|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 91 No. 4 (February 15), 1998:
pp. 1341-1354
Altered Interleukin-12 Responsiveness in Th1 and Th2 Cells Is
Associated With the Differential Activation of STAT5 and STAT1
By
Jared A. Gollob,
Erin A. Murphy,
Sudipta Mahajan,
Claudia P. Schnipper,
Jerome Ritz, and
David A. Frank
From the Department of Adult Oncology, Dana-Farber Cancer Institute,
Department of Medicine, Harvard Medical School, Boston, MA.
 |
ABSTRACT |
T-cell activation in response to interleukin-12 (IL-12) is mediated
through signaling events that include the tyrosine phosphorylation of
STAT4. IL-12 responsiveness and the ability of IL-12 to activate STAT4
is different in T cells induced to differentiate into a Th1 or Th2
phenotype. In this report, we show that STAT5, STAT1 , and STAT1 ,
in addition to STAT4, are tyrosine phosphorylated in response to IL-12
in phytohemagglutinin (PHA)-activated human T cells. To understand how
the activation of these STATs contributes to T-cell IL-12
responsiveness, we analyzed the IL-12-induced activation of STAT5 and
STAT1 in T cells stimulated to undergo Th1 or Th2 differentiation. The
IL-12-induced tyrosine phosphorylation of STAT5 and STAT1, but not
STAT4, is augmented in T cells activated into Th1 cells with PHA + interferon- (IFN- ) compared with T cells activated with PHA
alone. STAT5 DNA binding induced by IL-12 is also augmented in T cells
activated with PHA + IFN- compared with T cells activated with PHA
alone, whereas STAT4 DNA binding is not increased. In contrast, the
IL-12-induced activation of these STATs is inhibited in T cells
activated into Th2 cells with PHA + IL-4. The enhancement of IL-12
signaling by IFN- is not a direct effect of IFN- on T cells, but
rather is mediated by IL-12 that is produced by antigen-presenting
cells in response to IFN- . This positive autoregulatory effect of
IL-12 on the activation of select STATs correlates with an increase in
T-cell IFN- production in response to IL-12. These findings suggest that the activation of STAT5 and STAT1 may augment select
STAT4-dependent functional responses to IL-12 in Th1 cells.
 |
INTRODUCTION |
INTERLEUKIN-12 (IL-12) is a heterodimeric
cytokine produced by antigen-presenting cells (APCs)1-3
that stimulates proliferation,4 cytolytic
activity,5,6 and interferon- (IFN- )
production7 by T and natural killer (NK) cells. IL-12 also
promotes the development of T helper type 1 (Th1) cells that produce
IFN- and IL-2 and augment cellular immune responses.8,9
Lymphocyte responsiveness to IL-12 is dependent to a considerable
extent on the expression of high-affinity IL-12
receptors.10-12 Whereas the low-affinity binding sites
detected on activated T and NK cells are composed of the low-affinity
IL-12R 1 subunit alone,12,13 high-affinity binding is
mediated through the combination of IL-12R 1 and at least one
additional low-affinity subunit.12 A second low-affinity IL-12R subunit, designated IL-12R 2, was recently cloned and appears to be vital to IL-12 signaling in that it forms a high-affinity receptor in combination with IL-12R 1 in cotransfected Cos cells and
has a cytoplasmic domain that contains three tyrosine
residues.14 Furthermore, the expression of IL-12R 2
appears to be necessary for the activation of STAT4 by
IL-12.15,16
Upon binding to its receptor, IL-12 stimulates the tyrosine
phosphorylation of the Jak2 and Tyk2 protein tyrosine kinases in T and
NK cells.17 This is in distinction to IL-2, which instead activates Jak1 and Jak3.18 IL-12 also induces the tyrosine
phosphorylation of STAT4 in T and NK cells,19 an event that
so far appears to be unique to IL-12 and IFN-
stimulation.20 However, like IL-2, IL-12 also activates
STAT319 and perhaps STAT121 as well. IL-2
activates STAT5,22 but it is not known whether IL-12 is also capable of activating STAT5. Although IL-12 activates multiple STATs, the main functional effects of IL-12 on T and NK cells are lost
in mice lacking the STAT4 gene.23 This suggests that STAT4
is necessary for IL-12 signaling. However, because the response to
IL-12 in STAT1 and/or STAT3 knockout mice has not yet been analyzed, it is not clear how and to what extent these other STATs contribute to lymphocyte IL-12 responsiveness.
Apart from experiments using STAT4 knockout mice, information regarding
both the role of Jaks and STATs and the role of IL-12 receptors in
mediating the functional effects of IL-12 has been gained through
observing the alterations in T-cell IL-12 responsiveness that occur as
part of Th1 and Th2 development. For example, murine CD4+
T-cell clones stimulated to undergo Th2 differentiation in the presence
of antigen plus IL-4 lose the ability to produce IFN- in response to
IL-12.21 This impairment of IL-12 function is accompanied
by the loss of IL-12-induced Jak2 and STAT4 tyrosine phosphorylation,
suggesting that these are both integral components of IL-12 signaling
required for the induction of T-cell IFN- production. Human T cells
activated with the mitogen phytohemagglutinin (PHA) upregulate the
expression of high- and low-affinity IL-12 receptors and respond to
IL-12. However, when IL-4 is present during activation with PHA, T
cells are unable to upregulate the expression of high-affinity IL-12
receptors and subsequently respond poorly to IL-12.12 In
contrast, when IFN- , a cytokine that promotes Th1 development, is
present during PHA activation, the expression of high-affinity IL-12
receptors is augmented.12 This high-affinity receptor
upregulation is accompanied by a heightened production of IFN- in
response to IL-12. Because neither IL-4 nor IFN- affect the
expression of IL-12R 1 on T cells activated with PHA,12
their opposing effects on high-affinity IL-12 receptor expression are
likely due to modulation of expression of either the IL-12R 2 subunit
and/or a third as yet undiscovered IL-12R subunit.
Support for the hypothesis that IL-4 and IFN- have opposing effects
on IL-12R 2 expression comes from a recent report using Th clones
from transgenic mice that showed that the stimulation of Th cells
through the TCR in the presence of IL-4, leading to Th2 development,
prevented the transcription of the IL-12R 2 subunit gene while
leaving IL-12R 1 gene transcription unaffected.15 This
loss of IL-12R 2 gene transcription was accompanied by the inability
of IL-12 to activate STAT4. In contrast, IL-12R 2 gene transcription
could be restored to Th2 clones developing in the presence of IL-4
through the simultaneous stimulation with IFN- . However, in another
recent study using human Th clones,16 IL-4 was also able to
inhibit IL-12R 2 mRNA production, but this effect could not be
overcome with IFN- . Interestingly, IL-12 and IFN- were able to
override the inhibition of IL-12R 2 gene transcription in
IL-4-stimulated human Th clones. Although neither of these studies
explored whether IFN- alone, in the absence of IL-12 or IL-4, can
upregulate IL-12R 2 expression during the activation of naive T cells
through the TCR, they suggested that there might be important
differences between the human and murine systems regarding the
interactions between regulatory cytokines involved in the control of
high-affinity IL-12 receptor expression on T cells.
Because IL-12 binding studies have suggested that IL-4 and IFN- both
appear to be capable of altering T-cell IL-12 responsiveness by
differentially modulating the expression of one or more IL-12 receptor
subunits that are critical for high-affinity IL-12 binding on human T
cells, we examined the impact of such changes in receptor expression on
IL-12 signaling to provide insight into which Jaks and STATs are used
by T cells to maximize the functional effects of IL-12. In this report,
we show that STAT5, STAT1 , and STAT1 , in addition to STAT4, are
tyrosine phosphorylated in response to IL-12 in T cells derived from
the activation of peripheral blood mononuclear cells
(PBMC) with PHA. The IL-12-induced activation of STAT1
and STAT5, but not STAT4, is greatly augmented in T cells activated
with PHA + IFN- , as is the activation of Jak2 and Tyk2. In contrast,
the activation of these components of IL-12 signaling is inhibited in T
cells activated with PHA + IL-4. The observed effect of IFN- on
T-cell IL-12 signaling is mediated by IL-12 that is produced by
PHA-activated PBMC in response to IFN- . This autoregulatory effect
of IL-12 on IL-12 signaling correlates with an enhancement of both
high-affinity IL-12 receptor expression and IL-12-induced IFN-
production, but not with any significant enhancement of IL-12-induced
proliferation. These findings suggest that the activation of STAT5 and
STAT1 may be a mechanism through which Th1 cells can augment the
magnitude of select functional responses to IL-12.
 |
MATERIALS AND METHODS |
Cytokines and Antibodies
Recombinant human IL-4 (specific activity, 1 × 107
U/mg) and IFN- (specific activity, 4.75 × 107
U/mg) were purchased from Genzyme (Cambridge, MA). IL-2 (specific activity, 3.9 × 106 U/mL) was generously provided by
Amgen (Thousand Oaks, CA). Recombinant human IL-12 (specific activity,
1.7 × 107 U/mg) was generously provided by Dr Steven
Herrmann at Genetics Institute (Cambridge, MA). Neutralizing antibodies
to IL-12 (C8.6) and IFN- (25718.11) were purchased from Endogen
(Cambridge, MA) and R&D Systems (Minneapolis, MN), respectively.
Antibodies to Jak2, Jak3, and Tyk2 were purchased from Upstate
Biotechnology (Lake Placid, NY), and the antibodies to STAT4 and STAT5
were purchased from Santa Cruz Biotechnology, Inc (Santa Cruz, CA). The
antibody to STAT1 was purchased from Transduction Laboratories (Lexington, KY) and horseradish peroxidase (HRP)-conjugated rabbit antimouse and goat antirabbit antibodies were purchased from Calbiochem (San Diego, CA). The antiphosphotyrosine antibody (4G10) was a gift
