|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
Blood, Vol. 91 No. 5 (March 1), 1998:
pp. 1572-1581
By
From the Blood Research Institute, The Blood Center of Southeastern
Wisconsin, Milwaukee; the Department of Pediatrics, Medical College of
Wisconsin, Milwaukee, WI; and the Howard Hughes Medical Institute and
the Department of Biochemistry and Molecular Biophysics, Washington
University School of Medicine, St Louis, MO.
von Willebrand disease (vWD) is a common, autosomally inherited,
bleeding disorder caused by quantitative and/or qualitative deficiency of von Willebrand factor (vWF). We describe two families with a variant form of vWD where affected members of both families have
borderline or low vWF antigen levels, normal vWF multimer patterns,
disproportionately low ristocetin cofactor activity, and significant
bleeding symptoms. Whereas ristocetin-induced binding of plasma vWF
from affected members of both families to fixed platelets was reduced,
botrocetin-induced platelet binding was normal. The sequencing of
genomic DNA identified unique missense mutations in each family in the
vWF exon 28. In Family A, a missense mutation at nucleotide 4105T
VON WILLEBRAND DISEASE (vWD) is a common,
autosomally inherited bleeding disorder caused by a quantitative
and/or qualitative deficiency of von Willebrand factor (vWF)
affecting as many as 1% to 2% of the general population.1
vWF is an adhesive glycoprotein that is synthesized by both
megakaryocytes and endothelial cells and is stored in the secretory
granules of these cells as an array of multimers that range in
molecular weight from 500-kD dimers to multimers in excess of 20,000 kD.2 The primary functions of vWF are to serve as a carrier
protein for plasma factor VIII and as a ligand to support the adhesion
of platelets to the subendothelial matrix at sites of vascular damage.
vWF adheres to subendothelial matrix, likely through binding to
collagen,3 after which there is a change in the
conformation of vWF that converts it to an active ligand for the
platelet adhesive receptor glycoprotein (GP) Ib.4 In vitro,
vWF binding to platelet GPIb can be induced by the addition of the
antibiotic ristocetin, the snake venom protein botrocetin, or by
subjecting platelets and vWF to high shear stress.5-7 The
domain that mediates vWF interaction with platelet GPIb is the large
disulfide loop formed between Cys509 and Cys695 contained within the A1
domain of the vWF protein.8-10
vWD is broadly classified into types based on quantitative deficiencies
of vWF (type 1 and type 3 vWD) and qualitative deficiencies in vWF
(type 2 vWD).11 Type 2 vWD is further subdivided into various categories based on structural and functional abnormalities with the type 2M classification (type 2 mutations with normal multimers) being reserved for those that do not fit into the 2A, 2B,
and 2N subgroups. Type 2M vWD was previously referred to as a variant
of type 1 vWD, as there was no loss of high MW multimers, yet there was
decreased platelet-dependent function.12 Our laboratory has
recently reported type 2MMilwaukee-1 vWD, in which
patients have a very mild bleeding disorder, a modest reduction of
plasma vWF antigen (vWF:Ag) levels, disproportionately reduced vWF
ristocetin cofactor activity (vWF:RCo), normal vWF multimers, and a
parallel reduction in both ristocetin- and botrocetin-induced binding
of vWF to platelets.13 The genetic defect responsible for
the low vWF:RCo activity in type 2MMilwaukee-1 vWD
is an in-frame deletion of amino acids Arg629-Gln639 ( In comparing patients with low vWF levels and normal vWF multimers, we
evaluated the ratio of vWF:RCo activity to vWF:Ag in 681 individuals as
part of a previous study.13 Several patients, including
those presented in this report, had vWF:RCo activity/vWF:Ag ratios that
were decreased more than 2 standard deviations (SD) below the mean,
suggesting a similar genetic lesion. We report here two new families
with type 2M vWD, in which the affected individuals of both families
have borderline or low vWF:Ag levels, normal vWF multimer patterns,
disproportionately low vWF:RCo activity, and decreased
ristocetin-induced platelet binding. Two new missense mutations were
identified within the A1 loop of vWF. The vWF defects from affected
individuals in the families described in the current report have normal
botrocetin-induced platelet binding of vWF, normal collagen binding of
vWF, and a stronger history of clinical bleeding and are thus
phenotypically distinct from our previous report of type
2MMilwaukee-1 vWD.13
Patients.
