|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 91 No. 5 (March 1), 1998:
pp. 1562-1571
Glycoprotein IIb Leu214Pro Mutation Produces Glanzmann Thrombasthenia
With Both Quantitative and Qualitative Abnormalities in GPIIb/IIIa
By
Christine M. Grimaldi,
Fangping Chen,
Changhong Wu,
Harvey J. Weiss,
Barry S. Coller, and
Deborah L. French
From the Department of Medicine, Mount Sinai School of Medicine, New
York; and Columbia University College of Physicians and Surgeons, St
Luke's-Roosevelt Hospital, New York, NY.
 |
ABSTRACT |
Glanzmann thrombasthenia is an inherited bleeding disorder due to a
functional reduction or absence of platelet GPIIb/IIIa ( IIb 3) integrin receptors. Based on a
prolonged bleeding time and absence of platelet aggregation in response
to physiologic agonists, a 55-year-old white man was diagnosed as
having Glanzmann thrombasthenia. The patient's platelet fibrinogen
level was  5% of normal. As judged by complex-dependent monoclonal
antibody (MoAb) binding, surface expression of platelet GPIIb/IIIa
receptors was less than 5.5% of normal, whereas the binding of an
anti-GPIIIa specific MoAb (7H2) was 12% of normal. Immunoblot
analysis of the patient's platelet lysates showed 35% of normal
levels of GPIIIa, 30% of normal levels of GPIIb, and an abnormally
migrating fragment of GPIIb. Biotinylation of the surface proteins on
the patient's platelets followed by immunoprecipitation and sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis
showed only GPIIb and GPIIIa subunits of normal size. Surface
expression of platelet v3 receptors was
192% of normal, suggesting that the patient's' defect was in GPIIb.
Sequence analysis of the patient's GPIIb cDNA identified a T to C
transition at nucleotide 643, predicting a Leu214Pro substitution.
Direct sequencing of GPIIb exon 6 indicated that the patient is
homozygous for the mutation. The nature of the Leu214Pro mutation was
analyzed by expression in Chinese hamster ovary (CHO)
cells. As judged by subunit-specific MoAb binding, surface expression
of mutant receptors was 60% of normal, but these receptors were not
recognized by the complex-dependent monoclonal antibodies, 10E5 and
7E3. In addition, mutant receptors pretreated with the ligand-induced binding site MoAb AP5 were not recognized by the
activation-dependent MoAb PAC-1 and mutant expressing CHO cells did not
adhere to immobilized fibrinogen. These data suggest that the Leu214Pro
mutation in GPIIb disrupts the structural conformation, and either
directly or indirectly, the ligand binding properties of the
heterodimeric complex. This is in accord with studies from other
integrins that have implicated a -turn in a homologous region as
important in ligand binding. Thus, the Leu214Pro mutation appears to
produce the Glanzmann thrombasthenia phenotype by both qualitative and quantitative abnormalities. In addition, the mutation appears to confer
susceptibility of the GPIIb subunit to proteolysis.
| |
INTRODUCTION |
THE PLATELET GPIIb/IIIa receptor has
served as a prototype for the integrin family of adhesion receptors
because of its important role in platelet physiology and the early
recognition of its capacity to undergo activation. The receptor
mediates the interaction of activated platelets with ligands, including
fibrinogen, von Willebrand factor, vitronectin, and
fibronectin.1 The subunit of the receptor (GPIIb or
IIb) is platelet-specific and the subunit (GPIIIa or
3) is more widely expressed.1,2 Association
of 3 with v forms the
v3 vitronectin receptor, which is present on endothelial cells, osteoclasts, megakaryocytes, smooth muscle cells,
and many cultured cells.3 The GPIIb/IIIa receptor is abundantly expressed on the platelet surface (80,000 molecules per
platelet),4 whereas the v3
receptors are expressed in very low numbers (50 to 100 molecules per
platelet).5
A number of key steps have been identified in the normal biosynthesis
of integrin subunits with many of the studies performed on the platelet
GPIIb/IIIa receptor complex.6-9 In megakaryocytes, proGPIIb
is synthesized as a single chain precursor (Mr 140,000) that
associates with GPIIIa (Mr 90,000) in the endoplasmic reticulum (ER). The expression and proper folding of both subunits are required for normal complex formation, maturation in the ER, and additional processing of proGPIIb into heavy (GPIIb) (Mr 120,000) and light (GPIIb) (Mr 20,000) chains, which remain associated by a single disulfide bond.10 Cleavage of the proGPIIb subunit may be
mediated by the Golgi-associated serine proteinase furin or a
furin-like proteinase11 within a conserved arginine
containing consensus sequence12 that is found in other
-chain subunits including human and rodent GPIIb.13 The
mature GPIIb/IIIa receptor complex is transported to the cell surface
and is expressed in an "unactivated" or "low-affinity" form
that requires an activation event to attain high-affinity binding for
soluble fibrinogen and other adhesive glycoproteins.14
Fibrinogen mediates platelet aggregation by binding to GPIIb/IIIa
receptors on adjacent platelets via a  -chain carboxyl-terminal
dodecapeptide sequence, HHLGGAKQAGDV, that is found only in
fibrinogen.15 Even the "unactivated" form of the GPIIb/IIIa receptor can, however, mediate adhesion to immobilized fibrinogen16-18 and uptake of fibrinogen into
-granules.19
Amino acid residues and structural domains that are crucial for
biogenesis and function of platelet GPIIb/IIIa receptors have been
identified by characterizing naturally occurring inherited mutations in
patients with Glanzmann thrombasthenia.20 This disease is a
rare, inherited recessive bleeding disorder characterized by
quantitative or qualitative abnormalities of GPIIb or GPIIIa, resulting
in a life-long bleeding diathesis characterized by mucocutaneous hemorrhage. The platelets of patients with Glanzmann thrombasthenia do
not aggregate in response to physiologic agonists such as adenine diphosphate (ADP), thrombin, or epinephrine as a result of the GPIIb/IIIa abnormality. A total of 27 GPIIb and 23 GPIIIa genetic defects responsible for Glanzmann thrombasthenia have been
identified.21-23
This study characterizes the mutational defect in a Glanzmann
thrombasthenia patient with a T to C transition in GPIIb exon 6 resulting in a Leu214Pro amino acid substitution. Decreased levels of
the mutant receptor were expressed on the patient's platelets, but
this quantitative abnormality was not as severe as it is in many other
patients with Glanzmann thrombasthenia, suggesting the possibility of
an additional qualitative abnormality. To assess this possibility, the
function of the mutant receptor was analyzed by expression in Chinese
hamster ovary (CHO) cells. The proline substitution in GPIIb resulted
in a disruption of the ligand-binding conformation of the receptor
complex as shown by (1) the inability of GPIIb/IIIa complex-dependent
monoclonal antibodies to bind to the receptor, (2) the inability of the
mutant receptor to bind PAC-1, and (3) the inability of transfected CHO cells to adhere to immobilized fibrinogen.