from Dr Thomas Roberts (Dana-Farber Cancer Institute, Boston, MA). The
phospho-STAT1 antibody recognizes the tyrosine-phosphorylated forms of
STAT1 and STAT1 and cross-reacts with the tyrosine-phosphorylated form of STAT5.24-26 The phospho-STAT5 antibody was raised
in rabbits to a phosphopeptide containing amino acids 687-698 of ovine
STAT5, with phosphotyrosine in position 694, and specifically
recognizes the tyrosine phosphorylated form of STAT5.
Isolation and Activation of T Cells
Whole blood was obtained through venipuncture from volunteer donors
ranging in age from 24 to 50 years. Experiments were repeated using
blood from different donors. PBMC were isolated from whole blood
through density gradient centifugation using Ficoll-Paque (Pharmacia
Biotech, Uppsala, Sweden). PBMC were cultured at a starting
concentration of 1 × 106 cells/mL in RPMI 1640 medium
(Sigma Chemical Co, St Louis, MO) containing 15% fetal calf serum (PAA
Laboratories, Newport Beach, CA), 2% L-glutamine, 1% sodium pyruvate,
1% gentamicin, and 1% penicillin-streptomycin. For activation, PHA
(Murex, Dartford, UK) was added to the culture medium at day 0 at a
concentration of 2.5 µg/mL. Where indicated, cytokines were added to
the cultures at the same time as the PHA, using either IFN- at 1,000 U/mL, IL-4 at 20 ng/mL, or IL-12 at a concentration of 1 pmol/L.
Neutralizing IFN- or IL-12 antibodies were also added at day 0 where
indicated, at concentrations of 5 µg/mL and 10 µg/mL, respectively.
Cells were cultured at 37°C in 5% CO2. Seventy-two to
96 hours after the start of activation, cells were routinely greater
than 95% CD3+CD56 , 0%
CD3 CD56+.
T-Cell Stimulation and Preparation of Whole Cell Lysates for
Immunoprecipitations and Western Blots
After activating T cells with PHA with or without cytokines and
antibodies, cells were acid-treated to remove any bound PHA and/or cytokine in a solution containing 10 mmol/L citrate, 140 mmol/L NaCl, and 50 µg/mL bovine serum albumin (BSA), pH 4.0, for 1 minute, washed with RPMI 1640 medium, and recultured for an additional
18 hours in starvation medium consisting of RPMI 1640 with 2.5% fetal
calf serum before use in stimulation experiments. Anti-IL-12 or
anti-IFN- antibodies were added again to the starvation medium
where indicated. On day 4 after the start of activation, cells were
washed and stimulated for 20 minutes at 37°C in a total volume of
800 µL using either medium alone (RPMI 1640 + 2.5% fetal calf serum)
or medium plus either 100 pmol/L IL-12 or 100 pmol/L IL-2. After
stimulation, cells were washed once with ice-cold phosphate-buffered
saline (PBS) and then lysed on ice for 20 minutes in lysis buffer
containing 1% NP-40, 50 mmol/L Tris, pH 8.0, 150 mmol/L NaCl, 2 mmol/L
EDTA, 2 µg/mL aprotinin, 100 µg/mL phenylmethylsulfonyl fluoride
(PMSF), 1 mmol/L sodium orthovanadate, and 1 mmol/L NaF. Aliquots of
whole cell lysates were mixed with an equal volume of 2× reducing
sample buffer and boiled, and proteins were resolved on a 7.5%
polyacrylamide gel. For immunoprecipitations, antibodies to Jak2, Jak3,
Tyk2, STAT4, or STAT5 were added to the lysates and incubated overnight
at 4°C. Antibody-protein complexes were then immunoprecipitated
from the lysates by adding protein A beads (Pharmacia Biotech) and
incubating with rotation at 4°C for 4 hours. The beads were washed
twice with ice-cold PBS and boiled in reducing sample buffer, and
precipitated proteins were resolved on a 7.5% polyacrylamide gel.
For Western blots, proteins were transferred to a nitrocellulose
membrane (Schleicher & Schuell, Keene, NH) by electroblotting, and
membranes were then blocked for 30 minutes in Tris-buffered saline
(TBS) containing 0.1% Tween-20 (BioRad, Hercules, CA) and either 5%
BSA (US Biochemicals, Cleveland, OH) or 5% nonfat dried milk.
Membranes were then incubated with dilutions of the indicated antibodies for 1 hour at room temperature, washed with TBS/Tween-20, incubated with either HRP-conjugated rabbit antimouse or goat antirabbit antibodies (diluted 1:10,000) for 1 hour, washed again, and
developed using ECL (Amersham Life Science, Buckinghamshire, UK). When
reprobed, membranes were first stripped by incubating in a solution
containing 2% sodium dodecyl sulfate, 100 mmol/L 2-mercaptoethanol
(2-ME), and 62.5 mmol/L Tris-HCl, pH 6.7, for 30 minutes
at 65°C.
Preparation of Nuclear Extracts
After cytokine stimulation, T cells were placed on ice, washed once
with cold PBS, resuspended in 5 mL of hypotonic buffer (10 mmol/L Tris,
pH 7.4, 10 mmol/L NaCl, 6 mmol/L MgCl2), and incubated on
ice for 5 minutes. Thereafter, the cells were centrifuged and
resuspended in 0.8 mL of hypotonic buffer containing 1 mmol/L -mercaptoethanol ( ME), 10 µg/mL PMSF, and 1 mmol/L sodium
orthovanadate. Cells were disrupted by shearing in a Dounce homogenizer
(type b pestle, 25 strokes), and the nuclei were collected by 10 seconds of centrifugation at 12,000g. The nuclear pellet was
washed once with hypotonic buffer, resuspended in 3 pellet volumes of
high salt buffer (20 mmol/L HEPES, pH 7.9, 420 mmol/L NaCl, 25%
glycerol, 1.5 mmol/L MgCl2, 0.2 mmol/L EDTA, 1 mmol/L
ME, 1 mmol/L sodium orthovanadate, and 10 µg/mL PMSF), and rocked
at 4°C for 30 minutes. Intact nuclei were removed by centrifugation
at 12,000g for 3 minutes at 4°C, and the supernatant was
recovered.
Electrophoretic Mobility Shift Assay (EMSA)
One microliter of nuclear extract was mixed with 1 ng of a
double-stranded 32P-labeled oligonucleotide derived from
the IFN responsive factor-1 (IRF-1) promoter (AGCCTGATTTCCCCGAAATGACGGC
and its complement) in 5 µL of binding buffer (25 mmol/L HEPES, pH
7.9, 100 µmol/L EGTA, 200 µmol/L MgCl2, 500 µmol/L
dithiothreitol, 1 µg/ µL BSA, 0.2 µg/µL poly dI:dC, 1% Ficoll,
and 0.1 µg/µL herring testis DNA). The incubation was performed at
room temperature for 20 minutes. Where designated, 1 µL of antibody
was added at the end of the binding reaction, and incubated at 4°C
for an additional 30 minutes. The products of the binding reaction were
then separated by electrophoresis on a 4% acrylamide gel in 0.2×
tris-borate/EDTA and visualized by autoradiography.
IL-12 Binding Assays
IL-12 was labeled with 125I (DuPont/New England Nuclear,
Wilmington, DE) using the Iodo-Bead (Pierce, Rockford, IL) method, as previously described.27 Day-4 activated T cells (2 × 106) were incubated for 2 hours on ice with concentrations
of [125I]-IL-12 ranging from 12 nmol/L to 30 pmol/L. To
calculate nonspecific binding (routinely 0.1% to 0.3% of total counts
added), T cells were first incubated with excess cold IL-12 for 1 hour
before adding the radiolabeled IL-12. After incubating cells with
radiolabeled IL-12, the bound IL-12 was separated from free IL-12 by
pelleting the cells through a mixture of silicone oil and paraffin oil
(81:19 ratio) for 1 minute at 10,000g. The amounts of bound and
free [125I]-IL-12 were measured using a gamma counter.
The number of specific bound counts was calculated by subtracting
nonspecific counts bound from total counts bound and converted to
molecules bound per cell. IL-12 binding was analyzed using the
Scatchard method.
Measurement of IFN- , IFN- , and IL-12
To assess IFN- production, PBMC were first activated for 96 hours
with PHA and, where indicated, antibodies and/or cytokines. Cells were then washed twice and plated in U-bottom wells at 3 × 104 cells/well with either medium alone or the indicated
concentrations of IL-12. Cells were incubated for 72 hours at 37°C,
supernatants were harvested, and the IFN- concentration was measured
using an enzyme-linked immunosorbent assay (ELISA; Endogen, Cambridge, MA). The sensitivity of the IFN- ELISA is less than 3 pg/mL.
To determine IFN- and IL-12 production, PBMC were cultured at a
starting concentration of 1 × 106 cells/mL in medium
containing either PHA alone or PHA + IFN- . Aliquots of culture
supernatants were harvested at 24, 48, and 72 hours. The IFN-
concentration was measured using an IFN- ELISA (Endogen), the
sensitivity of which is less than 3 pg/mL. The IL-12 concentration was
measured using an IL-12 ELISA (Endogen) that detects only the p70 IL-12
heterodimer. The sensitivity of the IL-12 ELISA is less than 3 pg/mL.
 |
RESULTS |
The IL-12-Induced Tyrosine Phosphorylation of STAT1 and STAT1 Is
Augmented in T Cells Activated With PHA + IFN-
There have been conflicting reports regarding whether IL-12 is able to
stimulate the tyrosine phosphorylation of STAT1 in T and NK cells.
Using murine CD4+ Th1 cell clones, one study showed that
the constitutive tyrosine phosphorylation of STAT1 in these cells was
augmented by IL-12,21 although there were no data regarding
which STAT1 isoform (STAT1 , STAT1 , or both) was being activated.
However, two other studies using either PHA activated human T
cells19 or human NK cells28 failed to
demonstrate the tyrosine phosphorylation of STAT1 in response to IL-12.
To determine whether IL-12 stimulates the tyrosine phosphorylation of
STAT1 and/or STAT1 in T cells, we activated human T cells
with PHA for 72 hours, rested them in starvation medium for 18 hours,
and then stimulated them with either IL-12 or IL-2. We then looked for
STAT1 activation in these stimulated T cells by performing a Western
blot on whole cell lysates with an antibody that recognizes the
tyrosine-phosphorylated forms of STAT1 , STAT1 , and STAT5. In T
cells activated with PHA, there is low-level constitutive activation of
STAT1 and STAT1 (Fig 1A and B, lane
1). With the addition of either IL-12 or IL-2, there is a clear
increase in the amount of tyrosine-phosphorylated STAT1 and STAT1
(lanes 2 and 3), showing that these cytokines activate both isoforms of
STAT1.

