|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 91 No. 4 (February 15), 1998:
pp. 1453-1457
Neonatal Hemolytic Anemia Due to Inherited Harderoporphyria:
Clinical Characteristics and Molecular Basis
By
J. Lamoril,
H. Puy,
L. Gouya,
R. Rosipal,
V. Da Silva,
B. Grandchamp,
T. Foint,
B. Bader-Meunier,
J.P. Dommergues,
J.C. Deybach, and
Y. Nordmann
From the Centre Français des Porphyries, INSERM U409,
Hôpital Louis Mourier, Colombes, France; the Department of
Pediatrics, Faculty of Medicine I, Charles University, Praha, Czech
Republic; the Service de Dermatologie, Centre Hospitalier, La
Flèche, France; and the Service de Pédiatrie, Hôpital
Kremlin Bicêtre, Kremlin Bicêtre, France.
 |
ABSTRACT |
Porphyrias, a group of inborn errors of heme synthesis, are
classified as hepatic or erythropoietic according to clinical data and
the main site of expression of the specific enzymatic defect.
Hereditary coproporphyria (HC) is an acute hepatic porphyria with
autosomal dominant inheritance caused by deficient activity of
coproporphyrinogen III oxidase (COX). Typical clinical manifestations of the disease are acute attacks of neurological dysfunction; skin
photosensitivity may also be present. We report a variant form of HC
characterized by a unifying syndrome in which hematologic disorders
predominate: harderoporphyria. Harderoporphyric patients exhibit
jaundice, severe chronic hemolytic anemia of early onset associated
with hepatosplenomegaly, and skin photosensitivity. Neither abdominal
pain nor neuropsychiatric symptoms are observed. COX activity is
markedly decreased. In a first harderoporphyric family, with three
affected siblings, a homozygous K404E mutation has been previously
characterized. In the present study, molecular investigations in a
second family with neonatal hemolytic anemia and harderoporphyria
revealed two heterozygous point mutations in the COX gene. One allele
bore the missense mutation K404E previously described. The second
allele bore an A G transition at the third position of the
donor splice site in intron 6. This new COX gene mutation resulted in
exon 6 skipping and the absence of functional protein production. In
contrast with other COX gene defects that produce the classical hepatic
porphyria presentation, our data suggest that the K404E substitution
(either in the homozygous or compound heterozygous state associated
with a mutation leading to the absence of functional mRNA or protein)
is responsible for the specific hematologic clinical manifestations of
harderoporphyria.
| |
INTRODUCTION |
HUMAN PORPHYRIAS ARE a group of inborn
errors of heme biosynthesis that are classified as hepatic or
erythropoietic according to clinical data and the main site of
expression of the specific enzymatic defect.1 Hereditary
coproporphyria (HC) is an autosomal dominant acute hepatic porphyria
with incomplete penetrance due to a partial deficiency of
coproporphyrinogen III oxidase (COX; EC 1.3.3.3). COX is a
mitochondrial enzyme2,3 that catalyzes the sixth step in
heme biosynthesis, the decarboxylation of coproporphyrinogen III to
protoporphyrinogen IX.4 Typical clinical manifestations of
the disease resemble two other forms of inherited acute hepatic porphyria, acute intermittent porphyria (AIP), and variegate porphyria (VP).5 These porphyrias are characterized by acute attacks of neurologic dysfunction with abdominal pain, hypertension,
tachycardia, and peripheral neuropathy. Skin photosensitivity may also
be present in HC and VP. Excretion of large amounts of coproporphyrin
III, mostly in feces and in urine, is observed.1 COX
activity is decreased to 50% of normal controls in all tissues from
coproporphyric patients as well as from asymptomatic carriers of the
gene defect.1 Human cDNA encoding COX has been
sequenced,6,7 and the COX gene structure has been
determined.8,9 To date, eight different mutations have been
characterized, which are distributed all over the COX gene. These
mutations, either in the heterozygous (n = 7) or homozygous state (n = 1), are responsible for typical HC.3,9-13
Harderoporphyria is an erythropoietic variant form of HC that is
biochemically characterized by marked overproduction in the erythrocytes and increased fecal excretion of the tricarboxylic porphyrin called harderoporphyrin and a markedly decreased lymphocyte COX activity. Harderoporphyria was first diagnosed in three siblings from healthy nonconsanguineous parents mainly on the basis of neonatal
hemolytic anemia and skin photosensitivity.14 Molecular studies in the family identified a lysine to glutamic acid susbtitution (K404E) produced by a homozygous A to C transition at position 1210 in
exon 6 of the COX gene.11 In the present study, we describe and investigate a new case of harderoporphyria bringing new insights into the clinical and molecular basis of the disease.
| |
MATERIALS AND METHODS |
Case report.