| |
MATERIALS AND METHODS |
Subject.
The patient (L.W.) is a 55-year-old product of a nonconsanguineous
marriage who has been the subject of previous reports.24,25 He suffered from repeated bouts of epistaxis, excessive bleeding after
dental extractions and lacerations, and episodes of pharyngeal and
gastric bleeding. Several bleeding episodes required platelet transfusions. At age 39, he developed painful swelling of his ankles
and x-rays obtained 2 years later showed destructive changes in both
ankle joints with total loss of the entire tibial talar joint,
ebernution of the cartilaginous tissues, and cystic changes. Bilateral
ankle fusion was performed and histologic examination of the synovial
tissue showed evidence of remote hemorrhage and no active inflammation.
Studies for rheumatoid factor have been consistently negative.
Laboratory tests have demonstrated absent platelet aggregation in
response to ADP (50 µmol/L), but a normal initial response to
ristocetin. Clot retraction, observed at 37°C in citrated
platelet-rich plasma (PRP) that had been clotted with thrombin and
calcium, was absent at 1 hour and only partial at 24 hours.
Surface expression of platelet GPIb, GPIIb/IIIa, and
v3 receptors.
The preparation of PRP and the assessment of surface expression of
platelet receptors based on the binding of radiolabeled monoclonal
antibodies was performed as previously described.26 Platelet surface GPIb expression was assessed by the binding of murine
monoclonal antibody (MoAb) 6D127; GPIIb/IIIa expression was
assessed by the binding of the complex-dependent murine MoAb
10E526 and the Fab fragment of the mouse/human chimeric
antibody 7E328 (which also reacts with
v3); and GPIIIa expression was assessed by the binding of the murine MoAb 7H2.29 Surface expression of the v3 vitronectin receptor was
assessed by the binding of murine monoclonal antibodies
LM142,30 specific for human v, and
LM609,30 specific for the v3
complex (generously provided by Dr David Cheresh, Scripps Clinic, La
Jolla, CA).
Platelet fibrinogen levels and immunoblot analyses.
The preparation of platelets and the analysis of sodium dodecyl sulfate
(SDS)-solubilized platelets for fibrinogen, GPIIb, and GPIIIa levels by
SDS-polyacrylamide gel electrophoresis (PAGE) and immunoblot were
performed as previously described.31 Platelet fibrinogen
was quantified relative to myosin heavy chain by scanning densitometry
as previously described.19 For immunoblot analyses, samples
of SDS-solubilized untreated or surface-biotinylated platelet proteins
(see below) were first separated by SDS-PAGE and then electrophoresed
onto polyvinylidene difluoride (PVDF) membranes (Millipore, Burlington,
MA). The membranes were analyzed with a murine MoAb specific for
GPIIIa, 7H2,29 and a murine MoAb specific for the heavy
chain of GPIIb, PMI-1 (a generous gift of Dr Mark Ginsberg, Scripps
Clinic, La Jolla, CA)8,32,33 followed by an
horseradish peroxidase (HRP)-conjugated rabbit antimouse
kappa light chain specific antibody. For identification of bands in
immunoprecipitates from lysates of surface-biotinylated platelets,
HRP-streptavidin was used followed by detection using the avidin-ECL
chemiluminescence detection system (Amersham, Arlington Heights, IL).
To obtain a semiquantitative assessment of patient platelet GPIIb and
GPIIIa content, immunoblot band intensities of multiple dilutions of
normal and patient samples were compared visually after normalizing for
myosin heavy chain.
Platelet surface biotinylation and immunoprecipitation
analysis.
PRP from 30 mL of whole blood anticoagulated with EDTA (10 mmol/L) yielded a total of 4 × 109 platelets.
Platelets were washed three times in phosphate-buffered saline (PBS)
(137 mmol/L NaCl; 2.7 mmol/L KCl; 4.3 mmol/L
Na2HPO4, 1.4 mmol/L
KH2PO4; pH 7.4) containing EDTA (10 mmol/L),
and the platelet pellet was put on ice for 5 minutes. A fresh solution of Sulfo-NHS-LC-biotin (5 mmol/L) (Pierce, Rockford, IL) in PBS was
added to each pellet to yield a final platelet concentration of 2 × 109/mL. The pellets were quickly resuspended and
incubated on ice for 30 minutes with occasional mixing. The
biotinylated platelets were added to tubes prechilled on ice containing
5 mmol/L glycine in 5 mL Tris-buffered saline (TBS) (10 mmol/L Tris-Cl,
pH 7.4; 150 mmol/L NaCl; 0.05% NaN3) and EDTA (10 mmol/L)
(TSE) and incubated on ice for 10 minutes. Tubes were centrifuged
(900g) for 10 minutes and platelets were washed two times with
TSE containing glycine (5.0 mL each). Platelet pellets were solubilized
in lysis buffer (TBS containing 0.5% NP-40 and 2 mmol/L
phenylmethylsulfonyl fluoride) at a concentration of 4 × 108/mL, incubated on ice for 30 minutes with occasional
mixing, and centrifuged (12,000g) for 30 minutes at 4°C.