View larger version (61K):
[in this window]
[in a new window]

View larger version (30K):
[in this window]
[in a new window]
| Fig 1.
IFN- augments while IL-4 inhibits the IL-12-induced
tyrosine phosphorylation of STAT1 and STAT1 . PBMC were
cultured for 72 hours with PHA, PHA + 1,000 U/mL IFN- (A),
or PHA + 20 ng/mL IL-4 (B); rested overnight in fresh medium
containing 2.5% fetal calf serum; and then stimulated for 20 minutes
with either medium alone (lanes 1 and 4), 100 pmol/L IL-12 (lanes 2 and
5), or 100 pmol/L IL-2 (lanes 3 and 6). Western blots were performed
with antibodies to phospho-STAT1 (A, upper panel, and B) or STAT1 (A, lower panel). Results are representative of five separate
experiments.
|
|
Because human T cells activated with PHA + IFN- demonstrate an
increase in the number of high-affinity IL-12 receptors and a
heightened response to IL-12 compared with T cells activated with PHA
alone, we examined whether the ability of IL-12 to activate STAT1 was
augmented in these IFN- -activated cells. The activation of T cells
with PHA + IFN- leads to an increase in the constitutive activation
of STAT1 and STAT1 (Fig 1A, lane 4). However, even after
normalizing for the increased basal activation of STAT1, the tyrosine
phosphorylation of STAT1 and STAT1 induced by IL-12 is
significantly greater in cells activated with PHA + IFN- (lane 5)
compared with cells activated with PHA alone (lane 2). IFN- does not
increase the total amount of STAT1 and STAT1 protein present
within the cells, as indicated by reprobing the membrane with a STAT1
antibody (Fig 1A, lower panel). In contrast to IL-12, the activation of
STAT1 by IL-2 is only minimally increased in the IFN- -treated T
cells (lane 6), suggesting that the effect of IFN- on cytokine
signaling is restricted to IL-12.
T cells activated with PHA + IL-4 fail to upregulate high-affinity
IL-12 receptors and respond poorly to IL-12. In these IL-4-treated cells, IL-12 does not induce an increase in the tyrosine
phosphorylation of STAT1 and STAT1 (Fig 1B, lane 5). This is not
due to the absence of STAT1, because similar amounts of STAT1 protein
are present within T cells treated with either PHA alone or PHA + IL-4
(data not shown). The specificity of this IL-4 effect for IL-12
signaling is demonstrated by the finding that IL-4 has no effect on the
IL-2-induced tyrosine phosphorylation of STAT1 (lane 6). This supports
the observation that the functional response to IL-2 remains intact
among T cells activated with PHA + IL-4.12
IL-12 Stimulates the Tyrosine Phosphorylation and DNA Binding of
STAT5 in T Cells Activated With PHA + IFN-
In addition to activating STAT1 and STAT3, IL-2 induces the tyrosine
phosphorylation of STAT5 in T and NK cells.22,28 The phospho-STAT1 antibody not only recognizes the tyrosine-phosphorylated forms of STAT1 and STAT1 , but also cross-reacts with the tyrosine phosphorylated form of STAT5. In cells stimulated with IL-2, a third
band migrating slower than STAT1 with a molecular weight of
approximately 93 kD is clearly visible (Fig 1A, lanes 3 and 6), and
represents the tyrosine-phosphorylated form of STAT5.26 However, this same band also appears to be present when cells are
stimulated with IL-12 (Fig 1A, lanes 2 and 5), suggesting that IL-12
may also be capable of activating STAT5.
To determine whether IL-12 can induce the tyrosine phosphorylation of
STAT5, T cells were activated with PHA for 72 hours, rested in
starvation medium for 18 hours, and stimulated with IL-12 or IL-2. A
Western blot was then performed on whole cell lysates using an antibody
that recognizes the tyrosine phosphorylated form of STAT5. Whereas IL-2
strongly activates STAT5 (Fig 2A, lane 3),
IL-12 also activates STAT5 (lane 2) but to a lesser degree than that
observed with IL-2. By contrast, in T cells activated with PHA + IFN- , there is a striking increase in IL-12-induced STAT5 tyrosine
phosphorylation (lane 5), with no significant change in the degree of
STAT5 activation by IL-2 (lane 6). Reprobing the membrane with a STAT5
antibody demonstrates that IFN- does not increase the total amount
of STAT5 present within the activated T cells (Fig 2A, lower panel).
Whereas STAT5 tyrosine phosphorylation induced by IL-12 is greatly
augmented in T cells activated with PHA + IFN- , in cells activated
with PHA + IL-4, IL-12 does not induce the tyrosine phosphorylation of
STAT5 above the basal level (lanes 7 and 8). The IL-2-induced
activation of STAT5 is unaffected by IL-4 (lane 9), showing that this
effect is restricted to IL-12 signaling.

View larger version (29K):
[in this window]
[in a new window]

View larger version (35K):
[in this window]
[in a new window]

View larger version (53K):
[in this window]
[in a new window]
| Fig 2.
The tyrosine phosphorylation and DNA binding of STAT5 in
response to IL-12 is enhanced in T cells activated with PHA + IFN- but inhibited in T cells activated with PHA + IL-4. (A) PBMC cultured in either PHA alone, PHA + IFN- , or PHA + IL-4 were
stimulated with medium alone (lanes 1, 4, and 7), IL-12 (lanes 2, 5, and 8), or IL-2 (lanes 3, 6, and 9). Western blots were performed with
antibodies to phospho-STAT5 (upper panel) or STAT5 (lower panel).
Results are representative of five separate experiments. (B) PBMC
cultured in either PHA alone or PHA + IFN- were
stimulated with medium alone (lanes 1 and 4), IL-12 (lanes 2 and 5), or
IL-2 (lanes 3 and 6). Cell lysates were immunoprecipitated with a STAT5 antibody, and Western blots were performed with antibodies to phosphotyrosine (upper panel), phospho-STAT5 (middle panel), or STAT5
(lower panel). Results are representative of three separate experiments. (C) PBMC were activated with PHA alone, PHA + IFN- , or PHA + IL-4 and then stimulated with the indicated cytokine. Nuclear lysates were then prepared and used in an EMSA with a 32P-labeled DNA probe consisting of a STAT-binding sequence
found within the IRF-1 gene promoter. Where indicated, 1 µL of a
STAT5 antibody was added to the binding reaction containing nuclear lysate and DNA probe. The arrow points to supershifted complexes. Similar results were obtained in two separate experiments.
|
|
To confirm the results obtained with the phospho-STAT5 antibody, T
cells were again activated with PHA or PHA + IFN- and stimulated
with IL-12 or IL-2. Immunoprecipitations were performed on lysates
using an antibody that recognizes both STAT5a and STAT5b, and the precipitated proteins were subjected to Western blotting using
a phosphotyrosine antibody. As shown in the upper panel of Fig 2B, the
results obtained are identical to those observed using whole cell
lysates and the phospho-STAT5 antibody (Fig 2A). Reprobing with the
STAT5 antibody (Fig 2B, lower panel) demonstrated that STAT5a is the
STAT5 isoform tyrosine phosphorylated in response to IL-12 and IL-2,
although a very small amount of STAT5b activation could be detected in
some experiments in response to IL-2 (data not shown). This absence of
STAT5b activation is not due to diminished STAT5b expression, because
activated T cells contain more STAT5b than STAT5a (Fig 2B, lower
panel). Reprobing with the phospho-STAT5 antibody (Fig 2B, middle
panel) confirmed the specificity of this antibody for the
tyrosine-phosphorylated form of STAT5.
As shown in Fig 2A and B, even in T cells activated with PHA + IFN- ,
the amount of STAT5 activated in response to IL-2 is significantly
greater than the amount activated in response to IL-12. To further
assess the functional significance of IL-12-induced STAT5 tyrosine
phosphorylation, we examined whether IL-12 induces STAT5 binding to a
32P-labeled DNA probe consisting of a STAT-binding sequence
found within the IRF-1 gene promoter. As shown in Fig 2C, both IL-2 and
IL-12 induce the formation of two similar complexes (A and B, lanes 2 and 3) that are not present in the control lane (lane 1). In addition,
IL-12 also induces the formation of two faster migrating complexes (d
and e, lane 3). In the presence of a STAT5 antibody, complex A induced
by IL-2 and IL-12 is supershifted (lanes 5 and 6), demonstrating that
complex A contains STAT5. Thus, IL-12 and IL-2 both stimulate not only
STAT5 tyrosine phosphorylation, but STAT5 DNA binding as well.
Consistent with the results obtained with Western blotting, STAT5
activation by IL-2 assessed through DNA binding is significantly
greater than IL-12-induced STAT5 activation. In addition, STAT5
activation by IL-12 is again augmented in T cells activated with PHA + IFN- (lane 9) compared with T cells activated with PHA alone (lane
3) and completely abrogated in T cells activated with PHA + IL-4 (lane
15).
The IL-12-Induced Tyrosine Phosphorylation of STAT5 in T Cells
Activated With PHA + IFN- Is Not Mediated By IL-2
Because IL-2 is known to activate STAT5, it was possible that IL-12 was
activating STAT5 indirectly by stimulating the secretion of IL-2 from
the IFN- -treated T cells. To determine whether IL-2 signaling was
responsible for the effect of IL-12 on STAT5 tyrosine phosphorylation,
we examined whether IL-12 stimulation of T cells activated with PHA + IFN- leads to the tyrosine phosphorylation of Jak3. The activation
of this kinase is a proximal event in IL-2 signaling mediated through
the c chain of the IL-2 receptor,18 but it
is not a component of signaling through the IL-12
receptor.17 Thus, the absence of Jak3 activation after
stimulation with IL-12 would exclude the possibility that STAT
activation seen with IL-12 stimulation was due in part to IL-2. IL-2
induces the tyrosine phosphorylation of Jak3 to a slightly greater
extent in T cells activated with PHA + IFN- compared with T cells
activated with PHA alone (Fig 3, lanes 3 and 6). However, whether T cells are activated with PHA alone or PHA + IFN- , IL-12 does not stimulate the tyrosine phosphorylation of
Jak3 (lanes 2 and 5). This demonstrates that the IL-12-induced
tyrosine phosphorylation of STAT5 in IFN- -treated cells
cannot be due to T cell-derived IL-2.