The patient was born at term of healthy, nonconsanguineous French
parents. Shortly after birth, he developed severe jaundice. Physical
findings included hepatosplenomegaly and hypospadias. The total serum
bilirubin level was 243 µmol/L. The hemoglobin level was 11.9 g/dL.
The nucleated cell count was 160 × 109/L, of which
85% were erythroblasts. After four exchange transfusions, performed
between the 10 and 91 hours of life, partial regression of
hepatosplenomegaly and resolution of icterus were observed. At 3 months
of age, the child was investigated. A blood smear showed 14%
erythroblasts and basophilic stippling. Hemoglobin electrophoresis,
erythrocyte enzyme activities, globin chain synthesis, and immulogic
investigations were normal. Bone marrow aspirate was normal. Hepatic
biopsy showed significant iron storage in hepatocytes without any other
abnormality. At 2 and 7 years of age, the patient was again examined.
Erythrocyte thermal sensitivity was normal and osmotic fragility
increased. Spectrin examination findings were normal. Another bone
marrow examination showed hyperplastic marrow with 50% erythroblasts
without dyserythropoiesis. Perls' Prussian blue stain showed 46%
sideroblasts without ring sideroblasts. Ultrastructural bone marrow
morphology was normal. The hematologic data are summarized in
Table 1. Growth and development remained normal despite persistent hemolytic anemia and mild splenomegaly. At 8 years of age, skin fragility, thickening, and erosion of the back of
both hands appeared intermittently without evidence of precipitating
factors.
Hepatic porphyria was suspected only when the patient was 18 years old
because of skin lesions associated with chronic hemolytic anemia. The
cutaneous lesions, characterized by the formation of vesicles and
bullae up to 2 cm in diameter, which crusted over and took several
weeks to heal, were localized on light-exposed areas of the backs of
the hands and on the arms and face. The patient had increased skin
fragility, but no hypertrichosis, alopecia, or porphyrin-rich gall
stones were found.
The patient is the second of two siblings
(Fig 1). In both parents and his sister,
hematologic data were normal (Table 1). The proband and his relatives
never exhibited abdominal and/or neurologic symptoms typical of
acute hepatic porphyrias.
View larger version (12K):
[in this window]
[in a new window]
| Fig 1.
Family pedigree (solid symbols, patient). In parenthesis
is the lymphocyte COX activity expressed as picomoles of protoporphyrin per hour per milligram of protein at 37°C (normal control value, 350 ± 80; mean ± 2 SD).
|
|
Porphyrin synthesis investigations
(Table 2).
Erythrocyte, urinary, and fecal porphyrins were determined using
standard methods.15,16 Lymphocyte COX activity was measured as described.17
DNA preparation and amplification by polymerase chain reaction
(PCR).
Genomic DNA from the proband, his parents, and his sister was extracted
from peripheral blood according to a standard protocol.18 Genomic DNA fragments of interest were amplified by PCR using primers
selected from the published COX sequence.9,12 Twenty picomoles of each set of primers was mixed in 50 µL of PCR solution containing 1 U of Taq polymerase (Beckmann Inc, Fullerton, CA), 50 mmol/L KCl, 10 mmol/L Tris-HCl, pH 8.5, 1.5 mmol/L MgCl2,
and 200 mmol/L of each dNTP. Reactions were performed in a DNA
thermocycler (Hybaid, Teddington, UK) as follows: 35 cycles of
denaturation at 94°C for 30 seconds, annealing at specific
temperature for 30 seconds, and elongation at 72°C for 1 minute.
Reverse transcription PCR (RT-PCR).
Total RNA was extracted from isolated peripheral blood mononuclear
cells using a standard technique.19 cDNA was obtained by
reverse transcription of total RNA using oligo(dT) as a primer. cDNA
was amplified as already described.10,12
DNA sequencing.