Supernatants were added to fresh tubes containing 1% deoxycholate and
0.1% SDS, centrifuged as in the previous step, and transferred to
fresh tubes for immunoprecipitation analysis.
Platelet lysates (1.0 mL each) were precleared by adding 100 µL of a
1:1 protein G sepharose (Pharmacia, Piscataway, NJ) slurry that was washed and equilibrated in immunoprecipitation (IP) buffer (100 mmol/L Tris-Cl, pH 7.4, 150 mmol/L NaCl, 0.5% NP-40, 1%
deoxycholate, 0.1% SDS). This step was repeated one time.
Immunoprecipitation of platelet GPIIb/IIIa was accomplished with
antibody 10E5, GPIIb with Tab34 (generously provided by Dr
Roger McEver, Oklahoma City, OK), and GPIIIa with 7H2. Antibody (5 µg/mL) was added to 20 µL (normal control) or 300 µL (patient
L.W.) aliquots, tubes were rotated for 1 hour at room temperature
followed by addition of protein G Sepharose slurry (50-µL/tube) and
rotation of tubes for an additional 45 minutes at room temperature.
After centrifugation (12,000g for 10 seconds), beads were
washed five times in IP buffer containing 600 mmol/L NaCl,
1% deoxycholate, 0.1% SDS (1.0 mL/tube), and then proteins were
eluted from the beads by heating to 95°C in sample buffer. Samples
were then analyzed by SDS-PAGE in 6.5% gels under reduced and
nonreduced conditions and transferred onto PVDF membranes (Millipore).
Biotinylated proteins were identified using the avidin-ECL
chemiluminescence detection system (Amersham), according to the
manufacturer's instructions.
Identification of mutation by polymerase chain reaction (PCR) and
sequencing.
Primers were synthesized (Operon Technologies, Inc, Alameda, CA),
resuspended in ddH2O (1.0 mmol/L), and stored at
 80°C. The sequences of the GPIIb specific primers that were
used for reverse transcriptase (RT)-PCR were kindly provided by Dr
Peter Newman (The Blood Center of SE Wisconsin, Milwaukee) and are
listed in Table 1. The sequences of the
GPIIb-specific sense 5 AGGCGAGTAGGGAGCAAAAG3
and antisense 5GAAAATATCCGCAACTGGAG3 primers used for the
amplification of exon 6 were previously described.35 The
protocols for RT-PCR and PCR amplification reactions and for the
sequence determinations of PCR amplified fragments, including cloned
fragments, were performed as previously described.19 The
identification of the mutant sequence was obtained from amplified PCR
fragments that were subcloned into the PCR II vector according to the
manufacturer's protocol (InVitrogen Corp, San Diego, CA). Confirmation
of the mutation was obtained from the patient's DNA by direct sequence
of amplified fragments of GPIIb exon 6.
Generation of GPIIb Leu214Pro mutant cDNA construct.
The GPIIb and GPIIIa cDNA constructs in the pcDNA3 mammalian cell
expression vector (Invitrogen Corp) were kindly provided by Dr Peter
Newman. Using primers A and B (Table 1), an RT-PCR amplified fragment
with the T to C mutation at nucleotide 64336 was
synthesized from the patient's RNA. First-strand cDNA synthesis was
performed using Superscript II (GIBCO-BRL Life
Technologies, Grand Island, NY), according to the
manufacturer's instructions. PCR amplification was performed by
preheating the following reaction mixture (50 µL total volume) to
96°C for 5 minutes: 0.4 µmol/L primer A, 0.4 µmol/L primer B,
0.2 mmol/L deoxynucleotides (dNTP), 1.5 mmol/L
MgCl2 , 20 µL cDNA, 2.5 U AmpliTaq (Perkin Elmer,
Norwalk, CT) in buffer (20 mmol/L Tris-Cl, pH 8.3, 50 mmol/L KCl).
After preheating, 30 cycles of 92°C for 45 seconds, 55°C for 30 seconds, and 72°C for 30 seconds with a final extension at 72°C
for 10 minutes were performed. The 776-bp fragment was digested with Ksp I and BbrPI (Boehringer Mannheim, Indianapolis, IN)
and gel-purified by electroelution for ligation into a gel-purified
preparation of pcDNA3/GPIIb vector in which the normal 524-bp
Ksp I-BbrPI fragment had been removed. XL-1 Blue
Escherichia coli cells (Stratagene, La Jolla, CA) were
transformed by electroporation (Bio-Rad Laboratories, Melville, NY)
according to the maufacturer's instructions. Single colonies were
picked for restriction enzyme analysis and the cloned insert was
sequenced to confirm the presence of the mutation and to eliminate any
PCR and cloning artifacts.
Flow cytometic analysis of transfected CHO cells.
CHO cells were transiently transfected with normal pcDNA3/GPIIb and
pcDNA3/GPIIIa or mutant pcDNA3/GPIIb and normal pcDNA3/GPIIIa cDNA
constructs using LipofectAmine reagent (Life Technologies, Gaithersburg, MD) according to a published protocol.37
Briefly, GPIIb and GPIIIa cDNA constructs (2 µg each) or pcDNA3 alone
(4 µg) were mixed with LipofectAmine (20 µL) in Dulbecco's
modified Eagle's medium (DMEM) (200 µL) for 10 minutes. This mixture was added to CHO cells (plated 24 hours before
transfection at 2 × 106 cells/100-mm tissue culture
dish) and incubated at 37°C for 6 hours. The transfection
efficiency of the GPIIb and GPIIIa expressing cDNA constructs in CHO
cells was determined by cotransfection with another plasmid, pXGH5,
that expresses human growth hormone (hGH) (Nichols Institute
Diagnostics, San Juan Capistrano, CA). The secreted hGH was measured in
the medium from each dish using the HGH-TGES kit (Nichols Institute
Diagnostics, San Juan Capistrano, CA). Briefly, medium (100 µL from
each dish was incubated with 125I-labeled and
biotin-labeled hGH antibodies and an avidin-coated bead for 90 minutes
at room temperature. The samples were washed and counted in a Packard
Autogamma 5650 (Packard Instrument Co, Downers Grove, IL).