View larger version (15K):
[in this window]
[in a new window]
| Fig 3.
Jak3 is not tyrosine phosphorylated by IL-12 in T cells
activated with PHA + IFN- . PBMC cultured with either PHA alone or PHA + IFN- were stimulated for 20 minutes with either medium alone
(lanes 1 and 4), IL-12 (lanes 2 and 5), or IL-2 (lanes 3 and 6).
Immunoprecipitations were performed on whole cell lysates (30 to 40 × 106 cells/lane) with an antibody to Jak3, followed by a
Western blot with an antibody to phosphotyrosine. Results are
representative of two separate experiments.
|
|
The IL-12-Induced Tyrosine Phosphorylation and DNA Binding of
STAT4 Is Not Enhanced in T Cells Activated With PHA + IFN-
The mitogen activation of T cells in the presence of IFN- greatly
augments the ability of IL-12 to stimulate the tyrosine phosphorylation
of STAT1 and STAT5 without affecting the activation of these STATs by
IL-2. Given this, we examined whether STAT4 activation induced by IL-12
was similarly modulated by IFN- . IL-12 induces the tyrosine
phosphorylation of STAT4 in PHA-activated T cells
(Fig 4A, lane 2), whereas IL-2 does not
(lane 3). Two isoforms of STAT4 are visible after activation with
IL-12. A previous study has shown that the slower migrating form of
STAT4 results from the IL-12-induced serine phosphorylation of STAT4,
whereas tyrosine phosphorylation does not affect the electrophoretic
mobility of STAT4.20 Both isoforms are tyrosine
phosphorylated in response to IL-12 in cells activated with PHA alone
(lane 2). The magnitude of STAT4 tyrosine phosphorylation by IL-12 is
marginally enhanced in T cells activated by PHA + IFN- (lane 5),
contrasting with the pronounced augmentation of STAT1 and STAT5
activation in response to IL-12 in PHA + IFN- -treated T cells.
Furthermore, there appears to be no increase in the IL-12-induced
serine phosphorylation of STAT4 in T cells activated with PHA + IFN-
compared with cells activated with PHA alone (lanes 2 and 5, lower
panel). In contrast with IL-12, IL-2 is unable to activate STAT4 in
IFN- -treated cells (lane 6).

View larger version (42K):
[in this window]
[in a new window]

View larger version (62K):
[in this window]
[in a new window]
| Fig 4.
IL-12-induced STAT4 tyrosine phosphorylation and DNA
binding is not augmented by IFN- but is partially inhibited by IL-4. (A) PBMC were cultured with either PHA alone or PHA + IFN- and then stimulated with medium alone (lanes 1 and 4), IL-12 (lanes 2 and
5), or IL-2 (lanes 3 and 6). Immunoprecipitations were performed on
whole cell lysates with an antibody to STAT4, followed by Western blots
with an antiphosphotyrosine antibody (upper panel) or an antibody to
STAT4 (lower panel). Results are representative of three separate
experiments. (B) PBMC were cultured with either PHA alone or PHA + IL-4 and stimulated with medium alone (lanes 1 and 3) or IL-12 (lanes 2 and 4). STAT4 was then immunoprecipitated from cell lysates as in (A),
and Western blots were performed as described in (A). Results are
representative of three separate experiments. (C) PBMC were activated
with PHA, PHA + IFN- , or PHA + IL-4 and then stimulated with the
indicated cytokine. Nuclear lysates were then prepared and used in an
EMSA with a 32P-labeled DNA probe consisting of a
STAT-binding sequence found within the promoter region of the IRF-1
gene. Where indicated, 1 µL of a STAT4 antibody was added to the
binding reaction containing nuclear lysate and DNA probe. Similar
results were obtained in two separate experiments.
|
|
Activation of T cells in the presence of IL-4 has the opposite effect
from that observed with IFN- , leading to the inhibition of STAT4
tyrosine and serine phosphorylation in response to IL-12 (Fig 4B, lanes
2 and 4, upper and lower panels). Whereas STAT4 tyrosine and serine
phosphorylation in response to IL-12 is greatly diminished, it is not
completely extinguished in these IL-4-treated T cells.
The lack of any augmentation of IL-12-induced STAT4 tyrosine
phosphorylation in T cells activated with PHA + IFN- was confirmed in an analysis of IL-12-induced STAT4 DNA binding. IL-12 stimulation of T cells activated with PHA alone induces the formation of 2 complexes (Fig 4C, d and e, lane 3) that are not induced in the untreated or IL-2-treated cells (lanes 1 and 2). The addition of a
STAT4 antibody results in the loss of these complexes (lane 6),
demonstrating that they contain STAT4. The same STAT4-containing complexes are induced by IL-12 in T cells activated with PHA + IFN-
(lane 9), but the signal intensity is no different from that observed
in T cells activated with PHA alone (lane 3). In contrast, the signal
intensity of the IL-12-induced STAT5-DNA complex (A) is significantly
greater in T cells activated with PHA + IFN- (lanes 9 and 12)
compared with T cells activated with PHA alone (lanes 3 and 6).
Therefore, the analysis of STAT tyrosine phosphorylation and DNA
binding in response to IL-12 demonstrates that IFN- augments
IL-12-induced STAT5 activation but does not affect IL-12-induced
STAT4 activation. In addition, the DNA binding studies also confirm
that IL-4 completely abrogates IL-12-induced STAT5 activation (lanes
15 and 18) but only partially inhibits IL-12-induced STAT4 activation
(lane 15).
IFN- Augments and IL-4 Inhibits the IL-12-Induced Activation
of Jak2 and Tyk2 in T Cells
In addition to activating STATs, IL-12 induces the tyrosine
phosphorylation of the Janus family tyrosine kinases Jak2 and Tyk2. A
recent report demonstrated that Jak2 is associated with the cytoplasmic
domain of IL-12R 2, whereas Tyk2 is associated with
IL-12R 1.29 The binding of IL-12 to IL-12 receptors
presumably leads to the heterodimerization of IL-12R 1 + IL-12R 2,
thereby activating their associated Jaks. These receptor-associated
tyrosine kinases would then phosphorylate tyrosine residues on the
cytoplasmic domains of one or more IL-12R subunits, allowing certain
STATs to dock via their SH2 domains and in turn become phosphorylated on conserved tyrosine residues.30
Having shown that IFN- augments the IL-12-induced activation of
STAT5 and STAT1, whereas IL-4 inhibits the activation of these same
STATs, we wanted to determine whether there were similar changes in the
IL-12-induced activation of Jak2 and Tyk2. The IL-12-induced
activation of Jak2 is greatly augmented in T cells activated with PHA + IFN- (Fig 5A, lane 4) compared with T
cells activated with PHA alone (lane 2). In addition, the tyrosine
phosphorylation of Tyk2 by IL-12 is also significantly increased in the
IFN- -treated T cells (Fig 5B, lanes 2 and 4). This increase in Jak2
and Tyk2 activation by IL-12 in IFN- -treated cells is not due to an
increase in the amount of Jak2 or Tyk2 protein (Fig 5A and B, lower
panels). In contrast with IFN- , the IL-12-induced activation of
both Jak2 and Tyk2 is diminished but not abolished in T cells activated with PHA + IL-4 compared with T cells activated with PHA alone (Fig 5C
and D).

View larger version (47K):
[in this window]
[in a new window]

View larger version (42K):
[in this window]
[in a new window]
| Fig 5.
Activation of T cells with PHA + IFN- augments
whereas activation with PHA + IL-4 inhibits the IL-12-induced
tyrosine phosphorylation of Jak2 and Tyk2. PBMC were cultured with
either PHA, PHA + IFN- (A and B), or PHA + IL-4 (C and D), and T
cells were then stimulated with medium alone (lanes 1 and 3) or IL-12
(lanes 2 and 4). Immunoprecipitations were performed on whole cell
lysates with an antibody to Jak2 (A and C) or Tyk2 (B and D) followed
by Western blots using an antiphosphotyrosine antibody (upper panels)
or antibodies to either Jak2 or Tyk2 (lower panels). Each result is
representative of two separate experiments.
|
|
The Effect of IFN- on IL-12 Signaling and High-Affinity IL-12
Receptor Expression Is Mediated Indirectly Through IL-12
The activated T cells used in these experiments were derived from PBMC
stimulated with PHA alone or PHA plus added cytokines. After 72 to 96 hours of activation, these cultured PBMC are greater than 95% T cells.
However, for the first 48 hours, these cultures contain normal
complements of NK cells, B cells, and monocytes. This raised the
possibility that the effect of IFN- on IL-12 signaling in T cells
might not be a direct effect of IFN- on T cells, but rather could be
mediated by another cytokine produced in response to the added IFN- .
It has been shown that IL-12 and IFN- can upregulate IL-12R 2 gene
expression in human T-cell clones, whereas IFN-
cannot.16 Thus, it was important to determine whether
IFN- was stimulating IL-12 production (presumably from monocytes)
and/or IFN- production during the activation of PBMC with
PHA and, if so, whether these cytokines rather than the IFN- were
responsible for the observed changes in IL-12 signaling.
No IL-12 could be detected in cultures of PBMC activated with PHA
alone, but small amounts (8 to 26 pg/mL, or approximately 0.1 pmol/L)
of IL-12 are present in cultures of PBMC activated with both PHA and
1,000 U/mL IFN- (Table 1). No IFN-
could be detected in cultures of PBMC activated with PHA alone or PHA + IFN- (Table 1). Because activated T cells are capable of responding to as little as 0.1 pmol/L IL-12,31 we next investigated
whether neutralization of this small amount of IL-12 would alter the
ability of IFN- to modulate IL-12 signaling.
PBMC were cultured with either PHA alone, PHA + IFN- , or PHA + IFN- + a neutralizing IL-12 antibody, and the ability of IL-12 to
activate STAT5 and STAT1 was assessed. Whereas the IL-12-induced tyrosine phosphorylation of both STAT5 and STAT1 is greatly augmented in T cells activated with PHA + IFN- compared with T cells activated with PHA alone, this effect of IFN- is inhibited by the neutralizing IL-12 antibody (Fig 6A, lanes 5 and 8). The
IL-2-induced activation of STAT5 and STAT1 is not affected by the
neutralizing IL-12 antibody (lanes 6 and 9). This suggests that during
the activation of PBMC with PHA + IFN- , a small amount of endogenous
IL-12 (on the order of 0.1 pmol/L) is responsible for promoting the
development of T cells in which IL-12 can activate STAT5 and STAT1, in
addition to STAT4.