All exons and exon/intron boundaries of the COX gene were amplified
using previously selected primers.9,12 PCR products were
purified with the Wizard PCR preps DNA purification system (Promega-Biotech, Madison, WI). Genomic DNA and cDNA fragments were
directly sequenced using 35S-dATP and the fMol DNA
sequencing kit (Promega-Biotech).
Construction and prokaryotic expression of normal and mutated human
COX cDNA.
Normal human cDNA was expressed using the pGEX-2T expression vector
(Pharmacia LKB Biotechnology Inc, Uppsala, Sweden) as already
described.11 To study mutated cDNA with the exon 6 deletion, site-directed mutagenesis was performed using normal cloned
COX cDNA (pGEX-2T:COX) as template. We used the Transformer
site-directed mutagenesis kit (Clontech Laboratories, Palo Alto, CA),
which is based on the long primer-unique site elimination mutagenesis method described by Deng and Nickoloff.20 Briefly, long
primers were generated by PCR. 5 -Phosphorylated sense
oligonucleotide (mutagenic primer), which bypasses exon 6 (105 bp), has
22-bp and 20-bp matching sequences, respectively, flanking the 5
and 3 sides of the deleted exon. An antisense oligonucleotide
which mutates a single BsaAI restriction site in the pGEX-2T
plasmid (selection primer) was used. The sequences of these primers are as follows: mutagenic primer (Del.exon6), 5GGCAGCAGCT
CAGAAGAGGACG ATGGGAGTACATGCATTCAC (the arrow indicates the exon 6 bypass); and selection primer,
5ACACTCCGCTATCGCTCCGCGACTGGGTCATGGCT (mutated bases abolishing the single BsaAI restriction site are in bold and underlined).
Standard DNA elongation, ligation, and two-step
digestion/transformation of mutated plasmids in mutS Escherichia
coli and E coli DH5 strains were performed according to
the manufacturer's recommendations. The entire sequence of the mutated
plasmid was verified by sequencing. The recombinant bacteria (E
coli DH5) were grown and COX activities in bacteria lysates were
determined as previously described.21
| |
RESULTS |
The patient displayed symptoms and signs of severe hemolytic anemia
with splenomegaly and compensatory hyperactive bone marrow features. In
this proband, an atypical profile of porphyrin excretion was found in
feces with massive accumulation of harderoporphyrin (Table 2). COX
activity compared with control values was decreased by 78% in the
patient's lymphocytes and by 50% and 30% in those of the father and
mother, respectively (Fig 1).
Sequencing of the seven exons and intron-exon boundaries of the COX
gene from the patient showed two mutations in the heterozygous state,
each on a different allele. The numbering of the mutations is based on
the first base of the initiation codon described by Delfau-Larue et
al.9
The first mutation, an A to G transition at nucleotide 1210, had been
identified in the first reported harderoporphyric
patients.11 This mutation resulted in a lysine to glutamate
substitution at position 404 in the abnormal protein (K404E). The
second mutation was found to be an A to G transition at the third
position of the donor splice site in intron 6 (1277+3AG).
This mutation is responsible for exon 6 skipping. After amplification
of cDNA from the proband, PCR products showed two bands, one of the
expected size and the other corresponding to a 105-bp deletion in
accordance with exon 6 skipping (Fig 2).
Sequencing of the cDNA confirmed the exon 6 deletion that corresponds
to an in-frame deletion of 35 amino acids in the abnormal protein.
Procaryotic expression studies of the exon-6-deleted cDNA are
summarized in Table 3. The enzymatic
activity of the K404E mutated COX protein had already been
investigated.11 In the proband, no other abnormality was found in the coding sequence.
View larger version (67K):
[in this window]
[in a new window]
| Fig 2.
Analysis of RT-PCR products from lymphocyte mRNAs.