GPIIb/IIIa surface expression was measured by flow cytometry
approximately 48 hours after transfection. Cells (3 to 5 × 106) were incubated with 10 µg/mL of monoclonal
antibodies 10E526 (anti-GPIIb/IIIa complex),
7E328 (anti-GPIIb/IIIa and
v3), and Tab34 (anti-GPIIb)
in 100 µL of DMEM on ice for 60 minutes, washed with PBS, and
incubated with fluorescein isothiocyanate (FITC)-labeled donkey
antimouse F(ab')2 fragments (Jackson ImmunoResearch, West
Grove, PA). To assess the ability of the receptors to bind the
PAC-138 MoAb, transfected CHO cells (3 to 5 × 106) were resuspended in TSBG buffer (50 mmol/L Tris, pH
7.4; 150 mmol/L NaCl; 5 mmol/L glucose) containing MgCl2
(1.4 mmol/L) and 100 µg/mL of the ligand-induced binding site (LIBS)
MoAb AP539 (generously provided by Dr Thomas Kunicki,
Scripps Clinic, La Jolla, CA) or the GPIIIa-specific MoAb
AP340 (generously provided by Dr Peter Newman) and
FITC-labeled PAC-1 (20 µL of 0.1 mg/mL) (Becton Dickinson
Immunocytometry Systems, San Jose, CA) in a total volume of 100 µL.
The samples were analyzed with a FACScan flow cytometer (Becton
Dickinson, Mountain View, CA) using LYSYS II software.
Adhesion of transfected CHO cells to immobilized fibrinogen.
Adhesion of transfected CHO cells to immobilized fibrinogen was
performed as previously described.19 Briefly, CHO cells were transfected by electroporation and analyzed 48 hours later. The
cells (1.5 × 108 cells/mL in 2 mL) were
51Cr-labeled for 1 hour at 37°C and incubated with TBS
alone and complex-dependent antibodies (50 µg/mL) 10E526
(anti-GPIIb/IIIa), 7E328 (anti-GPIIb/IIIa + v3), and LM60930
(anti-v3) for 30 minutes at room
temperature. Cells (50 µL/well) were added to the fibrinogen-coated plates and incubated for 1 hour at room temperature, washed, and adherent cells were lysed in 2% SDS (100 µL/well) for 30 minutes at
room temperature. Lysates were counted in a Packard Autogamma 5650 (Packard Instrument Company, Downers Grove, IL). Cells bound per well
were calculated from the specific activity of a control aliquot (50 µL) of 51Cr-labeled cells.
| |
RESULTS |
Expression of platelet surface receptors.
The binding of radiolabeled 6D1 antibody (anti-GPIba) to
the patient's platelets was 108% of the control value demonstrating that the patient's GPIb receptor was expressed at normal levels (Table 2). The binding of antibody 10E5
(anti-GPIIb/IIIa) was 2.6% of normal and the binding of c7E3 Fab
(anti-GPIIb/IIIa + v3) was 5.4% of
normal. In contrast, the patient's platelets bound 12% of the
normal amount of antibody 7H2 (anti-GPIIIa), which does not require
GPIIb/IIIa complex formation. The discordance between the binding
values for 7H2 versus those of 10E5 and 7E3, raised the possibility
that there may be GPIIb/IIIa complexes on the platelet surface that are
not recognized by 10E5 and 7E3 because of abnormalities in complex
formation. Antibody LM609 (anti-v3) was
tested at two different concentrations, and in both cases, the
patient's platelets bound more antibody molecules than did the normal
platelets (192% of normal). The increased level of surface
v3 receptors indicates that GPIIIa
(3) is probably normal, making it likely that the
patient's abnormality is in GPIIb.
Platelet fibrinogen level and immunoblot analyses.
Platelet -granule fibrinogen levels depend on the expression of
functional GPIIb/IIIa receptors41 and so we analyzed the patient's platelet fibrinogen content. Based on scanning densitometry of SDS-PAGE gels, the patient's platelet fibrinogen level was 5%
of normal. This value is similar to the levels of fibrinogen (3% to
11% of normal) identified in the platelets of patients with Glanzmann
thrombasthenia having no GPIIb/IIIa or only trace amounts of
GPIIb/IIIa.42,43 This value is much less than the 36% of
normal levels we found in a patient with only 10% of normal surface
GPIIb/IIIa whose mutant GPIIb/IIIa receptors were able to support cell
adhesion to fibrinogen.19
To determine the levels of total GPIIb and GPIIIa in the patient's
platelets, immunoblot analyses were performed. Semiquantitative estimates of GPIIb and GPIIIa levels were determined by analysis of
multiple dilutions of patient and control solubilized platelets using
the antibodies 7H2 (anti-GPIIIa) and PMI-1 (anti-GPIIb). Under
nonreduced conditions, GPIIIa migrates at an Mr of
95,000 (Fig 1A, arrow). The protein
level of GPIIIa in the patient's platelets was determined to be
35% of normal. This level is considerably higher than the low and
undetectable levels of GPIIIa, respectively, in the platelets of two
other patients with Glanzmann thrombasthenia who have mutations in
GPIIb (Arab) and GPIIIa (Iraqi-Jewish).44 This level is
also higher than the estimate of surface GPIIIa (Table 2), suggesting
that a disproportionate amount of GPIIIa is intracellular. The GPIIb in
the patient's platelets was analyzed under nonreduced (data not shown)
and reduced (Fig 1B) conditions to determine the levels of proGPIIb,
which migrates at Mr 140,000 (Fig 1B, closed arrow), and
mature processed GPIIb heavy chain, which migrates at Mr
120,000 (Fig 1B, open arrow). A semiquantitative estimate of mature
GPIIb heavy chain in the patient's platelets was 25% of normal.