View larger version (58K):
[in this window]
[in a new window]

View larger version (48K):
[in this window]
[in a new window]
| Fig 6.
The enhancement of IL-12-induced STAT5 and STAT1
activation by IFN- is dependent on IL-12. (A) PBMC were cultured
with either PHA alone, PHA + IFN- , or PHA + IFN- + a
neutralizing IL-12 antibody (10 µg/mL), and T cells were then
stimulated with medium alone (lanes 1, 4, and 7), IL-12 (lanes 2, 5, and 8), or IL-2 (lanes 3, 6, and 9). Western blots were performed with
antibodies to phospho-STAT5 and phosphoSTAT1 (upper panels), as well as
with antibodies to STAT5 and STAT1 (lower panels). Results are
representative of two separate experiments. (B) PBMC were cultured with
PHA alone, PHA + IL-12 1 pmol/L, or PHA + IL-12 1 pmol/L + a
neutralizing IFN- antibody (5 µg/mL). T cells were then stimulated
with medium alone (lanes 1, 4, and 7), IL-12 (lanes 2, 5, and 8), or
IL-2 (lanes 3, 6, and 9), and Western blots were performed as described in (A). Results are representative of two separate experiments.
|
|
To directly demonstrate this effect of IL-12 on T-cell differentiation,
PBMC were activated with either PHA alone or PHA + 1 pmol/L IL-12 and
assessed for IL-12-induced STAT5 and STAT1 activation. In addition,
because it was not clear whether the direct action of both IL-12 and
IFN- on T cells was required to mediate the observed changes in
IL-12 signaling among T cells activated with PHA + IFN- , we also
activated PBMC with PHA + IL-12 in the presence of a neutralizing
IFN- antibody to inhibit the biologic effect of any endogenous
IL-12-induced IFN- . T cells cultured with PHA + IL-12 exhibit a
significant enhancement of IL-12-induced STAT5 and STAT1 tyrosine
phosphorylation compared with T cells activated with PHA alone (Fig 6B,
lanes 2 and 5). The addition of a neutralizing IFN- antibody has no
effect on that activation (lanes 5 and 8). This indicates that the
presence of IL-12 during T-cell activation can enhance IL-12 signaling independent of IFN- . T cells activated with PHA + IL-12 or PHA + IL-12 + anti-IFN- also display an enhanced basal tyrosine
phosphorylation of STAT5 and STAT1 (lanes 4 and 7). This enhancement is
most pronounced in T cells cultured with PHA + 1 pmol/L IL-12 + anti-IFN- (lane 7).
To determine whether IFN- -induced IL-12 was also responsible for
the upregulation of high-affinity IL-12 receptor expression observed
among T cells activated with PHA + IFN- , IL-12 binding studies were
performed on T cells activated with PHA, PHA + IFN- , or PHA + IFN- + anti-IL-12. T cells activated with PHA alone for 4 days have
high-affinity (kd = 61 ± 20 pmol/L, 259 ± 59 sites/cell) and low-affinity (kd = 6.0 ± 2.4 nmol/L, 2,775 ± 318 sites/cell) IL-12 receptors
(Table 2 and Fig 7). When activated for 4 days with PHA + IFN- , the high-affinity IL-12 receptors were altered with respect to both the kd and number of sites per cell, whereas the
low-affinity sites remained unchanged. Specifically, there was a 90%
increase in the high-affinity kd (increasing from 61 ± 20 pmol/L to
115 ± 21 pmol/L) and an 80% increase in the number of
high-affinity sites (increasing from 259 ± 59 to 470 ± 75). In
contrast, for T cells activated with PHA + IFN- in the presence of
the neutralizing IL-12 antibody, the high-affinity kd was increased by
only 30% (88 ± 18 pmol/L) and the number of high-affinity sites increased by only 25% (325 ± 49) compared with T cells activated with PHA alone. There was also a modest 20% increase in the number of
low-affinity sites with no significant change in the low-affinity kd.
This suggests that the effect of IFN- on IL-12 binding is mediated
largely by IL-12.
View this table:
[in this window]
[in a new window]
|
Table 2.
The IFN- -Induced Upregulation of High-Affinity IL-12
Receptor Expression During T-Cell Activation Is Inhibited by
Neutralizing Endogenous IL-12
|
|

View larger version (15K):
[in this window]
[in a new window]
| Fig 7.
The IFN- -induced increase in high-affinity IL-12
receptor expression is mediated by IL-12. PBMC were activated with PHA, PHA + IFN- , or PHA + IFN- + anti-IL-12. Binding studies
using [125I]-IL-12 were performed and the results
analyzed using the Scatchard method. Similar results were obtained in
three separate experiments.
|
|
T Cells Activated With PHA + IL-12 Produce More IFN- in
Response to IL-12 Than T Cells Activated With PHA Alone
The activation of T cells with PHA + IL-12 significantly augments the
expression of high-affinity IL-12 receptors and the ability of IL-12 to
activate STAT1 and STAT5 relative to T cells activated with PHA alone.
Thus, we examined how these changes impacted on the functional response
of T cells to IL-12. We have shown previously that the activation of T
cells with PHA + IFN- enhances IL-12-induced IFN- production to
a greater extent than IL-12-induced proliferation.12 In T
cells activated with PHA + IFN- , there is a twofold increase in
IFN- production induced by 1 pmol/L IL-12 and a 10-fold increase in
IFN- production induced by 0.1 pmol/L IL-12 when compared with T
cells activated with PHA alone (Fig 8A). Significant
changes in IL-12-induced proliferation were not observed (data not
shown). When endogenous IFN- -induced IL-12 is neutralized during
T-cell activation with PHA + IFN- , the augmentation of
IL-12-induced IFN- production is largely abolished (Fig 8A). To
confirm that the presence of small amounts of IL-12 during T-cell
activation with PHA can enhance subsequent IL-12-induced IFN-
production, T cells were cultured with either PHA alone or PHA + IL-12
1 pmol/L + anti-IFN- and then stimulated for 72 hours
with IL-12. PBMC activated with PHA + IL-12 demonstrate similar
increases in IL-12-induced IFN- production as PBMC activated with
PHA + IFN- (Fig 8B). Consistent changes of this magnitude in
IL-12-induced proliferation were not observed in T cells activated with PHA + IL-12 (data not shown).