Two unrelated families with abnormal bleeding histories were identified
with low vWF:Ag, disproportionately low vWF:RCo activity, and normal
multimer structure in the affected members. Available members of three
generations of each family were seen in the Pediatric Clinical Research
Center at Children's Hospital of Wisconsin. Plasma was evaluated by
the Hemostasis Reference Laboratory at The Blood Center of Southeastern
Wisconsin, Milwaukee, WI. Plasma vWF:RCo activity was determined by
ristocetin-induced agglutination of formalin-fixed platelets as
previously described.15 vWF:Ag levels of the same samples
were measured by quantitative Laurell rocket
immunoelectrophoresis.16 Plasma vWF multimers were analyzed by electrophoresis on a 0.65% sodium dodecyl sulfate (SDS)/agarose gel
using a discontinuous buffer system and detection with
125I-anti-vWF antibody (Ab) as described by Ruggeri and
Zimmerman.17,18
Polymerase chain reaction (PCR) amplification of genomic DNA.
After obtaining informed consent, blood samples were collected from
individuals in both families. Genomic DNA was prepared from peripheral
white blood cells from patients AII-1 and AIII-1 in Family A and
patients BII-1, BIII-1 and BIII-2 in Family B as previously
described.19 The vWF DNA sequence is numbered starting from
the ATG of the initiating Met codon of exon 2.20 Amino acid
numbering starts with the mature vWF sequence. For selected Family A
patients, vWF exon 28 was amplified from genomic DNA by PCR with
Amplitaq Taq polymerase (Perkin-Elmer Cetus, Norwalk, CT) using sense
primer VsI27-4:EcoRI (GAGgaatTcTGGGAATATGGAAGTCATTG) located in
intron 27 and antisense primer VaI28-6:BamHI
(tGAGgatccTCTTGGCAGATGCATGTAGC) located in intron 28 of the vWF
gene.21 These primers were chosen for selective
amplification of vWF gene sequence without interference from the vWF
pseudogene.22 Lower case letters indicate where nucleotides
(nt) differ from the vWF gene sequence for the purpose of introducing
restriction enzyme sites into the final product. For selected Family B
patients, DNA from exon 28 of the vWF gene was amplified by PCR using
sense primer VsI27-3 (CCACAGGTTCTTCCTGAACCATT) located in intron 27 and
antisense primer a5040-5020 located in exon 28 of the vWF gene. This
was followed by a second amplification using nested sense primer
Vs3673-3697:Nsi I (atgCAtTGTGATGTTGTCAACCTCA) and antisense
primer a4488-4462. After PCR amplification, the amplified DNA products
were subcloned into plasmids (TA cloning PCR Vector by
Invitrogen, Carlsbad, CA; Version 2.0) and sequenced using
Sequenase kit (V.2.0, United States Biochemical, Cleveland, OH).
Rapid PCR/restriction digestion method for detection of mutations.
Because the mutation in Family A does not create or delete a
restriction site, a Bcl I restriction site unique to the
mutation in Family A was created using additional base changes in a PCR primer. Primer Vs4067
(tgtggtGCGAGGTCTTGAAATACACACTGTTCCtgATC) introduced a TG
(underlined) at nts 4100-1 such that the Bcl I restriction site
(tgATCA4105) is created only when the missense
mutation 4105T Plasmid constructs and expression of recombinant vWF.
The Asp I/Nco I restriction fragments (nt 3832-4481 of
vWF) of the subcloned PCR products amplified from genomic DNA from patients AII-1 and AIII-1 in Family A and patients BII-1 and BIII-2 in
Family B were subcloned into P18vW1, an intermediate vector that was
constructed by the insertion of the BamHI/Kpn I
restriction fragment (nt 2717-4752 of mature vWF) from the full length
vWF cDNA expression plasmid pvW198.1 (provided by Dennis Lynch, Dana Farber Cancer Center, Boston, MA) into the plasmid vector pUC-18 (United States Biochemical).19 The BamHI/Kpn
I restriction fragment of the resulting construct containing the
vWD mutant sequence was ligated into the corresponding BamHI
and Kpn I sites of the full-length vWF expression plasmid
pvW198.1. The pvW198.1 and mutant expression plasmids were used to
transfect COS-7 cells in the presence of Lipofectamine (GIBCO-BRL,
Gaithersburg, MD) using the protocol of Felgner et al.23
After 48 hours, conditioned media were harvested, cleared by low speed
centrifugation, and stored at Multimer analysis of recombinant vWF.
