
Summary of Pc-G gene expression patterns observed
in different purified subpopulations of human bone marrow cells.
|
|
Using degenerate primers, 4 novel chromobox sequences similar to that
of the previously described Pc genes (referred to as HP1Hs -like A, B, and C and
p25-like) were identified. In most cases, these sequences were
obtained in 2 independent PCR reactions, suggesting that they may
represent novel human Pc members. Because the bone marrow used
for this part of the work originated from a single donor, it is
impossible to rule out that one of these sequences (eg, clone no. 4, Table 2) represents polymorphism. However, this is unlikely, because
each novel sequence contains at least one mutation that affects the
primary sequence of the highly conserved chromodomain. In support of
the existence of several uncharacterized HP1Hs
members, several HP1Hs sequences have been found
in EST databases. Hybridization of mouse and human genomic DNA with a
probe for HP1Hs have also shown several
bands.18 Importantly, the other
HP1Hs -related sequences identified by Saunders
et al18 were not detected by the probe used in our studies.
Together, these data indicate that our knowledge of the full complement
of Pc-G genes expressed in hematopoietic cells has not
been resolved yet.
The ability of each probe to hybridize to specific sequences is shown
in Fig 3 by the absence of a signal in at least one of the cell line
controls (HP1Hs , M32, M33,
Mel-18, Mph1/Rae-28, and ENX-1) or one of the
purified subpopulations analyzed (HP1Hs
and M31). Except for M32 and
HP1Hs , all Pc-G gene probes used in
these studies only detected one DNA fragment, as shown by Southern blot
analysis of human and mouse genomic DNA (data not shown). Therefore,
M32 and HP1Hs probes possibly cross-hybridized
with other Pc genes whose expression would also be prominent in
mature bone marrow cells (Fig 3), further supporting our observation
that Pc gene expression is higher in more mature bone marrow
cells.
Further insight into Pc-G gene expression was provided by
Northern blot analysis, which showed multiple Pc-G gene signals in several human and murine hematopoietic cells. Because our probe for
M32 and HP1Hs may recognize more than one gene,
some of the signals detected by Northern blot analysis may be derived
from related genes. However, the signals observed with the probes
specific for HP1Hs , M31, and
Mel-18 represent alternative transcripts. It would be
interesting to investigate whether some of these transcripts are
hematopoietic-specific, lineage-specific, or encode proteins with
altered function (eg, dominant negative, etc). Interestingly, the low
to undetectable expression levels of the M32, M33, and Mph1/Rae-28 genes in all cell lines (Figs 3 and 4) contrast
with their relatively high expression levels in differentiated primary hematopoietic cells (Fig 3), raising the possibility that these proteins normally perform antiproliferative functions in mature bone
marrow cells. Indeed, a correlation can be made between the expression
pattern of BMI-1 and Mel-18 (the 2 known mammalian Psc genes) and their ability to control cellular proliferation. BMI-1, a known proto-oncogene, is preferentially expressed in bone marrow cells displaying a high proliferative potential (ie, subpopulation I; Fig 3), whereas Mel-18, a gene recently shown to exhibit tumor suppressive activity,54 is only expressed
in mature and nonproliferating CD34 cells.
Together, our results show a progressive upregulation of most
Pc-G genes concomitant with differentiation of human bone
marrow cells and support a complex-constitution model. In this model, newly expressed Pc-G gene products would progressively
interact with existing Pc-G protein complexes, favoring
novel interactions with target sequences. This, in turn, would allow a
progressive packaging of DNA into an heterochromatin-like structure
and, for the Hox genes, a progressive 3 to 5
closure of the clusters, allowing proper differentiation of the
hematopoietic stem cells. This is most interesting in the view that
Hox gene expression decreases 3 to 5 during
differentiation of hematopoietic cells47 and overexpression
of Hox genes in hematopoietic cells profoundly alters their
differentiation and proliferation.45,46,55
 |
FOOTNOTES |
Submitted July 17, 1997;
accepted October 6, 1997.