Amplified fragments encompassing exon 5, exon 6, and the coding part of exon 7 were obtained from lymphocyte cDNAs by RT-PCR using primers HUCO-2-Bio-A and HUCO-10S (9) and analyzed on 2% agarose gel. Two
amplified products were obtained from the heterozygous harderoporphyric patient (P), the 468-bp fragment containing the K404E missense mutation
and the 363-bp fragment resulting from the mRNA with complete deletion
of exon 6. Amplification of control mRNA (N) showed only the normal
468-bp fragment. M, molecular size markers.
|
|
Direct sequencing of exon 6 and its intron junctions from the
proband's relatives' genomic DNAs showed that the father was heterozygous for the splice site mutation (1277+3AG), whereas the mother and the sister were heterozygous for the K404E missense mutation.
| |
DISCUSSION |
In this study, we report clinical and molecular investigations in a
second family with harderoporphyria. The proband had an early onset
porphyria with severe neonatal hemolytic anemia. The pattern of
porphyrin excretion showed that the major part of fecal porphyrin was
harderoporphyrin, while a large amount of coproporphyrin was found in
urine; in addition, protoporphyrin was increased in erythrocytes.
Enzymatic studies of COX activity in lymphocytes showed a markedly
decreased activity compatible with a homozygous deficient COX gene.
Harderoporphyric patients reported to date (this case and Nordmann et
al14) exhibited strictly identical clinical symptoms
characterized by early onset of hemolytic anemia associated with
chronic cutaneous manifestations. It must be emphasized that abdominal
pain and neurologic symptoms, suggestive of acute hepatic porphyrias,
have not been seen in harderoporphyric patients. In both
harderoporphyric families, the parents were clinically asymptomatic but
exhibited slightly abnormal fecal porphyrin excretion and an
approximately 50% reduction in COX lymphocyte activity.
In the first harderoporphryic cases, molecular studies showed a
homozygous point mutation (A to G transition at nucleotide 1210 in exon
6 of the COX gene) resulting in a lysine to glutamic acid substitution
(K404E).11 The mutated K404E protein expressed in a
procaryotic system showed abnormal kinetics with reduced affinity, less
stability, and a decreased residual activity (25% of control). It has
been suggested that the two decarboxylation steps catalyzed by COX take
place at the same catalytic site and that this mutation was localized
at this active site of the enzyme.11 Consistent with this
hypothesis, COX from harderoporphyric patients has been found to have a
similarly increased Km for both coproporphyrinogen and
harderoporphyrinogen substrates.14
In this study, we show that harderoporphyria, occurring in a second
family, resulted from compound heterozygous mutations affecting the COX
gene. The previously reported K404E mutation was found in the
heterozygous state in the proband, his mother, and his sister. The
second mutation, an exon 6 skipping mutation caused by an A to G
transition at position 1277+3, is a new mutation that resulted in an
in-frame deletion of 35 aminoacids in the mutated protein. This
mutation was found in the heterozygous state in the proband and his
father. The father did not exhibit acute porphyria syndrome typical of
HC, probably because of the low penetrance of the disease, especially
in males. Expression studies showed that the truncated protein encoded
by the exon-6-deleted COX mRNA had virtually no residual enzymatic
activity (Table 3). Interestingly, a previous exon 6 skipping mutation
(not assessed with expression studies) has been reported in a patient
of Czech origin with a heterozygous G to A transition at position 1277, the last position of the splice donor site of exon 6.9 This patient had a typical clinical form of HC. He repeatedly exhibited neurologic symptoms with paresis, and the diagnosis was made during hospitalization after treatment with barbiturates.9 All
these data indicate that the residual enzyme activity found in compound heterozygous harderoporphyric patients results exclusively from the
K404E mutated COX protein. Therefore, the specific harderoporphyric symptoms appear directly related to this point mutation in the COX
gene.
To date, eight different mutations in the COX gene have been
characterized. They were responsible for typical HC.3 Only one homozygous form of HC has been reported,10 but its
clinical and biologic presentation was completely different from
harderoporphyria. The patient had a clinical history of severe acute
attacks of hepatic porphyria, without chronic hemolytic anemia, a large
accumulation in feces of coproporphyrin with harderoporphyrin being
absent, and a profound defect of COX activity in
lymphocytes.22 Molecular investigations showed an arginine
to tryptophan substitution (R231W) in exon 5 of the COX
gene.10
It has been hypothesized that the active COX protein acts as a
homodimer of approximatively 70 to 74 kD.23,24 Because of the lack of crystallographic data, little structural information about
the human COX enzyme is available. Recently, a histidine residue at
position 258 has been shown to be a highly conserved region of aerobic
COX; it could be involved in COX catalytic activity through a
hypothetic and controversial interaction with
Cu2+.25,26 Our studies on harderoporphyria show
that the lysine residue at position 404 is also important for catalytic
activity of the enzyme: the K404E mutation is probably responsible for accumulation of harderoporphyrinogen, an intermediate in the oxidative decarboxylation of coproporphyrinogen. It has been suggested that this
intermediate would leave the abnormal enzyme more easily and, after
spontaneous oxidation to harderoporphyrin, would accumulate in the
patient.11 Moreover, comparison of nucleotide deduced amino
acid sequences from humans, Saccharomyces cerevisiae,
Salmonella typhimurium, E coli,26-29 and
mouse30 showed that the K404E mutation occurred in a region
highly conserved throughout evolution
(Table 4). Our data and the high
percentage of conserved aminoacids suggest that exon 6 may play an
important role in the catalytic activity and/or maintenance of
the active conformation of the enzyme.