The total of proGPIIb and mature GPIIb was estimated to be 30% of
normal, which is similar to the estimate of GPIIIa content (35%),
but much higher than the <1% of normal GPIIb content we found in
other patients with Glanzmann thrombasthenia.45 Of interest
was the identification of an abnormally migrating immunoreactive GPIIb
fragment of Mr 100,000 (Fig 1B, arrow head) in both
reduced samples of the patient's platelets obtained more than 5 years
apart. Nonreduced samples of the patient's platelets also showed an
abnormal GPIIb-immunoreactive fragment, but the Mr was
120,000 (data not shown). Because the epitope for the PMI-1 antibody is
located near the carboxy-terminal end of the GPIIb heavy
chain,33 these data suggest that the abnormal band may be
due to proteolytic cleavage of a fragment from the amino-terminus of
GPIIb.
View larger version (58K):
[in this window]
[in a new window]
| Fig 1.
Immunoblot analyses of GPIIIa (nonreduced) and GPIIb
(reduced). SDS-solubilized platelets (1 µL of 5 × 107
platelets/mL) were electrophoresed into a 7.5% polyacrylamide gel,
electrotransferred onto PVDF membranes, and developed as previously
described.31 (A) Control, patient, and two other GT patient
samples with mutations in GPIIIa (I-J: Iraqi-Jewish) and GPIIb
(Arab)44 were run under nonreduced conditions. The membranes were incubated with the anti-GPIIIa specific murine MoAb,
7H2.29 The arrow indicates the position of GPIIIa. (B) Two
patient samples prepared on different dates (January 1990 and February
1995) and a control sample were run under reduced conditions. The
membranes were incubated with the anti-GPIIb heavy chain specific
murine MoAb, PMI-1.32,33 The solid arrow indicates the
position of proGPIIb, the open arrow, mature processed GPIIb, and the
arrow head an abnormally migrating fragment.
|
|
Surface biotinylation and immunoprecipitation of platelet GPIIb/IIIa
receptors.
Because an abnormal fragment of GPIIb was identified in the patient's
platelet lysate, the molecular weights of the GPIIb and GPIIIa subunits
expressed on the surface of the patient's platelets were determined.
Platelet surface proteins were biotinylated and the receptor was
immunoprecipitated from platelet lysates using the GPIIIa specific
MoAb, 7H2, the GPIIb specific MoAb, Tab, and the complex-dependent
MoAb, 10E5. To insure that the anti-GPIIb MoAb Tab recognized the
abnormal fragment of GPIIb, immunoblots of the biotinylated platelet
lysates using PMI-1 were performed with
(Fig 2A, right) and without (Fig 2A, left)
immunoprecipitation using Tab. As already shown in Fig 1B, the
abnormally migrating fragment was demonstrated in the immunoblot using
PMI-1 (Fig 2A, left) and this fragment was also identified in the
sample after immunoprecipitation with Tab (Fig 2A, right). These data
show that the GPIIb-specific MoAb, Tab, recognized the abnormally
migrating GPIIb fragment in the patient's platelets.
View larger version (32K):
[in this window]
[in a new window]
| Fig 2.
Immunoblot and immunoprecipitation of solubilized,
surface-biotinylated platelets. (A) Left panel, immunoblot of patient
and control platelet lysates using the GPIIb-specific MoAb,
PMI-1.32,33 This pattern is essentially identical to that
in Fig 1 except that because the control sample was diluted 20-fold,
the bands in the patient's sample are more intense than the bands in
the control sample. Right panel, immunoprecipitation of lysates using the GPIIb-specific MoAb, Tab34 and immunoblotting with
PMI-1. Samples were electrophoresed under reduced conditions and arrows mark the positions of pro-GPIIb, mature GPIIb, and the GPIIb fragment. These data indicate that Tab recognizes all forms of the mutant GPIIb.
(B) Patient and normal control surface-biotinylated platelet lysates
were immunoprecipitated with the GPIIb/IIIa complex-specific MoAb,
10E5,26 the GPIIb-specific MoAb, Tab, and the
GPIIIa-specific MoAb, 7H2.29 Immunoprecipitates were
electrophoresed under nonreduced conditions and blotted onto PVDF
membranes. The membranes were treated with HRP-streptavidin and the
bands developed. Arrows mark the positions of GPIIb and GPIIIa. Because
only surface-labeled molecules are detected by the avidin reagent, the
failure to identify the patient's abnormal GPIIb bands indicates that
these were not present on the surface of the patient's platelets. (C)
Experiment conducted as in (B) except immunoprecipitates were reduced
before electrophoresis.
|
|
We next assessed which glycoproteins were expressed on the platelet
surface by first immunoprecipitating all of the immunoreactive proteins, but only detecting the ones that were surface-biotinylated by
using an avidin-HRP conjugated reagent. In the nonreduced (Fig 2B) and
reduced (Fig 2C) samples immunoprecipitated with 10E5, Tab, and 7H2;
only GPIIb and GPIIIa subunits of normal Mr were detected
by this technique. The surface GPIIb immunoprecipitated by both Tab and
7H2 only contained the band of normal mobility, indicating that the
abnormal GPIIb molecules do not become expressed on the platelet
surface. The 10E5 MoAb failed to immunoprecipitate the patient's
surface exposed GPIIb/IIIa receptors presumably because the abnormality
affects the 10E5 epitope. These data are consistent with the surface
expression studies in which 125I-10E5 antibody binding to
the patient's platelets was only 2.6% of normal (Table 2).