View larger version (11K):
[in this window]
[in a new window]
| Fig 8.
T cells activated with PHA + IFN- or PHA + IL-12
exhibit an increase in IL-12-induced IFN- production. (A) PBMC
activated with either PHA alone, PHA + IFN- , or PHA + IFN- + anti-IL-12 were plated at 3 × 104 cells/well and
cultured for an additional 72 hours with the indicated concentrations
of IL-12. Supernatants were then harvested and the IFN-
concentration measured by ELISA. The values shown were obtained after
subtracting the amount of IFN- produced by the same T cells in
response to medium alone for 72 hours. Results are representative of
two separate experiments. ( ) PHA; ( ) PHA + IFN- ; ( ) PHA + IFN- + anti-IL-12. (B) PBMC activated for 4 days with
either PHA alone or PHA + IL-12 + anti-IFN- were plated
at 3 × 104 cells/well and cultured for an additional 72 hours with the indicated concentrations of IL-12. Supernatants were
then harvested and the IFN- concentration determined by ELISA as
described in (A). Results are representative of two separate
experiments. ( ) PHA; ( ) PHA + 1 pmol/L IL-12 + anti-IFN- .
|
|
 |
DISCUSSION |
In this report, we have shown that the opposing effects of IL-4 and
IL-12 on high-affinity IL-12 receptor expression during human T-cell
activation with PHA profoundly influence IL-12 signaling. Although IL-4
does not affect the expression of the low-affinity IL-12R 1
subunit,12 it does prevent the expression of at least one
additional IL-12 receptor subunit (IL-12R 2),15,16
thereby inhibiting the formation of IL-12R 1/IL-12R 2 heterodimers
that bind IL-12 with high affinity.16 Our demonstration
that the activation of Jak2 and Tyk2 by IL-12 is impaired by IL-4
despite the preservation of IL-12R 1 expression suggests that the
IL-12-induced heterodimerization of IL-12R 1 and IL-12R 2 is
required for both Jak2 and Tyk2 tyrosine phosphorylation. The residual
IL-12-induced Tyk2 tyrosine phosphorylation in IL-4-treated cells may
be triggered by the binding of IL-12 to IL-12R 1 alone, because Tyk2
appears to preferentially associate with IL-12R 1, whereas Jak2
associates with IL-12R 2.29 However, the observation that
there is also residual Jak2 tyrosine phosphorylation suggests that Jak2
and Tyk2 are being activated through a vastly reduced complement of high-affinity IL-12R 1/IL-12R 2 heterodimers.
The effects of IL-4 on high-affinity IL-12 receptor expression and
Jak2/Tyk2 activation by IL-12 are paralleled by the inhibition of STAT
activation by IL-12. In this report, we have shown for the first time
that IL-12 can induce the tyrosine phosphorylation of STAT1 ,
STAT1 , and STAT5 in activated human T cells. The tyrosine phosphorylation of STAT1 , STAT1 , and STAT5 induced by IL-12 is
completely abrogated in T cells activated with PHA + IL-4, whereas
STAT4 activation is greatly diminished but not completely extinguished.
It appears, therefore, that, although the expression of IL-12R 1 and
perhaps a small number of IL-12R 1/IL-12R 2 high-affinity heterodimers is sufficient to allow for low-level Jak2/Tyk2 and STAT4
activation in response to IL-12 in IL-4-treated T cells, it is not
capable of mediating the activation of STAT1 and STAT5. This suggests
that, at the level of IL-12 receptor expression, the requirements for
STAT4 activation by IL-12 differ from the requirements for STAT1 and
STAT5 activation. From a functional standpoint, we have shown
previously that human T cells activated with PHA + IL-4 are still
capable of proliferating and producing IFN- in response to IL-12,
although the magnitude of these functional responses is greatly
diminished compared with T cells activated with PHA
alone.12 Although the preservation of some functional responsiveness to IL-12 in the absence of STAT1 and STAT5 activation may be an indication that STAT4 by itself (or perhaps STAT4 together with STAT3) can mediate the functional effects of IL-12, the fact that
STAT1, STAT5, and STAT4 activation by IL-12 are all diminished in
IL-4-treated T cells precludes any assignment of the relative importance of these STATs to IL-12
signaling.
In contrast with the demonstration that IL-4 inhibits IL-12 signaling
when present during T-cell activation, the activation of T cells with
PHA + IFN- markedly augments the ability of IL-12 to activate
STAT1 , STAT1 , and STAT5. Although the IL-12-induced tyrosine
phosphorylation of STAT5 in T cells activated with PHA + IFN-
remains considerably less than that observed in response to IL-2, it is
associated with STAT5 DNA-binding and is therefore likely to be
functionally significant. Because we have shown that the effect of
IFN- is mediated primarily through IL-12, we conclude that IL-12
exerts a positive autoregulatory effect on T-cell IL-12 signaling by
stimulating T cells through IL-12 receptors that are upregulated during
the early phase of T-cell activation. Several lines of evidence
indicate that IL-12 is modulating its signaling pathway through changes
in high-affinity IL-12 receptor expression. First, whereas the
IL-12-induced activation of STAT5 and STAT1 is augmented in T cells
activated with PHA + IFN- or PHA + IL-12, the activation of these
same STAT proteins by IL-2 is unaffected. This excludes the possibility
that IL-12 is nonspecifically augmenting the tyrosine phosphorylation
of signaling proteins through, for example, the stabilization of
phosphotyrosine moieties. Furthermore, we have shown that IL-12 does
not increase the IL-12-induced tyrosine phosphorylation of STAT1 and
STAT5 by altering the total amount of STAT1 and STAT5 present within
activated T cells. Second, the increased activation of STAT1 and STAT5
in response to IL-12 correlates with strong increases in Jak2 and Tyk2
tyrosine phosphorylation, whereas only weak augmentation in the
activation of Jak3 by IL-2 is observed. Because Jak2 and Tyk2
physically associate with subunits of the IL-12 receptor and comprise
the most proximal components of IL-12 signaling, it is likely that
changes in their level of activation in response to IL-12 reflect
changes in IL-12 receptor expression. Finally, we have shown that the
increase in high-affinity IL-12 receptor expression (80% increase)
observed on T cells activated with PHA + IFN- compared with T cells
activated with PHA alone is significantly diminished when endogenous
IL-12 is neutralized. This correlates with similar decreases in the
level of augmentation of IL-12-induced STAT5 and STAT1 tyrosine
phosphorylation.
Using a neutralizing IL-12R 1 antibody, we have shown previously that
all of the high-affinity IL-12 binding on T cells activated with PHA + IFN- was dependent on IL-12R 1 expression.12 We also
demonstrated that IFN- did not affect IL-12R 1 expression, suggesting that IFN- was upregulating high-affinity IL-12 receptor expression by enhancing the expression of one or more additional IL-12R
subunits that formed high-affinity complexes with IL-12R 1. Although
we have presented evidence in this report that indicates that
IFN- -induced IL-12 is largely responsible for the upregulation of
these additional subunits, the identity of these IL-12R subunits is
currently undefined. Because IL-12 appears to be capable of promoting
IL-12R 2 gene transcription,15,16 it is possible that the
IL-12-induced increase in high-affinity IL-12 binding sites is due
solely to the upregulation of IL-12R 2 surface expression. If this is
true, it would suggest that a threshold exists for the number of
high-affinity IL-12R 1/IL-12R 2 heterodimers that are required for
the optimal activation of STAT5 and STAT1 by IL-12. Alternatively, when
present during activation with PHA, IL-12 may be upregulating the
expression of a third IL-12R subunit that, like IL-12R 2, can form
high-affinity heterodimers with IL-12R 1. This hypothetical third
subunit might be the means through which STAT5 and additional STAT1
molecules can be recruited to the IL-12 receptor and tyrosine
phosphorylated in response to IL-12. Interestingly, the kd of the
high-affinity IL-12 binding sites on T cells activated with PHA + IFN- is twice as large as the kd of high-affinity IL-12 receptors on
T cells activated with PHA alone. This supports the hypothesis that the
additional high-affinity IL-12 receptors appearing in response to
IFN- -induced IL-12 might be different from those present after
activation with PHA alone.
Whereas the IL-12-induced increase in high-affinity IL-12 receptor
expression is associated with an increase in STAT5 and STAT1 activation
by IL-12, there is no corresponding increase in STAT4 activation as
measured by STAT4 tyrosine phosphorylation and DNA binding. This
implies that the complement of high-affinity IL-12 receptors needed for
maximal STAT4 activation by T cells differs from that required for
optimal STAT5 and STAT1 activation. It also suggests that the observed
change in IL-12-induced IFN- production among T cells activated
with PHA + IL-12 may be mediated through STAT5 and STAT1 rather than
STAT4. Although studies with STAT4 knockout mice have demonstrated that
STAT4 activation is needed for all of the major functional responses of
T cells to IL-12,23 our present findings suggest that STAT5
and STAT1 may play an important role in modulating the magnitude of
IL-12-induced IFN- production while having little effect on
IL-12-induced proliferation. Interestingly, it has been shown that
STAT1, STAT4, and STAT5 can all bind to distinct and partially
overlapping sequences of DNA within the first intron of the human
IFN- gene.32 Furthermore, the optimal binding of these
STATs to DNA appears to require cooperative interactions between STATs
mediated through conserved amino-terminal domains and has a significant
impact on gene transcription. It is possible, therefore, that the
optimal binding of STAT4 to key regulatory sequences within the IFN-
gene required for optimal gene transcription depends on cooperative
interactions of STAT4 molecules with STAT1 and STAT5, thus dictating
that all three STAT proteins must be activated to maximize IFN-
production.
Our experiments with PBMC cultured with PHA + IFN- are notable for
demonstrating that the presence of a small amount of APC-derived IL-12
during T-cell activation is sufficient to augment both IL-12 signaling
and the functional response of PHA-activated T cells to IL-12. The
increase in IL-12-induced IFN- production is most pronounced when
analyzing the T-cell response to IL-12 at concentrations ranging from
0.1 to 1 pmol/L, lending further support to the hypothesis that the
observed increase in high-affinity IL-12 receptor expression plays an
important role in the augmentation of IL-12 signaling and
IL-12-induced IFN- production. A number of reports have shown that
the in vitro activation of human monocytes, dendritic cells, and
Langerhans cells leads to the production of small amounts of the p70
IL-12 heterodimer, on the order of 0.1 to 1 pmol/L.1-3 This
corresponds to what we have observed in our experimental system when
PBMC are activated with PHA + IFN- . Similar amounts of p70 IL-12 are
produced by CD40-stimulated APCs from patients with multiple
sclerosis33 and by mycobacterium + IFN- -stimulated APCs