View this table:
[in this window]
[in a new window]
|
Table 4.
Comparison of Amino Acid Sequences Deduced From
Nucleotides Sequences of the Human (HC), From Codon 387 to
448, Mouse (MC), Saccharomyces cerevisiae (SC), E
coli (EC), Salmonella typhimurium (ST), and Soybean
(GM)
|
|
The pathogenesis of the hematologic symptoms in harderoporphyria is not
yet fully understood. However, as observed in erythropoietic porphyrias
(Günther's disease, erythro-hepatic porphyria), harderoporphyric patients exhibit splenomegaly. The spleen is the major site for removal
of damaged or hemolyzed erythrocytes31; hence, the
splenomegaly observed in harderoporphyria could be presumed to be
secondary to this process. Extrinsic abnormalities of erythrocytes seem
unlikely, because the direct Coomb's test was negative and the
survival time of normal erythrocytes transfused into harderoporphyric
patients was normal. The overproduction of porphyrins in
harderoporphyria may account for the hemolytic symptoms. The elevated
level of erythrocyte protoporphyrin found in all the harderoporphyric
patients, in contrast with classical HC, provides evidence favoring the
bone marrow as a source of elevated porphyrins in this disease and
could be involved, at least in part, in the hemolytic process.
Hemolysis of erythrocytes may also result from photolysis as
porphyrin-laden cells are exposed to light in the dermal capillaries.
Light wavenlengths suitable for porphyrin photoactivation are known to
penetrate the skin to a depth sufficient to produce this phenomenon and
photohemolysis has also been demonstrated in
vitro.32,33
In conclusion, this study suggests for the first time the existence of
a phenotype/genotype relationship in the human COX gene. In contrast
with other COX gene defects responsible for HC, the K404E mutation in
the homozygous state or associated with a deleterious allele (exon 6 skipping in this case) induces harderoporphyria. The abnormal kinetic
pattern with reduced affinity, less stability, and the decreased (25%)
residual activity of the mutated K404E is responsible for the unusual
accumulation of harderoporphyrin and the specific hematologic and
clinical symptoms of harderoporphyria. Harderoporphyria is a unifying
syndrome of childhood onset with clinical features quite different from
those observed in other hepatic porphyrias. It is characterized by
jaundice, hemolytic anemia, hepatosplenomegaly, skin photosensitivity,
and a marked increase in harderoporphyrin in urine and feces.
| |
FOOTNOTES |
Submitted May 28, 1997;
accepted October 10, 1997.
Supported by grants from INSERM (U409), University Paris VII in
collaboration with Charles University of Praha (Czech Republic), and
Association Française contre les Myopathies.
Address reprint requests to Y. Nordmann, MD, Laboratoire de Biochimie,
Hôpital Louis Mourier, 92701 Colombes Cedex, France.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. section 1734 solely
to indicate this fact.
| |
REFERENCES |
1. Kappas A, Sassa S, Galbraith RA, Nordmann Y: The porphyrias, in
Scriver CR, Beaudet AL, Sly WS, Valle D (eds): The Metabolic and
Molecular Basis of Inherited Disease. New York, NY, McGraw-Hill, 1995, p 2103
2.
Grandchamp B,
Phung N,
Nordmann Y:
The mitochondrial localization of coproporphyrinogen III oxidase.
Biochem J
176:97,
1978[Medline]
[Order article via Infotrieve]
3.
Grandchamp B,
Lamoril J,
Puy H:
Molecular abnormalities of coproporphyrinogen oxidase in patient with hereditary coproporphyria.