Supported by grants from the National Cancer Institute, the Medical
Research Council (MRC), and the Leukemia Research Fund of Canada. J.L.
is a recipient of an MRC scholarship and G.S. is a Clinician-Scientist
scholar of the MRC.
Address reprint requests to Guy Sauvageau, MD, PhD, Institut de
Recherches Cliniques de Montréal, 110 Pine Ave W, Montréal, Québec, Canada H2W 1R7.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. section 1734 solely
to indicate this fact.
 |
ACKNOWLEDGMENT |
The authors gratefully acknowledge the expert technical assistance of
Nathalie Tessier, head of the Flow Cytometry Service of IRCM for cell
sorting, and of Dr Peter Lansdorp and Vishia Dragowska for providing
the CD34, CD45RA, and CD71 conjugated antibodies used in this study. Dr
Trang Hoang and Nathalie Bouchard are also acknowledged for providing
frozen bone marrow cells. We also thank Dr David Lohnes, Dr Keith
Humphries, and Dr Terry Magnuson for critically reviewing this
manuscript.
 |
REFERENCES |
1.
Krumlauf R:
Hox genes in vertebrate development.
Cell
78:191,
1994[Medline]
[Order article via Infotrieve]
2.
Simon J,
Chiang A,
Bender W:
Ten different Polycomb group genes are required for spatial control of the abdA and AbdB homeotic products.
Development
114:493,
1992[Abstract]
3.
Lewis EB:
A gene complex controlling segmentation in Drosophila.
Nature
276:565,
1978[Medline]
[Order article via Infotrieve]
4.
Jürgens G:
A group of genes controlling the spatial expression of the bithorax complex in Drosophila.
Nature
316:153,
1985
5.
Dura JM,
Brock HW,
Santamaria P:
Polyhomeotic: A gene of Drosophila melanogaster required for correct expression of segmental identity.
Mol Gen Genet
198:213,
1985[Medline]
[Order article via Infotrieve]
6.
Duncan IM:
Polycomblike: A gene that appears to be required for the normal expression of the bithorax and antennapedia gene complexes of Drosophila melanogaster.
Genetics
102:49,
1982[Abstract/Free Full Text]
7.
Struhl G:
A gene product required for correct initiation of segmental determination in Drosophila.
Nature
293:36,
1981[Medline]
[Order article via Infotrieve]
8.
Jones RS,
Gelbart WM:
Genetic analysis of the enhancer of zeste locus and its role in gene regulation in Drosophila melanogaster.
Genetics
126:185,
1990[Abstract]
9.
Phillips MD,
Shearn A:
Mutations in polycombeotic, a Drosophila polycomb-group gene, cause a wide range of maternal and zygotic phenotypes.
Genetics
125:91,
1990[Abstract]
10. Gehring W: A recessive lethal with a homeotic effect in
Drosophila melanogaster. Drosophila Inf Serv 45:103, 1970
11.
Girton JR,
Jeon SH:
Novel embryonic and adult homeotic phenotypes are produced by pleiohomeotic mutations in Drosophila.
Dev Biol
161:393,
1994[Medline]
[Order article via Infotrieve]
12.
Breen TR,
Duncan IM:
Maternal expression of genes that regulate the bithorax complex of Drosophila melanogaster.
Dev Biol
118:442,
1986[Medline]
[Order article via Infotrieve]
13.
Ingham PW:
A gene that regulates the bithorax complex differentially in larval and adult cells of Drosophila.
Cell
37:815,
1984[Medline]
[Order article via Infotrieve]
14.
Santamaria P,
Randsholt NB:
Characterization of a region of the X chromosome of Drosophila including multi sex combs (mxc), a Polycomb group gene which also functions as a tumour suppressor.
Mol Gen Genet
246:282,
1995[Medline]
[Order article via Infotrieve]
15.
Soto MC,
Chou TB,
Bender W:
Comparison of germline mosaics of genes in the Polycomb group of Drosophila melanogaster.