Recombinant vWF was immunoprecipitated with vWF MoAb AvW-1 coupled to
Sepharose-4B (Pharmacia, Piscatay, NJ). Immunoprecipitated vWF (14 ng)
was analyzed on a 1.5% resolving gel as described by Raines et
al,25 with the following modifications. After adding the
samples to the wells, electrophoresis was performed at 150 V (constant)
for 7 to 8 hours in a Bio-Rad Model 1415 electrophoresis chamber
(Bio-Rad Laboratories, Richmond, CA) cooled to 15°C.
After electrophoretic transfer to nitrocellulose, recombinant vWF
multimers were detected using anti-vWF rabbit polyclonal Ab followed by horseradish peroxidase-conjugated goat antirabbit IgG (Pierce) and
visualized by chemiluminescence using the ECL Western blot detection
system (Amersham Corp, Arlington Heights, IL).
Platelet binding assay.
The binding of vWF to fixed platelets was measured using a modification
of a procedure previously described.19,26 Briefly, AvW-1, a
vWF MoAb that does not interfere with vWF binding to either GPIb or
GPIIbIIIa,24,27 was labeled with 125I (DuPont
NEN, Boston, MA) using Iodo-Beads (Pierce). 125I-AvW-1 was
incubated with either plasma (3 parts plasma: 1 part 125I-AvW-1, 6,000 cpm/µL) or conditioned medium (60 parts
conditioned medium: 1 part 125I-AvW-1, 2,000 cpm/µL) for
30 to 60 minutes at 22°C. For recombinant vWF experiments,
conditioned medium from transfected COS-7 cells or normal pooled human
plasma were diluted in Tris-saline (20 mmol/L Tris pH 7.4, 150 mmol/L
NaCl) such that equal amounts of vWF (determined by ELISA as described
above) were used within a single platelet binding experiment (range, 50 to 100 ng/mL). Labeled plasma (35 µL, 50,000 cpm) or conditioned
media (300 µL, 10,000 cpm) was incubated with formalin-fixed
platelets (200 µL of 2 × 108/mL for plasma, or 40 µL of 4 × 108/mL for recombinant vWF experiments,
BioData, Hatboro, PA) in the presence of ristocetin (Helena, Beaumont,
TX), botrocetin, or control buffer and gently rocked for 30 to 60 minutes at 22°C. Botrocetin was purified as described by Andrews et
al.28 After pelleting platelets and platelet bound vWF
(12,000g, 10 minutes), the upper half of the supernatant was
transferred to a clean tube. The amount of radioactivity in the pellet
half (a) and the supernatant half (b) fractions was determined using a
gamma counter. The percent of vWF bound to the platelets was calculated
using the formula: [(a Collagen and AvW-3 binding assay.
Type III collagen (6 µg/mL, Southern Biotechnology Associates,
Birmingham, AL), vWF MoAb AvW-1 (5 µg/mL), or MoAb AvW-3 (5 µg/mL),
a vWF MoAb that binds vWF and inhibits its interaction with
GPIb,27,29 in a carbonate buffer was plated on microtiter wells (50 µL/well) at 4°C overnight. After blocking (0.05%
Tween-20 in Tris-saline, 2 to 3 hours, 22°C) and washing, 50 µL
of conditioned medium from transfected COS-7 cells, diluted to
approximate concentrations of both 100 ng/mL and 50 ng/mL of
recombinant vWF in blocking buffer, was added to wells in triplicate
and incubated at 22°C for 60 minutes. After washing the wells,
bound recombinant vWF was detected by ELISA using rabbit anti-vWF
polyclonal Ab followed by horseradish peroxidase-conjugated goat
antirabbit IgG (Pierce). Immune complexes were detected using
o-phenylenediamine (Zymed, San Francisco, CA). Bound vWF was
quantitated by comparing the resultant optical density (above
background) with a standard curve of pooled normal plasma vWF binding
that was performed in parallel in each of these studies. The amount of
vWF added to the wells was quantitated by binding to AvW-1-coated
wells in parallel experiments. The amount of recombinant vWF bound to
collagen or AvW-3 was expressed as a ratio of the amount of vWF bound
to collagen or AvW-3 divided by the amount of vWF added to the well.
vWF A1 domain molecular model.
The coordinates for the A domains of integrins Description of two family pedigrees.