J Bioenerg Biomembr
27:215,
1995[Medline]
[Order article via Infotrieve]
4.
Elder GH,
Evans JO,
Jackson JR,
Jackson AH:
Factors determining the sequence of oxidative decarboxylation of the 2-and 4-propionate substituents of coproporphyrinogen III by coproporphyrinogen III oxidase in rat liver.
Biochem J
169:215,
1978[Medline]
[Order article via Infotrieve]
5. Nordmann Y, Deybach JC: Human hereditary porphyrias, in Dailey,
HA (ed): Biosynthesis of Heme and Chlorophylls. New York, NY,
McGraw-Hill, 1990, p 491
6.
Martasek P,
Camadro JM,
Delfau-Larue MH,
Dumas JB,
Montagne JJ,
De Verneuil H,
Labbe P,
Grandchamp B:
Molecular cloning sequencing and functional expression of a cDNA encoding human coproporphyrinogen oxidase.
Proc Natl Acad Sci USA
91:3024,
1994[Abstract/Free Full Text]
7.
Taketani S,
Kohno H,
Furukawa T,
Yoshinaga T,
Tokunaga R:
Molecular cloning, sequencing and expression of cDNA encoding human coproporphyrinogen oxidase.
Biochem Biophys Acta
1183:547,
1994[Medline]
[Order article via Infotrieve]
8.
Cacheux V,
Martasek P,
Fougerousse F,
Delfau MH,
Druart L,
Tachdjian G,
Grandchamp B:
Localization of the coproporphyrinogen oxidase gene to chromosome band 3q12.
Hum Genet
94:557,
1994[Medline]
[Order article via Infotrieve]
9.
Delfau-Larue MH,
Martasek P,
Grandchamp B:
Coproporphyrinogen oxidase: Gene organization and description of a mutation leading to exon skipping.
Hum Mol Genet
3:1325,
1994[Abstract/Free Full Text]
10.
Martasek P,
Nordmann Y,
Grandchamp B:
Homozygous hereditary coproporphyria caused by an arginine to tryptophan substitution in coproporphyrinogen oxidase and common intragenic polymorphisms.
Hum Mol Genet
3:477,
1994[Abstract/Free Full Text]
11.
Lamoril J,
Martasek P,
Deybach JC,
Da Silva V,
Grandchamp B,
Nordmann Y:
A molecular defect in coproporphyrinogen oxidase gene causing harderoporphyria, a variant form of hereditary coproporphyria.
Hum Mol Genet
4:275,
1995[Abstract/Free Full Text]
12.
Lamoril J,
Deybach JC,
Puy H,
Grandchamp B,
Nordmann Y:
Three novel mutations in the coproporphyrinogen oxidase gene.
Hum Mutat
9:78,
1997[Medline]
[Order article via Infotrieve]
13.
Fugita H,
Kondo M,
Taketani S,
Nomura N,
Furuyama K,
Akagi R,
Nagai T,
Terajima M,
Galbraith RA,
Sassa S:
Characterization and expression of cDNA encoding coproporphyrinogen oxidase from a patient with hereditary coproporphyria.
Hum Mol Genet
3:1807,
1994[Abstract/Free Full Text]
14.
Nordmann Y,
Grandchamp B,
De Verneuil H,
Phung L:
Harderoporphyria: A variant hereditary coproporphyria.
J Clin Invest
72:1139,
1983
15.
Bissel DM:
Laboratory evaluation in porphyria.
Semin Liver Dis
2:100,
1982[Medline]
[Order article via Infotrieve]
16.
Lim CK,
Li F,
Peters TJ:
High performance liquid chromatography of uroporphyrinogen and coproporphyrinogen isomers with amperometric detection.
Biochem J
234:629,
1986[Medline]
[Order article via Infotrieve]
17.
Guo R,
Lim CK,
Peters TJ:
Accurate and specific HPLC assay of coproporphyrinogen III activity in human peripheral leucocytes.
Clin Chim Acta
177:245,
1988[Medline]
[Order article via Infotrieve]
18.
Loparev VN,
Cartas MA,
Monken CE,
Velpandi A,
Srinivasan A:
An efficient and simple method of DNA extraction from whole blood and cell lines to identify infectious agents.