Genetics
140:231,
1995[Abstract]
16.
Struhl G:
Genes controlling segmental specification in the Drosophila thorax.
Proc Natl Acad Sci USA
79:7380,
1982[Abstract/Free Full Text]
17.
Alkema MJ,
van der Lugt NM,
Bobeldijk RC,
Berns A,
van Lohuizen M:
Transformation of axial skeleton due to overexpression of bmi-1 in transgenic mice.
Nature
374:724,
1995[Medline]
[Order article via Infotrieve]
18.
Saunders WS,
Chue C,
Goebl M,
Craig C,
Clark RF,
Powers JA,
Eissenberg JC,
Elgin SC,
Rothfield NF,
Earnshaw WC:
Molecular cloning of a human homologue of Drosophila heterochromatin protein HP1 using anti-centromere autoantibodies with anti-chromo specificity.
J Cell Sci
104:573,
1993[Abstract]
19.
van Lohuizen M,
Frasch M,
Wientjens E,
Berns A:
Sequence similarity between the mammalian bmi-1 proto-oncogene and the Drosophila regulatory genes Psc and Su(z)2.
Nature
353:353,
1991[Medline]
[Order article via Infotrieve]
20.
Akasaka T:
The role of mel-18, a mammalian Polycomb group gene, during IL-7-dependent proliferation of lymphocyte precursors.
Immunity
7:135,
1997[Medline]
[Order article via Infotrieve]
21.
Shumacher A,
Faust C,
Magnuson T:
Positional cloning of a global regulator of anterior-posterior patterning in mice.
Nature
383:250,
1996[Medline]
[Order article via Infotrieve]
22.
Paro R,
Hogness DS:
The Polycomb protein shares a homologous domain with a heterochromatin-associated protein of Drosophila.
Proc Natl Acad Sci USA
88:263,
1991[Abstract/Free Full Text]
23.
Coré N,
Bel S,
Gaunt SJ,
Aurrand-Lions M,
Pearce J,
Fisher A,
Djabali M:
Altered cellular proliferation and mesoderm patterning in polycomb-M33 deficient mice.
Development
124:721,
1997[Abstract]
24.
Simon J:
Locking in stable states of gene expression: Transcriptional control during Drosophila development [review].
Curr Opin Cell Biol
7:376,
1995[Medline]
[Order article via Infotrieve]
25.
Gaunt SJ,
Singh PB:
Homeogene expression patterns and chromosomal imprinting [review].
Trends Genet
6:208,
1990[Medline]
[Order article via Infotrieve]
26.
Messmer S,
Franke A,
Paro R:
Analysis of the functional role of the Polycomb chromo domain in Drosophila melanogaster.
Genes Dev
6:1241,
1992[Abstract/Free Full Text]
27.
Paro R:
Imprinting a determined state into the chromatin of Drosophila [review].
Trends Genet
6:416,
1990[Medline]
[Order article via Infotrieve]
28.
Reuter G,
Giarre M,
Farah J,
Gausz J,
Spierer A,
Spierer P:
Dependence of position-effect variegation in Drosophila on dose of a gene encoding an unusual zinc-finger protein.
Nature
344:219,
1990[Medline]
[Order article via Infotrieve]
29.
Orlando V,
Paro R:
Mapping Polycomb-repressed domains in the bithorax complex using in vivo formaldehyde cross-linked chromatin.
Cell
75:1187,
1993[Medline]
[Order article via Infotrieve]
30.
McCall K,
Bender W:
Probes of chromatin accessibility in the Drosophila bithorax complex respond differently to Polycomb-mediated repression.
EMBO J
15:569,
1996[Medline]
[Order article via Infotrieve]
31.
Denell RE,
Frederick RD:
Homoeosis in Drosophila: A description of the Polycomb lethal syndrome.
Dev Biol
97:34,
1983[Medline]
[Order article via Infotrieve]
32.