Identification of a GPIIb mutation.
Based on increased expression of platelet surface
v3 receptors and the presence of an
abnormal fragment of GPIIb in the patient's platelet lysates (Fig 2),
sequence analysis of GPIIb RNA was performed. Using 10 pairs of primers
(Table 1) that hybridize to sequences specific for GPIIb cDNA, PCR
products were generated by RT-PCR from total RNA of the patient and a
normal control. The amplified products from patient and control samples
were cloned and sequenced. The only abnormality that was identified was
a T to C mutation (Fig 3A) at nucleotide
64336 that corresponds to a Leu214Pro substitution. The
mutation was confirmed by performing another RT-PCR reaction using
primers E and F (Table 1) and sequencing the cloned product. Because Leu 214 is encoded within exon 6 of the GPIIb gene,46
specific primers were also used to amplify this exon from high
molecular weight DNA isolated from patient and control peripheral blood mononuclear cells. Direct sequence analysis of exon 6 PCR fragments showed only the T to C mutation in the patient's sample indicating that the patient did not have any normal DNA (Fig 3).
View larger version (57K):
[in this window]
[in a new window]
| Fig 3.
PCR-amplified fragments and sequence analyses of control
and patient RNA and DNA samples. (A) RT-PCR amplification of RNA extracted from normal control (N) and patient (LW) platelets. Using
primers A and C (Table 1), a 424-bp fragment was cloned and sequenced.
Arrows indicate the T (normal) to C (patient) nucleotide base change.
(B) PCR amplification of DNA extracted from peripheral mononuclear
cells isolated from a normal control (N) and the patient (LW). Using
primers specific for amplification of GPIIb exon 6, the 245-bp
fragments were directly sequenced as described previously. Arrows
indicate the T (normal) to C (patient) nucleotide base change. No
normal sequence was identified in the patient's DNA.
|
|
Surface expression of GPIIb/IIIa on CHO cells.
CHO cell expression studies were performed to assess the effect of the
Leu214Pro mutation in GPIIb/IIIa receptor expression and function. A
GPIIb cDNA construct containing the T to C transition at position
64347 was generated by RT-PCR amplification of a fragment
including the mutation from the patient's RNA and subsequently cloned
into the cDNA construct. The mutant construct was coexpressed with a
normal GPIIIa cDNA construct in CHO cells, as was normal GPIIb with
normal GPIIIa. To determine the surface expression of normal and mutant
GPIIb/IIIa receptors, flow cytometry was performed using the
GPIIb-specific MoAb, Tab (which previously was shown to
immunoprecipitate the patient's GPIIb; Fig 2) and the GPIIb/IIIa complex-dependent antibodies 10E5 and 7E3
(Table 3). Because both GPIIb and GPIIIa
subunits are required for cell surface expression, the GPIIb surface
expression levels are indicative of GPIIb/IIIa receptor expression. In
both experiments, transfection efficiencies were similar for the normal
and mutant constructs assessed by the secretion of hGH (Table 3,
legend). CHO cells cotransfected with mutant GPIIb and unmutated GPIIIa
cDNA constructs bound 60% of the amount of Tab antibody that bound
to CHO cells expressing normal GPIIb/IIIa receptors. Despite the high
level of GPIIb and GPIIIa expression, the binding of the 10E5 and 7E3
complex-dependent antibodies was 10% of normal and <1% of
normal, respectively. Thus, consistent with the data from the
patient's platelets, the mutant GPIIb/IIIa receptor adopts a
conformation that disrupts the 10E5 and 7E3 epitopes.
PAC-1 binding to LIBS-activated normal and mutant GPIIb/IIIa
receptors.
To assess ligand-binding function of mutant GPIIb/IIIa receptors
expressed on CHO cells, antibody binding studies using the activation-dependent MoAb, PAC-1, were performed on CHO cells incubated
with the LIBS antibody AP5 (Fig 4). The
anti-GPIIIa specific antibody, AP3, was used as a negative control for
AP5 because it does not induce activation of the GPIIb/IIIa receptor. FITC-PAC-1 binding to normal and mutant GPIIb/IIIa expressing CHO
cells was measured using flow cytometry. The binding of PAC-1 to CHO
cells expressing wild-type GPIIb/IIIa receptors activated with AP5 was
significantly increased over cells incubated with the nonactivating AP3
antibody. In contrast, despite the high levels of mutant GPIIb/IIIa
receptors expressed on the CHO cell surface (Table 3), the binding of
PAC-1 to CHO cells expressing mutant GPIIb/IIIa receptors activated
with AP5 was the same as the binding to mutant cells incubated with AP3
and the same as PAC-1 binding to mock transfected cells incubated with
either AP3 or AP5. These data suggest that the mutant receptor cannot be induced to make the transition to a high-affinity ligand binding conformation.
View larger version (38K):
[in this window]
[in a new window]
| Fig 4.
Binding of the PAC-1 MoAb to CHO cells expressing normal
and mutant GPIIb/IIIa receptors. CHO cells were transfected with vector
alone (Mock), mutant GPIIb and normal GPIIIa (Patient LW), and normal
or wild-type GPIIb and GPIIIa (WT) cDNA constructs. The cells were
incubated with FITC-PAC-1 in the presence of the GPIIIa-specific LIBS
antibody AP539 or a control anti-GPIIIa-specific antibody
AP3.40 Flow cytometric analyses were performed and data are
presented as mean fluorescence intensity (MFI) ± standard deviation
(SD) from five separate experiments. *A
two-tailed Student's t-test was performed showing that the
binding of PAC-1 to WT cells in the presence of AP5 was significantly greater than the binding in the presence of AP3 (P < .004),
while the binding of PAC-1 to AP5-activated Patient LW (P = .35) transfected cells was not greater than the binding in the presence
of AP3.
|
|
Adhesion of normal and mutant GPIIb/IIIa-expressing CHO cells to
immobilized fibrinogen.