J Virol Methods
34:105,
1991[Medline]
[Order article via Infotrieve]
19.
Chomczynski P,
Sacchi N:
Single step method of RNA isolation by acid guanidium thiocyanate-phenol-chloroform extraction.
Anal Biochem
162:156,
1987[Medline]
[Order article via Infotrieve]
20.
Deng WP,
Nickoloff JA:
Site-directed mutagenesis of virtually any plasmid by eliminating a unique site.
Anal Biochem
200:81,
1992[Medline]
[Order article via Infotrieve]
21.
Grandchamp B,
Nordmann Y:
Decreased lymphocyte coprorporphyrinogen III oxidase activity in hereditary coproporphyria.
Biochem Biophys Res Commun
74:1089,
1978
22.
Grandchamp B,
Phung N,
Nordmann Y:
Homozygous case of hereditary coproporphyria.
Lancet
2:1348,
1977[Medline]
[Order article via Infotrieve]
23.
Bogard M,
Camadro JM,
Nordmann Y,
Labbe P:
Purification and properties of mouse liver coproporphyrinogen oxidase.
Eur J Biochem
181:417,
1989[Medline]
[Order article via Infotrieve]
24.
Camadro JM,
Chambon H,
Jolles J,
Labbe P:
Purification and properties of coproporphyrinogen oxidase from the yeast Saccharomyces cerevisiae.
Eur J Biochem
156:579,
1986[Medline]
[Order article via Infotrieve]
25.
Kohno H,
Furukawa T,
Tokunaga R,
Taketani S,
Yoshinaga T:
Mouse coproporphyrinogen oxidase is a copper-containing enzyme: Expression in Escherichia coli and site-directed mutagenesis.
Biochem Biophys Acta
1292:156,
1996[Medline]
[Order article via Infotrieve]
26.
Medlock AE,
Dailey HA:
Human coproporphyrinogen oxidase is not a metalloprotein.
J Biol Chem
271:32507,
1996[Abstract/Free Full Text]
27.
Troup B,
Jahn M,
Hungerer C,
Jahn D:
Isolation of the hemF operon containing the gene for the Escherichia coli aerobic coproporphyrinogen III oxidase by in vivo complementation of a yeast HEM13 mutant.
J Bacteriol
176:673,
1994[Abstract/Free Full Text]
28.
Xu K,
Elliott T:
An oxygen-dependent coproporphyrinogen oxidase encoded by the hemF gene of Salmonella typhimurium.
J Bacteriol
175:4990,
1993[Abstract/Free Full Text]
29.
Zagorec M,
Buhler JM,
Treich I,
Keng T,
Guarente L,
Labbe-Bois R:
Isolation, sequence, and regulation by oxygen of the yeast HEM13 gene coding for coproporphyrinogen oxidase.
J Biol Chem
263:9718,
1988[Abstract/Free Full Text]
30.
Kohno H,
Furukawa T,
Yoshinaga T,
Tokunaga R,
Taketani S:
Coproporphyrinogen oxidase purification, molecular cloning, and induction of mRNA during erythroid differentiation.
J Biol Chem
268:21359,
1993[Abstract/Free Full Text]
31.
Haining RG,
Cowger ML,
Shurtleff DB,
Labbe RF:
Congenital erythropoietic porphyria. Special studies and therapy.
Am J Med
45:624,
1968[Medline]
[Order article via Infotrieve]
32.
Nordmann Y,
Deybach JC:
Congenital erythropoietic porphyria.
Semin Liver Dis
2:154,
1982[Medline]
[Order article via Infotrieve]
33. Sassa S, Kappas A: The porphyrias, in Harris H, Hirschorn K
(eds): Advances in Human Genetics. New York, NY, Plenum, 1981, p 121
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
D.-S. Lee, E. Flachsova, M. Bodnarova, B. Demeler, P. Martasek, and C. S. Raman
Structural basis of hereditary coproporphyria
PNAS,
October 4, 2005;
102(40):
14232 - 14237.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Takeuchi, M. Kondo, M. Daimon, S. Susa, K. Ueoka, O. Uemura, and H. Togari
Neonatal-onset hereditary coproporphyria with male pseudohermaphrodism
Blood,
December 15, 2001;
98(13):
3871 - 3873.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Abstract
Introduction
Abstract