Struhl G:
Role of the esc+ gene product in ensuring the selective expression of segment-specific homeotic genes in Drosophila.
J Embryol Exp Morphol
76:297,
1983[Medline]
[Order article via Infotrieve]
33.
Struhl G,
Akam M:
Altered distributions of Ultrabithorax transcripts in extra sex combs mutant embryos of Drosophila.
EMBO J
4:3259,
1985[Medline]
[Order article via Infotrieve]
34.
Wedeen C,
Harding K,
Levine M:
Spatial regulation of Antennapedia and bithorax gene expression by the Polycomb locus in Drosophila.
Cell
44:739,
1986[Medline]
[Order article via Infotrieve]
35.
Castelli-Gair JE,
Garcia-Bellido A:
Interactions of Polycomb and trithorax with cis regulatory regions of Ultrabithorax during the development of Drosophila melanogaster.
EMBO J
9:4267,
1990[Medline]
[Order article via Infotrieve]
36.
Pirrotta V,
Rastelli L:
White gene expression, repressive chromatin domains and homeotic gene regulation in Drosophila [review].
Bioessays
16:549,
1994[Medline]
[Order article via Infotrieve]
37.
Adler PN,
Martin EC,
Charlton J,
Jones K:
Phenotypic consequences and genetic interactions of a null mutation in the Drosophila Posterior Sex Combs gene.
Dev Genet
12:349,
1991[Medline]
[Order article via Infotrieve]
38.
Dura JM,
Ingham P:
Tissue- and stage-specific control of homeotic and segmentation gene expression in Drosophila embryos by the polyhomeotic gene.
Development
103:733,
1988[Abstract/Free Full Text]
39.
Moazed D,
O'Farrell PH:
Maintenance of the engrailed expression pattern by Polycomb group genes in Drosophila.
Development
116:805,
1992[Abstract]
40.
Smouse D,
Goodman C,
Mahowald A,
Perrimon N:
Polyhomeotic: A gene required for the embryonic development of axon pathways in the central nervous system of Drosophila.
Genes Dev
2:830,
1988[Abstract/Free Full Text]
41.
Gateff E:
The genetics and epigenetics of neoplasms in Drosophila [review].
Biol Rev Cambridge Phil Soc
53:123,
1978[Medline]
[Order article via Infotrieve]
42.
Gateff E,
Mechler BM:
Tumor-suppressor genes of Drosophila melanogaster [review].
Crit Rev Oncogen
1:221,
1989[Medline]
[Order article via Infotrieve]
43. van der Lugt NM, Domen J, Linders K, van Roon M, Robanus-Maandag
E, te Riele H, van der Valk M, Deschamps J, Sofroniew M, van Lohuizen
M, et al: Posterior transformation, neurological abnormalities, and severe hematopoietic defects in mice with a targeted
deletion of the bmi-1 proto-oncogene. Genes Dev 8:757, 1994
44.
Hobert O,
Jallal B,
Ullrich A:
Interaction of Vav with ENX-1, a putative transcriptional regulator of homeobox gene expression.
Mol Cell Biol
16:3066,
1996[Abstract]
45.
Thorsteinsdottir U,
Sauvageau G,
Hough MR,
Lawrence HJ,
Largman C,
Humphries RK:
Overexpression of HOXA10 in murine hematopoietic cells perturbs both myeloid and lymphoid differentiation and leads to acute myeloid leukemia.
Mol Cell Biol
17:495,
1997[Abstract]
46.
Sauvageau G,
Thorsteinsdottir U,
Hough MR,
Hugo P,
Lawrence HJ,
Largman C,
Humphries RK:
Over-expression of HOXB3 in hematopoietic cells causes defective lymphoid development and progressive myeloproliferation.
Immunity
6:13,
1997[Medline]
[Order article via Infotrieve]
47.
Sauvageau G,
Lansdorp PM,
Eaves CJ,
Hogge DE,
Dragowska WH,
Reid DS,
Largman C,
Lawrence HJ,
Humphries RK:
Differential expression of homeobox genes in functionally distinct CD34+ subpopulations of human bone marrow cells.