To further assess ligand-binding function of the mutant GPIIb/IIIa
receptors, the adhesion of CHO cells expressing wild-type and mutant
receptors to microtiter wells precoated with immobilized fibrinogen was
tested (Fig 5). Cells expressing normal
GPIIb/IIIa receptors adhered to the fibrinogen-coated wells and the
adhesion was nearly completely inhibited by antibodies 7E3
(anti-GPIIb/IIIa + v3) and 10E5
(anti-GPIIb/IIIa). Inhibition with antibody LM609 (anti-v3) was minimal because adhesion of
v3 receptors to immobilized fibrinogen
requires the presence of MnCl2,48 which was not
added in the experiment. These data provide evidence that adhesion of
the transfected CHO cells to immobilized fibrinogen is mediated via the
GPIIb/IIIa receptor. In contrast, the cells expressing the mutant
receptor bound to the fibrinogen-coated wells no better than the
background binding of mock transfected cells. To assess the possibility
that adhesion by wild-type cells is mediated exclusively by cells
expressing the highest level of receptors, flow cytometry using the
GPIIb-specific MoAb, Tab, was performed on wild-type cells after
adhesion to immobilized fibrinogen. The profile of adherent
wild-type-expressing cells was broad, encompassing cells with quite
variable expression of GPIIb/IIIa receptors. This expression profile
for adherent wild-type cells overlapped the profile of Tab binding to
the entire population of mutant-expressing cells, showing that the
mutant cells expressed sufficient levels of receptors for adhesion to
immobilized fibrinogen (data not shown). In conclusion, these data
indicate that the Leu214Pro mutation in GPIIb disrupts the
ligand-binding properties of the GPIIb/IIIa receptor complex.
View larger version (24K):
[in this window]
[in a new window]
| Fig 5.
Adhesion of transiently transfected CHO cells to
immobilized fibrinogen. 51Cr-labeled CHO cells transfected
with vector alone (Mock), mutant GPIIb and normal GPIIIa cDNA
constructs (Patient LW), and wild-type GPIIb and GPIIIa cDNA constructs
(WT) were added to microtiter wells precoated with fibrinogen (100 µL
of 20 µg/mL). Cells were incubated with buffer ( ) or MoAbs
specific for v3 (LM609)
( ),30 GPIIb/IIIa + v3
(c7E3) (),28 and GPIIb/IIIa (10E5) ( ).26 The number of cells per well was calculated according to the specific activity of a 50-µL aliquot of cells sampled at the beginning of the
experiment, as previously described.19 Data are presented as mean ± SD of 4 data points obtained from two separate experiments.
|
|
| |
DISCUSSION |
We have identified a patient with typical clinical and laboratory
features of Glanzmann thrombasthenia who has a Leu214Pro mutation in
the GPIIb subunit of the platelet GPIIb/IIIa receptor. One unusual
aspect of the patient's history is long-standing seronegative arthritis. Although histology of his joint lining indicated evidence of
distant hemorrhage, it is unlikely that his platelet disorder was
causal because he did not give a history suggestive of repeated hemarthroses and spontaneous hemarthroses are rare in Glanzmann thrombasthenia.20
The leucine residue at position 214 in human GPIIb is conserved in
rodent GPIIb13 and a number of human -chain subunits including v, 1, 2, and
513,49 suggesting that this residue may be
located in a site important for the conformational integrity of the
receptor. Within the normal architecture of a protein molecule, proline
residues can usually be found in regions of direction change; thus the
probability of a proline residue being located in a -turn structure
is high.50 A predicted secondary structure of the amino
terminal domain of integrin -chain subunits has been
determined51 and the Leu214 residue in GPIIb immediately
precedes a predicted -turn structure comprising amino acids 215-224 (GAPGGYYFLG) that is highly conserved in non-I domain -chain
subunits.13,49 Within the -turn structure is a proline
residue at position 217 and this residue is highly conserved in rodent
GPIIb and in all non-I domain containing -chain subunits.13,49 Importantly, this -turn
structure has been implicated in ligand-binding function of the
GPIIb/IIIa receptor52 and the
41 and 51
integrin receptors.53 Due to significant homology among
integrin -subunits, this region has been proposed as a site involved
in the ligand-binding function of non-I domain containing
integrins.53 The Leu214Pro mutation identified in this
study results in the creation of a proline-glycine-alanine-proline (PGAP) sequence at the amino-terminal end of the -turn structure. The rigidity of the two proline residues linked by flexible glycine and
alanine residues may create a kink in the secondary structure affecting
the conformation of the -turn. The inability of mutant GPIIb/IIIa
receptors to be recognized by conformation-dependent antibodies, to be
activated into a high-affinity ligand binding conformation, and to
adhere to immobilized fibrinogen suggests that this structural
alteration affects ligand-binding and that the Leu214Pro mutation has
either an indirect or direct effect on this site.