from patients with tuberculoid leprosy.34 These findings suggest that, during the initial phase of antigen presentation and
T-cell activation, the development of a Th1 response may depend on the
ability of T cells to respond to small quantities of APC-derived IL-12.
The findings in this report suggest that a mechanism has evolved
whereby T cells, detecting the presence of small amounts of IL-12
through high-affinity IL-12 receptors, can maximize their response to
that IL-12 by upregulating high-affinity IL-12 receptor expression.
This may then allow the recruitment and activation of STAT5 and STAT1,
which may amplify STAT4-dependent functional responses to IL-12.
Although the correlation observed in this report between changes in
IL-12-induced STAT5 and STAT1 activation and IL-12-induced IFN-
production raises the possibility that the modulation of STAT5 and
STAT1 activation can alter specific IL-12 functional responses, it is
also possible that STAT5 and STAT1 activation plays no role in
mediating the T-cell response to IL-12. In addition to activating the
Jak-STAT signaling pathway, IL-12 has also been reported to activate
MAP kinase in T cells.35 It is therefore possible that
changes in either IL-12-induced MAP kinase activation or in the
activation of other undiscovered components of IL-12 signaling are
responsible for the change in IL-12 responsiveness in IL-12-activated
T cells. To further explore the role of STAT1 and STAT5 in mediating
the functional responses of T cells to IL-12, it will be important to
examine whether the autoregulatory enhancement of IL-12 responsiveness
demonstrated in this report with human T cells exists in mice and, if
so, whether it is abrogated in STAT1, STAT5, or STAT1/STAT5 knockout
mice. Furthermore, it will be important to determine whether STAT1 and
STAT5 activation also correlates with other important functional
effects of IL-12, such as Th1 development and cytolytic activity.
Because STAT3 is activated by both IL-12 and IL-2 in T cells,
determining whether IL-12 and IL-4 can modulate the activation of STAT3
by IL-12 will also help to further elucidate whether changes in the
degree of activation of distinct combinations of STATs is one of the
mechanisms through which changes in IL-12 receptor expression control
specific functional responses to IL-12.
 |
FOOTNOTES |
Submitted May 28, 1997;
accepted October 2, 1997.
Supported by National Institutes of Health Grant No. CA41619, American
Cancer Society Grant No. PRTA-33, and the Dr. Jeanne M. Connors and
Adelaide T. Hassett Research Foundation.
Address reprint requests to Jared A. Gollob, MD, Department of Adult
Oncology, Dana-Farber Cancer Institute, 44 Binney St, Boston, MA 02115.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. section 1734 solely
to indicate this fact.
 |
ACKNOWLEDGMENT |
The authors thank Genetics Institute for generously providing rhIL-12.
 |
REFERENCES |
1.
Heufler C,
Koch F,
Stanzl U,
Topar G,
Wysocka M,
Trinchieri G,
Enk A,
Steinman RM,
Romani N,
Schuler G:
Interleukin-12 is produced by dendritic cells and mediates T helper type 1 development as well as interferon- production by T helper 1 cells.
Eur J Immunol
26:659,
1996[Medline]
[Order article via Infotrieve]
2.
Hilkens CMU,
Snijders A,
Vermeulen H,
van der Meide PH,
Wierenga EA,
Kapsenberg ML:
Accessory cell-derived IL-12 and prostaglandin E2 determine the IFN- level of activated human CD4+ T cells.
J Immunol
156:1722,
1996[Abstract]
3.
Kang K,
Kubin M,
Cooper KD,
Lessin SR,
Trinchieri G,
Rook AH:
IL-12 synthesis by human Langerhans cells.
J Immunol
156:1402,
1996[Abstract]
4.
Perussia B,
Chan SH,
D'Andrea A,
Tsuji K,
Santoli D,
Pospisil M,
Young D,
Wolf SF,
Trinchieri G:
Natural killer (NK) cell stimulatory factor or IL-12 has differential effects on the proliferation of TCR- +, TCR- + T lymphocytes, and NK cells.
J Immunol
149:3495,
1992[Abstract]
5.
Robertson MJ,
Soiffer RJ,
Wolf SF,
Manley TJ,
Donahue C,
Young D,
Herrmann SH,
Ritz J:
Response of human natural killer (NK) cells to NK cell stimulatory factor (NKSF): Cytolytic activity and proliferation of NK cells is differentially regulated by NKSF.
J Exp Med
175:779,
1992[Abstract/Free Full Text]
6.
Mehrotra PT,
Wu D,
Crim JA,
Mostowski HS,
Siegel JP:
Effects of IL-12 on the generation of cytotoxic activity in human CD8+ T lymphocytes.
J Immunol
151:2444,
1993[Abstract]
7.
Chan SH,
Perussia B,
Gupta JW,
Kobayashi M,
Pospisil M,
Young HA,
Wolf SF,
Young D,
Clark SC,
Trinchieri G:
Induction of interferon- production by natural killer cell stimulatory factor: Characterization of responder cells and synergy with other inducers.
J Exp Med
173:869,
1991[Abstract/Free Full Text]
8.
Romagnani S:
Biology of human Th1 and Th2 cells.
J Clin Immunol
15:121,
1995[Medline]
[Order article via Infotrieve]
9.
Trinchieri G:
Interleukin-12 and its role in the generation of Th1 cells.
Immunol Today
14:335,
1993[Medline]
[Order article via Infotrieve]
10.
Desai BP,
Quinn PM,
Wolitzky AG,
Mongini PKA,
Chizzonite R,
Gately MK:
IL-12 receptor: II. Distribution and regulation of receptor expression.
J Immunol
148:3125,
1992[Abstract]
11.
Wu C-Y,
Warrier RR,
Wang X,
Presky DH,
Gately MK:
Regulation of interleukin-12 receptor 1 chain expression and interleukin-12 binding by human peripheral blood mononuclear cells.
Eur J Immunol
27:147,
1997[Medline]
[Order article via Infotrieve]
12.
Gollob JA,
Kawasaki H,
Ritz J:
Interferon- and interleukin-4 regulate T cell interleukin-12 responsiveness through the differential modulation of high affinity interleukin-12 receptor expression.
Eur J Immunol
27:647,
1997[Medline]
[Order article via Infotrieve]
13.
Chua AO,
Chizzonite R,
Desai BB,
Truitt TP,
Nunes P,
Minetti LJ,
Warrier RR,
Presky DH,
Levine JF,
Gately MK,
Gubler U:
Expression cloning of a human IL-12 receptor component: A new member of the cytokine receptor superfamily with strong homology to gp130.
J Immunol
153:128,
1994[Abstract]
14.
Presky DH,
Yang H,
Minetti LJ,
Chua AO,
Nabavi N,
Wu C-Y,
Gately MK,
Gubler U:
A functional interleukin 12 receptor complex is composed of two type cytokine receptor subunits.
Proc Natl Acad Sci USA
93:14002,
1997[Abstract/Free Full Text]
15.
Szabo SJ,
Dighe AS,
Gubler U,
Murphy KM:
Regulation of the interleukin (IL)-12R 2 subunit expression in developing T helper 1 (Th1) and Th2 cells.
J Exp Med
185:817,
1997[Abstract/Free Full Text]
16.
Rogge L,
Berberis-Maino L,
Biffi M,
Passini N,
Presky DH,
Gubler U,
Sinigaglia F:
Selective expression of an interleukin-12 receptor component by human T helper 1 cells.
J Exp Med
185:825,
1997[Abstract/Free Full Text]
17.
Bacon CM,
McVicar DW,
Ortaldo JR,
Rees RC,
O'Shea JJ,
Johnston JA:
Interleukin 12 (IL-12) induces tyrosine phosphorylation of JAK2 and TYK2: Differential use of janus family tyrosine kinases by IL-2 and IL-12.
J Exp Med
181:399,
1995[Abstract/Free Full Text]
18.
Miyazaki T,
Kawahara A,
Fujii H,
Nakagawa Y,
Minami Y,
Liu Z-J,
Oishi I,
Silvennoinen O,
Witthuhn BA,
Ihle JN,
Taniguchi T:
Functional activation of Jak1 and Jak3 by selective association with IL-2 receptor subunits.
Science
266:1045,
1994[Abstract/Free Full Text]
19.
Jacobson NG,
Szabo SJ,
Weber-Nordt RM,
Zhong Z,
Schreiber RD,
Darnell JE Jr,
Murphy KM:
Interleukin 12 signaling in T helper type 1 (Th1) cells involves tyrosine phosphorylation of signal transducer and activator of transcription (Stat)3 and Stat4.
J Exp Med
181:1755,
1995[Abstract/Free Full Text]
20.
Cho SS,
Bacon CM,
Sudarshan C,
Rees RC,
Finbloom D,
Pine R,
O'Shea JJ:
Activation of STAT4 by IL-12 and IFN- : Evidence for the involvement of ligand-induced tyrosine and serine phosphorylation.
J Immunol
157:4781,
1996[Abstract]
21.
Szabo SJ,
Jacobson NG,
Dighe AS,
Gubler U,
Murphy KM:
Developmental committment to the Th2 lineage by extinction of IL-12 signaling.
Immunity
2:665,
1995[Medline]
[Order article via Infotrieve]
22.
Lin J-X,
Migone T-S,
Tsang M,
Friedmann M,
Weatherbee JA,
Zhou L,
Yamauchi A,
Bloom ET,
Mietz J,
John S,
Leonard WJ:
The role of shared receptor motifs and common Stat proteins in the generation of cytokine pleiotropy and redundancy by IL-2, IL-4, IL-7, IL-13, and IL-15.
Immunity
2:331,
1995[Medline]
[Order article via Infotrieve]
23.
Thierfelder WE,
van Deursen JM,
Yamamoto K,
Tripp RA,
Sarawar SR,
Carson RT,
Sangster MY,
Vignali DAA,
Doherty PC,
Grosveld GC,
Ihle JN:
Requirement for Stat4 in interleukin-12-mediated responses of natural killer and T cells.
Nature
382:171,
1996[Medline]
[Order article via Infotrieve]
24.
Frank DA,
Robertson MJ,
Bonni A,
Ritz J,
Greenberg ME:
Interleukin 2 signaling involves the phosphorylation of STAT proteins.
Proc Natl Acad Sci USA
92:7779,
1995[Abstract/Free Full Text]
25.
Frank DA,
Varticovski L:
BCR/abl leads to the constitutive activation of Stat proteins, and shares an epitope with tyrosine phosphorylated Stats.
Leukemia
10:1724,
1996[Medline]
[Order article via Infotrieve]
26.
Sattler M,
Durstin MA,
Frank DA,
Okuda K,
Kaushansky K,
Salgia R,
Griffin JD:
The thrombopoietin receptor c-MPL activates JAK2 and TYK2 tyrosine kinases.
Exp Hematol
23:1040,
1995[Medline]
[Order article via Infotrieve]
27.
Gollob JA,
Li J,
Reinherz EL,
Ritz J:
CD2 regulates responsiveness of activated T cells to interleukin 12.
J Exp Med
182:721,
1995[Abstract/Free Full Text]
28.
Yu C-R,
Lin J-X,
Fink DW,
Akira S,
Bloom ET,
Yamachi A:
Differential utilization of janus kinase-signal transducer and activator of transcription signaling pathways in the stimulation of human natural killer cells by IL-2, IL-12, and IFN- .
J Immunol
157:126,
1996[Abstract]
29.
Zou J,
Presky DH,
Wu C-Y,
Gubler U:
Differential associations between the cytoplasmic regions of the interleukin-12 receptor 1 and 2 and JAK kinases.
J Biol Chem
272:6073,
1997[Abstract/Free Full Text]
30.
Stahl N,
Farruggella TJ,
Boulton TG,
Zhong Z,
Darnell Jr JE,
Yancopolous GD:
Choice of STATs and other substrates specified by modular tyrosine-based motifs in cytokine receptors.
Science
267:1349,
1995[Abstract/Free Full Text]
31.
Gollob JA,
Li J,
Kawasaki H,
Daley JF,
Groves C,
Reinherz EL,
Ritz J:
Molecular interaction between CD58 and CD2 counter-receptors mediates the ability of monocytes to augment T cell activation by IL-12.
J Immunol
157:1886,
1996[Abstract]
32.
Xu X,
Sun Y-L,
Hoey T:
Cooperative DNA binding and sequence-selective recognition conferred by the STAT amino-terminal domain.
Science
273:794,
1996[Abstract]
33.
Balashov KE,
Smith DR,
Khoury SJ,
Hafler DA,
Weiner HL:
Increased interleukin 12 production in progressive multiple sclerosis: Induction by activated CD4+ T cells via CD40 ligand.
Proc Natl Acad Sci USA
94:599,
1997[Abstract/Free Full Text]
34.
Libraty DH,
Airan LE,
Uyemura K,
Jullien D,
Spellberg B,
Rea TH,
Modlin RL:
Interferon- differentially regulates interleukin-12 and interleukin-10 production in leprosy.
J Clin Invest
99:336,
1997[Medline]
[Order article via Infotrieve]
35.
Pignata C,
Sanghera JS,
Cossette L,
Pelech SL,
Ritz J:
Interleukin-12 induces tyrosine phosphorylation and activation of 44-kD mitogen-activated protein kinase in human T cells.
Blood
83:184,
1994[Abstract/Free Full Text]