Proc Natl Acad Sci USA
91:12223,
1994[Abstract/Free Full Text]
48.
Perkins A,
Kongsuwan K,
Visvader J,
Adams JM,
Cory S:
Homeobox gene expression plus autocrine growth factor production elicits myeloid leukemia.
Proc Natl Acad Sci USA
87:8398,
1990[Abstract/Free Full Text]
49.
Perkins AC,
Cory S:
Conditional immortalization of mouse myelomonocytic, megakaryocytic and mast cell progenitors by the Hox-2.4 homeobox gene.
EMBO J
12:3835,
1993[Medline]
[Order article via Infotrieve]
50.
Nakamura T,
Largaespada DA,
Lee MP,
Johnson LA,
Ohyashiki K,
Toyama K,
Chen SJ,
Willman CL,
Chen I-M,
Feinberg AP,
Jenkins NA,
Copeland NG,
Shaughnessy JD:
Fusion of the nucleoporin gene NUP98 to HOXA9 by the chromosome translocation t(7;11)(p15; p15) in human myeloid leukaemia.
Nat Genet
12:154,
1996[Medline]
[Order article via Infotrieve]
51.
Nakamura T,
Largaespada DA,
Shaughnessy JD,
Jenkins NA,
Copeland NG:
Cooperative activation of Hoxa and Pbx1-related genes in murine myeloid leukaemias.
Nat Genet
12:149,
1996[Medline]
[Order article via Infotrieve]
52.
Lansdorp PM,
Sutherland HJ,
Eaves CJ:
Selective expression of CD45 isoforms on functional subpopulations of CD34+ hemopoietic cells from human bone marrow.
J Exp Med
172:363,
1990[Abstract/Free Full Text]
53.
Brady G,
Barbara M,
Iscove N:
Representative in vitro cDNA amplification from individual hemopoietic cells and colonies.
Methods Mol Cell Biol
2:1,
1990
54.
Kanno M,
Hasegawa M,
Ishida A,
Isono K,
Taniguchi M:
mel-18, a Polycomb group-related mammalian gene, encodes a transcriptional negative regulator with tumor suppressive activity.
EMBO J
14:5672,
1995[Medline]
[Order article via Infotrieve]
55.
Sauvageau G,
Thorsteinsdottir U,
Eaves CJ,
Lawrence HJ,
Largman C,
Lansdorp PM,
Humphries RK:
Overexpression of HOXB4 in hematopoietic cells causes the selective expansion of more primitive populations in vitro and in vivo.
Genes Dev
9:1753,
1995[Abstract/Free Full Text]

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
L. Jiang, J. Li, and L. Song
Bmi-1, stem cells and cancer
Acta Biochim Biophys Sin,
July 1, 2009;
41(7):
527 - 534.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. V. Glinsky
"Stemness" Genomics Law Governs Clinical Behavior of Human Cancer: Implications for Decision Making in Disease Management
J. Clin. Oncol.,
June 10, 2008;
26(17):
2846 - 2853.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Rizo, B. Dontje, E. Vellenga, G. de Haan, and J. J. Schuringa
Long-term maintenance of human hematopoietic stem/progenitor cells by expression of BMI1
Blood,
March 1, 2008;
111(5):
2621 - 2630.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Ritou, M. Bai, and S. D. Georgatos
Variant-specific patterns and humoral regulation of HP1 proteins in human cells and tissues
J. Cell Sci.,
October 1, 2007;
120(19):
3425 - 3435.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Silva, J. M. Garcia, C. Pena, V. Garcia, G. Dominguez, D. Suarez, F. I. Camacho, R. Espinosa, M. Provencio, P. Espana, et al.