In addition to disrupting the ligand-binding conformation of the
GPIIb/IIIa receptor, the Leu214Pro mutation resulted in decreased surface expression of the receptor on the patient's platelets (Table
2). Platelet surface receptor levels were determined to be 12% of
normal using an anti-GPIIIa specific antibody. A total of 27 mutations
have been identified in the gene encoding GPIIb (including the mutation
in this study).21,22 The majority of patients have surface
expression levels of less than 10% of normal and one patient was
reported to have expression levels greater than 20% of
normal.54 Three patients have been reported to have receptor surface expression levels similar to that of patient LW55-57 and transfection studies showed comparable receptor
expression levels to those identified on the patient's platelets. In
characterizing the Leu214Pro mutation in CHO cells, an interesting
finding was that surface expression levels of the receptor were 60%
of normal compared with the 12% of normal levels on the surface of
the patient's platelets. The discrepancy between the receptor
expression levels on the surface of platelets and CHO cells is likely
due to differences in proteolysis of the mutant GPIIb subunit between the cell types. Thus, when both intracellular and surface GPIIb/IIIa were measured by immunoblot analysis, the patient's total platelet GPIIb/IIIa content was actually 30% to 35% of normal, with the proteolytic fragment of GPIIb a significant component. In contrast, this fragment was not present in lysates of CHO cells expressing the
mutant GPIIb/IIIa receptor (data not shown). There are several possible
reasons for the mutant GPIIb fragment being detectable in the
patient's platelets, but not in transfected CHO cells: (1) proteolysis
may occur over a period of time during platelet formation and
survival the CHO cell expression studies were performed over 48 hours
using cells that were transiently transfected with normal and mutant
cDNA constructs, whereas platelets are formed over 8 to 10 days and
circulate for another 10 days; (2) the enzyme(s) in platelets
responsible for the cleavage of the GPIIb subunit may not be expressed
or activated in CHO cells; and (3) the conformation of the GPIIb
subunit that may result in susceptibility to proteolytic cleavage may
not be formed during biogenesis of the receptor complex in CHO cells.
It is interesting to speculate that the absence of mutant GPIIb
cleavage in CHO cells contributed to the higher surface expression than
was found in the patient's platelets.
By immunoblot with an antibody to the carboxy-terminus of GPIIb
(residues 875-891), the patient's GPIIb fragment was Mr
120,000 with nonreduced platelets (which is 20,000 less that
proGPIIb or nonreduced GPIIb). On reduction, a fragment of
Mr 100,000 was identified, which presumably is the same
fragment identified under nonreducing conditions, but without the GPIIb
light chain (Mr 20,000). These data suggest that the GPIIb fragment
is formed by proteolysis of the amino-terminal end of the GPIIb heavy
chain. If the cleavage interferes with transport of GPIIb to the
platelet surface, which seems plausible, as the signal sequence is
likely to be included, this might explain the relatively large amount of intraplatelet GPIIb/IIIa compared with platelet surface-expressed receptors, as well as the failure to find the cleaved GPIIb fragment on
the surface of the patient's platelets. The Mr of the
fragment suggests that cleavage occurs near amino acid 200, which is
near to the mutation site, suggesting that the additional proline may expose a nearby site that is susceptible to proteolysis.
We could not detect any normal GPIIb sequence in our analyses of the
patient's RNA or DNA, and this raises interesting questions because
both the patient and his mother deny that he is the product of a
consanguineous relationship. We excluded the presence of a large
deletion affecting a possible second GPIIb allele by Southern blot and
fluorescent in situ hybridization (FISH) analyses (V. Najfeld,
unpublished data, November 1996). Another Glanzmann
thrombasthenia patient was recently reported in whom only a mutant
GPIIIa could be identified even though consanguinity was
denied.58 Haplotype analyses of chromosome 17 suggested
that homozygosity was due to uniparental disomy from the patient's
mother. We would like to perform similar studies, but the patient's
father is dead and his mother has not yet been available to study; the
patient denies having any children.
In conclusion, we have identified a new GPIIb mutation, Leu214Pro, that
produces a Glanzmann thrombasthenia phenotype due to both qualitative
and quantitative abnormalities. This mutation alters the conformation
of the GPIIb/IIIa receptor and disrupts ligand-binding. It is located
within the first 334 residues of GPIIb, a region that has been
identified as contributing to the ligand-binding pocket of the
GPIIb/IIIa receptor,59 and amino-terminal to a putative
binding site for the fibrinogen -chain dodecapeptide sequence
(residues 294-314).60,61 The presumed defect in ligand binding capacity of the patient's GPIIb/IIIa receptor is supported by
the finding that the patient's platelets contained only 5% of
normal levels of plasma fibrinogen even though they contained 12%
of the normal number of receptors on the platelet surface. The platelet
fibrinogen level in this patient is much lower than the 36% of
normal that we identified in another patient with Glanzmann
thrombasthenia whose platelets contained only 10% of the normal
numbers of surface receptor.19 This latter patient has a
Cys374Tyr mutation in GPIIIa that affects surface expression, but not
the ability of the receptor to mediate adhesion to immobilized fibrinogen. Thus, even though these two patients had mutations resulting in comparable levels of surface GPIIb/IIIa receptors, the
characterization of parameters such as platelet fibrinogen levels and
receptor function in transfected cells provided important structure/function information on biosynthesis, ligand-binding, and
protein trafficking functions of the receptor. Finally, our studies
highlight the importance of rigidly classifying Glanzmann thrombasthenia mutations into quantitative versus qualitative abnormalities, as a single mutation may produce both effects.
| |
FOOTNOTES |
Submitted January 24, 1997;
accepted October 14, 1997.
Supported by Grant No. 19278 from the National Heart, Lung and Blood
Institute (to B.S.C.) and Grant No. 91014650 from the National American
Heart Association (to D.L.F.).
Address reprint requests to Deborah L. French, PhD,
Division of Hematology, Department of Medicine, Box 1079, Mount Sinai School of Medicine, One Gustave L. Levy Place, New York, NY
10029.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. section 1734 solely to indicate this fact.
| |
ACKNOWLEDGMENT |
We thank Dr Peter Newman for generously providing us with GPIIb and
GPIIIa cDNA constructs, oligonucleotide primer sequences for cDNA
analyses, the AP3 MoAb, and very helpful technical advice; to Dr Mark
Ginsberg for kindly supplying the PMI-1 MoAb, Dr David Cheresh for
kindly supplying LM609 and LM142 MoAbs, Dr Rodger McEver for kindly
supplying the Tab MoAb, and Dr Thomas Kunicki for kindly supplying the
AP5 MoAb. We are grateful to Dr Vesna Najfeld, Director Tumor
Cytogenetics Laboratory at Mount Sinai Medical Center, for performing
FISH analyses and to Lesley Scudder for her expert technical
assistance.
| |
RE | |
Abstract
Introduction
Abstract