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
K. A. Casey and M. F. Mescher
IL-21 Promotes Differentiation of Naive CD8 T Cells to a Unique Effector Phenotype
J. Immunol.,
June 15, 2007;
178(12):
7640 - 7648.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. C. Deng, X. Zeng, M. Newstead, T. A. Moore, W. C. Tsai, V. J. Thannickal, and T. J. Standiford
STAT4 Is a Critical Mediator of Early Innate Immune Responses against Pulmonary Klebsiella Infection
J. Immunol.,
September 15, 2004;
173(6):
4075 - 4083.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. J. Lund, Z. Chen, J. Scheinin, and R. Lahesmaa
Early Target Genes of IL-12 and STAT4 Signaling in Th Cells
J. Immunol.,
June 1, 2004;
172(11):
6775 - 6782.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Anderson, A. Sundstedt, L. Li, E. J. O'Neill, S. Li, D. C. Wraith, and P. Wang
Differential activation of signal transducer and activator of transcription (STAT)3 and STAT5 and induction of suppressors of cytokine signalling in Th1 and Th2 cells
Int. Immunol.,
November 1, 2003;
15(11):
1309 - 1317.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Mitola, M. Strasly, M. Prato, P. Ghia, and F. Bussolino
IL-12 Regulates an Endothelial Cell-Lymphocyte Network: Effect on Metalloproteinase-9 Production
J. Immunol.,
October 1, 2003;
171(7):
3725 - 3733.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Valenzuela, C. Schmidt, and M. Mescher
The Roles of IL-12 in Providing a Third Signal for Clonal Expansion of Naive CD8 T Cells
J. Immunol.,
December 15, 2002;
169(12):
6842 - 6849.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Lin, L. Brown, D. W. Hedley, D. L. Barber, and S. Benchimol
The death-promoting activity of p53 can be inhibited by distinct signaling pathways
Blood,
December 1, 2002;
100(12):
3990 - 4000.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. B. Nguyen, T. P. Salazar-Mather, M. Y. Dalod, J. B. Van Deusen, X.-q. Wei, F. Y. Liew, M. A. Caligiuri, J. E. Durbin, and C. A. Biron
Coordinated and Distinct Roles for IFN-{alpha}{beta}, IL-12, and IL-15 Regulation of NK Cell Responses to Viral Infection
J. Immunol.,
October 15, 2002;
169(8):
4279 - 4287.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Nishikomori, T. Usui, C.-Y. Wu, A. Morinobu, J. J. O'Shea, and W. Strober
Activated STAT4 Has an Essential Role in Th1 Differentiation and Proliferation That Is Independent of Its Role in the Maintenance of IL-12R{beta}2 Chain Expression and Signaling
J. Immunol.,
October 15, 2002;
169(8):
4388 - 4398.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Parham, M. Chirica, J. Timans, E. Vaisberg, M. Travis, J. Cheung, S. Pflanz, R. Zhang, K. P. Singh, F. Vega, et al.
A Receptor for the Heterodimeric Cytokine IL-23 Is Composed of IL-12R{beta}1 and a Novel Cytokine Receptor Subunit, IL-23R
J. Immunol.,
June 1, 2002;
168(11):
5699 - 5708.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Takeba, H. Nagafuchi, M. Takeno, J.-i. Kashiwakura, and N. Suzuki
Txk, a Member of Nonreceptor Tyrosine Kinase of Tec Family, Acts as a Th1 Cell-Specific Transcription Factor and Regulates IFN-{gamma} Gene Transcription
J. Immunol.,
March 1, 2002;
168(5):
2365 - 2370.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. J. Godshall, A. B. Lentsch, J. C. Peyton, M. J. Scott, and W. G. Cheadle
STAT4 Is Required for Antibacterial Defense but Enhances Mortality during Polymicrobial Sepsis
Clin. Vaccine Immunol.,
November 1, 2001;
8(6):
1044 - 1048.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. S. Wang, E. Zorn, and J. Ritz
Specific down-regulation of interleukin-12 signaling through induction of phospho-STAT4 protein degradation
Blood,
June 15, 2001;
97(12):
3860 - 3866.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. A. Gollob, K. G. Veenstra, H. Jyonouchi, A. M. Kelly, P. Ferrieri, D. J. Panka, F. Altare, C. Fieschi, J.-L. Casanova, D. A. Frank, et al.
Impairment of STAT Activation by IL-12 in a Patient with Atypical Mycobacterial and Staphylococcal Infections
J. Immunol.,
October 1, 2000;
165(7):
4120 - 4126.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. E. Verhagen, T. de Boer, H. H. Smits, F. A.W. Verreck, E. A. Wierenga, M. Kurimoto, D. A. Lammas, D. S. Kumararatne, O. Sanal, F. P. Kroon, et al.
Residual Type 1 Immunity in Patients Genetically Deficient for Interleukin 12 Receptor {beta}1 (IL-12R{beta}1): Evidence for an IL-12R{beta}1-Independent Pathway of IL-12 Responsiveness in Human T Cells
J. Exp. Med.,
August 21, 2000;
192(4):
517 - 528.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. E. Carson, J. E. Dierksheide, S. Jabbour, M. Anghelina, P. Bouchard, G. Ku, H. Yu, H. Baumann, M. H. Shah, M. A. Cooper, et al.
Coadministration of interleukin-18 and interleukin-12 induces a fatal inflammatory response in mice: critical role of natural killer cell interferon-gamma production and STAT-mediated signal transduction
Blood,
August 15, 2000;
96(4):
1465 - 1473.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Nagayama, K. Sato, H. Kawasaki, M. Enomoto, C. Morimoto, K. Tadokoro, T. Juji, S. Asano, and T. A. Takahashi
IL-12 Responsiveness and Expression of IL-12 Receptor in Human Peripheral Blood Monocyte-Derived Dendritic Cells
J. Immunol.,
July 1, 2000;
165(1):
59 - 66.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-i. Kashiwakura, N. Suzuki, H. Nagafuchi, M. Takeno, Y. Takeba, Y. Shimoyama, and T. Sakane
Txk, a Nonreceptor Tyrosine Kinase of the Tec Family, Is Expressed in T Helper Type 1 Cells and Regulates Interferon {gamma} Production in Human T Lymphocytes
J. Exp. Med.,
October 18, 1999;
190(8):
1147 - 1154.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. C. Showe, F. E. Fox, D. Williams, K. Au, Z. Niu, and A. H. Rook
Depressed IL-12-Mediated Signal Transduction in T Cells from Patients with Sezary Syndrome Is Associated with the Absence of IL-12 Receptor {beta}2 mRNA and Highly Reduced Levels of STAT4
J. Immunol.,
October 1, 1999;
163(7):
4073 - 4079.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. D. Marshall, J. Chehimi, G. Gri, J. R. Kostman, L. J. Montaner, and G. Trinchieri
The Interleukin-12-Mediated Pathway of Immune Events Is Dysfunctional in Human Immunodeficiency Virus-Infected Individuals
Blood,
August 1, 1999;
94(3):
1003 - 1011.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Galon, C. Sudarshan, S. Ito, D. Finbloom, and J. J. O'Shea
IL-12 Induces IFN Regulating Factor-1 (IRF-1) Gene Expression in Human NK and T Cells
J. Immunol.,
June 15, 1999;
162(12):
7256 - 7262.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M.-Y. Ho, B. K. Beattie, J. A. Squire, D. A. Frank, and D. L. Barber
Fusion of the ets Transcription Factor TEL to Jak2 Results in Constitutive Jak-Stat Signaling
Blood,
June 15, 1999;
93(12):
4354 - 4364.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. A. Gollob, C. P. Schnipper, E. A. Murphy, J. Ritz, and D. A. Frank
The Functional Synergy Between IL-12 and IL-2 Involves p38 Mitogen-Activated Protein Kinase and Is Associated with the Augmentation of STAT Serine Phosphorylation
J. Immunol.,
April 15, 1999;
162(8):
4472 - 4481.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. K. Naeger, J. McKinney, A. Salvekar, and T. Hoey
Identification of a STAT4 Binding Site in the Interleukin-12 Receptor Required for Signaling
J. Biol. Chem.,
January 22, 1999;
274(4):
1875 - 1878.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. S. Wang, J. Ritz, and D. A. Frank
IL-2 Induces STAT4 Activation in Primary NK Cells and NK Cell Lines, But Not in T Cells
J. Immunol.,
January 1, 1999;
162(1):
299 - 304.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|