Implication of Polycomb Members Bmi-1, Mel-18, and Hpc-2 in the Regulation of p16INK4a, p14ARF, h-TERT, and c-Myc Expression in Primary Breast Carcinomas
Clin. Cancer Res.,
December 1, 2006;
12(23):
6929 - 6936.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Chagraoui, S. L. Niessen, J. Lessard, S. Girard, P. Coulombe, M. Sauvageau, S. Meloche, and G. Sauvageau
E4F1: a novel candidate factor for mediating BMI1 function in primitive hematopoietic cells
Genes & Dev.,
August 1, 2006;
20(15):
2110 - 2120.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. M. Kamminga, L. V. Bystrykh, A. de Boer, S. Houwer, J. Douma, E. Weersing, B. Dontje, and G. de Haan
The Polycomb group gene Ezh2 prevents hematopoietic stem cell exhaustion
Blood,
March 1, 2006;
107(5):
2170 - 2179.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Ravandi and Z. Estrov
Eradication of Leukemia Stem Cells as a New Goal of Therapy in Leukemia
Clin. Cancer Res.,
January 15, 2006;
12(2):
340 - 344.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Nowak, K. Kerl, D. Fehr, C. Kramps, C. Gessner, K. Killmer, B. Samans, B. Berwanger, H. Christiansen, and W. Lutz
BMI1 is a target gene of E2F-1 and is strongly expressed in primary neuroblastomas.
Nucleic Acids Res.,
January 1, 2006;
34(6):
1745 - 1754.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M Hinkins, J Huntriss, D Miller, and H M Picton
Expression of Polycomb-group genes in human ovarian follicles, oocytes and preimplantation embryos
Reproduction,
December 1, 2005;
130(6):
883 - 888.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Kindler
Postnatal stem cell survival: does the niche, a rare harbor where to resist the ebb tide of differentiation, also provide lineage-specific instructions?
J. Leukoc. Biol.,
October 1, 2005;
78(4):
836 - 844.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. V. Molofsky, S. He, M. Bydon, S. J. Morrison, and R. Pardal
Bmi-1 promotes neural stem cell self-renewal and neural development but not mouse growth and survival by repressing the p16Ink4a and p19Arf senescence pathways
Genes & Dev.,
June 15, 2005;
19(12):
1432 - 1437.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Miyazaki, H. Kawamoto, Y. Kato, M. Itoi, K. Miyazaki, K. Masuda, S. Tashiro, H. Ishihara, K. Igarashi, T. Amagai, et al.
Polycomb Group Gene mel-18 Regulates Early T Progenitor Expansion by Maintaining the Expression of Hes-1, a Target of the Notch Pathway
J. Immunol.,
March 1, 2005;
174(5):
2507 - 2516.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Bijl, M. Sauvageau, A. Thompson, and G. Sauvageau
High incidence of proviral integrations in the Hoxa locus in a new model of E2a-PBX1-induced B-cell leukemia
Genes & Dev.,
January 15, 2005;
19(2):
224 - 233.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. M. Raaphorst, M. Vermeer, E. Fieret, T. Blokzijl, D. Dukers, R. G.A.B. Sewalt, A. P. Otte, R. Willemze, and C. J.L.M. Meijer
Site-Specific Expression of Polycomb-Group Genes Encoding the HPC-HPH/PRC1 Complex in Clinically Defined Primary Nodal and Cutaneous Large B-Cell Lymphomas
Am. J. Pathol.,
February 1, 2004;
164(2):
533 - 542.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Boccuni, D. MacGrogan, J. M. Scandura, and S. D. Nimer
The Human L(3)MBT Polycomb Group Protein Is a Transcriptional Repressor and Interacts Physically and Functionally with TEL (ETV6)
J. Biol. Chem.,
April 18, 2003;
278(17):
15412 - 15420.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Mayotte, D.-C. Roy, J. Yao, E. Kroon, and G. Sauvageau
Oncogenic interaction between BCR-ABL and NUP98-HOXA9 demonstrated by the use of an in vitro purging culture system
Blood,
December 1, 2002;
100(12):
4177 - 4184.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Remillieux-Leschelle, P. Santamaria, and N. B. Randsholt
Regulation of Larval Hematopoiesis in Drosophila melanogaster: A Role for the multi sex combs Gene
Genetics,
November 1, 2002;
162(3):
1259 - 1274.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. S. Levine, A. Weiss, H. Erdjument-Bromage, Z. Shao, P. Tempst, and R. E. Kingston
The Core of the Polycomb Repressive Complex Is Compositionally and Functionally Conserved in Flies and Humans
Mol. Cell. Biol.,
September 1, 2002;
22(17):
6070 - 6078.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. J. van Kemenade, F. M. Raaphorst, T. Blokzijl, E. Fieret, K. M. Hamer, D. P. E. Satijn, A. P. Otte, and C. J. L. M. Meijer
Coexpression of BMI-1 and EZH2 polycomb-group proteins is associated with cycling cells and degree of malignancy in B-cell non-Hodgkin lymphoma
Blood,
June 15, 2001;
97(12):
3896 - 3901.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. M. Raaphorst, A. P. Otte, F. J. van Kemenade, T. Blokzijl, E. Fieret, K. M. Hamer, D. P. E. Satijn, and C. J. L. M. Meijer
Distinct BMI-1 and EZH2 Expression Patterns in Thymocytes and Mature T Cells Suggest a Role for Polycomb Genes in Human T Cell Differentiation
J. Immunol.,
May 15, 2001;
166(10):
5925 - 5934.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Beà, F. Tort, M. Pinyol, X. Puig, L. Hernández, S. Hernández, P. L. Fernández, M. van Lohuizen, D. Colomer, and E. Campo
BMI-1 Gene Amplification and Overexpression in Hematological Malignancies Occur Mainly in Mantle Cell Lymphomas
Cancer Res.,
March 1, 2001;
61(6):
2409 - 2412.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
F. M. Raaphorst, F. J. van Kemenade, T. Blokzijl, E. Fieret, K. M. Hamer, D. P. E. Satijn, A. P. Otte, and C. J. L. M. Meijer
Coexpression of BMI-1 and EZH2 Polycomb Group Genes in Reed-Sternberg Cells of Hodgkin's Disease
Am. J. Pathol.,
September 1, 2000;
157(3):
709 - 715.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. M. Raaphorst, F. J. van Kemenade, E. Fieret, K. M. Hamer, D. P. E. Satijn, A. P. Otte, and C. J. L. M. Meijer
Cutting Edge: Polycomb Gene Expression Patterns Reflect Distinct B Cell Differentiation Stages in Human Germinal Centers
J. Immunol.,
January 1, 2000;
164(1):
1 - 4.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. D. Hanson, J. L. Hess, B. D. Yu, P. Ernst, M. van Lohuizen, A. Berns, N. M. T. van der Lugt, C. S. Shashikant, F. H. Ruddle, M. Seto, et al.
Mammalian Trithorax and Polycomb-group homologues are antagonistic regulators of homeotic development
PNAS,
December 7, 1999;
96(25):
14372 - 14377.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Lessard, A. Schumacher, U. Thorsteinsdottir, M. van Lohuizen, T. Magnuson, and G. Sauvageau
Functional antagonism of the Polycomb-Group genes eed and Bmi1 in hemopoietic cell proliferation
Genes & Dev.,
October 15, 1999;
13(20):
2691 - 2703.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
J. Voncken, D Schweizer, L Aagaard, L Sattler, M. Jantsch, and M van Lohuizen
Chromatin-association of the Polycomb group protein BMI1 is cell cycle-regulated and correlates with its phosphorylation status
J. Cell Sci.,
January 12, 1999;
112(24):
4627 - 4639.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
D. P. E. Satijn and A. P. Otte
RING1 Interacts with Multiple Polycomb-Group Proteins and Displays Tumorigenic Activity
Mol. Cell. Biol.,
January 1, 1999;
19(1):
57 - 68.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|