Figure 1 shows the pedigrees of Family A
and Family B (Figs 1A and, B). Members from three generations of each
family were available for study. The index case in Family A (AIII-1)
presented in childhood with a lifelong history of increased bruising
and moderately severe epistaxis; she required 1-desamino-8-D-arginine vasopressin (DDAVP) or vWF replacement therapy on multiple
occasions. She also experienced bleeding 2 days posttonsillectomy
despite perioperative vWF replacement therapy. The other affected
members of Family A (AI-1 and AII-1) have an extensive history of
increased bruising. The index case in Family B (BIII-2) presented in
infancy with a history of prolonged bleeding from the umbilical cord
stump; he subsequently developed increased bruising and frequent severe epistaxis. The epistaxis frequently requires DDAVP, vWF replacement therapy and/or cautery; he has been placed on prophylactic
replacement therapy to control his bleeding on several occasions. The
other affected individuals of Family B (BII-1 and BIII-1) have lifelong histories of increased bruising and moderately severe epistaxis during
childhood; the bleeding symptoms of BII-1 have improved as an adult.
Multimeric analysis of their vWF shows a normal distribution pattern of
multimers in affected members of both families (Fig 1C and D).
Identification of unique missense mutations in the vWF A1 binding
domain for both families.
The site of vWF interaction with platelet GPIb receptor has been
localized to the A1 domain of the mature vWF
glycoprotein37-39 that is encoded by exon 28 of the vWF
gene.8 Therefore, vWF exon 28 was amplified by PCR from
genomic DNA from two patients in each family and subcloned into
plasmids for DNA sequencing. In Family A, a single T
Detection of vWF missense mutation in affected family members by
restriction digestion of PCR products.
A Bcl I restriction site unique to the mutation in Family A was
created using additional base changes in a PCR primer. Figure 3C
illustrates the selective cutting of PCR products by Bcl I only
in the affected Family A members, AIII-1 and AII-1, but not in a normal
individual. Both Family A members were heterozygous for the full-length
(336 bp) and cut (302 bp) PCR products after Bcl I digestion,
showing that the affected individual had both normal and mutant
alleles. In Family B, the new mutation 4273A Expression and structural characterization of recombinant mutant
F606I and I662F vWF.
To determine the effect of the missense mutation on vWF structure and
function, restriction fragments containing the 4105T
Ristocetin- and botrocetin-induced binding of recombinant mutant vWF
to platelets.
To test the functional characteristics of the missense mutations,
platelet binding assays were performed with the recombinant mutant and
wt vWF expressed by the transfected COS-7 cells.19,26 The
binding of vWF to platelets was quantitated by a radiolabeled, noninhibitory, vWF MoAb AvW-1 that bound to vWF and was cosedimented with platelets through platelet-associated vWF. As shown in
Fig 5, normal plasma vWF and wt recombinant
vWF bound to fixed platelets in the presence of ristocetin (1.2 mg/mL)
to similar levels. No appreciable binding of AvW-1 to platelets was
seen when conditioned media from mock transfected cells was used. In
the presence of ristocetin, expressed recombinant F606I and I662F vWF
had decreased binding to platelets compared with wt recombinant vWF and
normal plasma vWF. However, both mutant proteins showed normal levels of botrocetin-induced binding to platelets. This is in contrast to
another recently described type 2M variant caused by an in-frame deletion within the A1 domain (
Binding of recombinant vWF to collagen.
While the A3 domain of vWF is the putative major binding site for
collagen,41 the A1 domain of vWF may also contribute to vWF
interactions with collagen.42 Recombinant F606I and I662F vWF both bound to collagen under static conditions to levels similar to
wt vWF (Fig 6A). In contrast, the type
2MMilwaukee-1 variant,
Binding of recombinant vWF to AvW-3.
Because vWF MoAb AvW-3 inhibits the binding of vWF to
GPIb,27,29 the binding of this MoAb to wt, F606I, I662F,
and Two lines of evidence support the conclusion that the vWF missense
mutations F606I in Family A and I662F in Family B are responsible for
the functional characteristics of the type 2M vWD. First, both missense
mutations and the low vWF:RCo/vWF:Ag ratio are coinherited in an
autosomal dominant manner through two or three generations of the
affected families. Second, similar to patient plasma vWF, recombinant
vWF containing each missense mutation is deficient in
ristocetin-mediated vWF binding to platelets, yet retains normal multimer structure, botrocetin-mediated platelet binding, collagen binding, and AvW-3 binding. We speculate that the more severe ristocetin-mediated binding defect observed for mutant recombinant vWF
compared with the same patient's plasma vWF is due to expression of
only the defective vWF in transfected cells versus heterozygous expression of mutant and normal vWF in the plasma of the affected patients. Interestingly, the missense mutation in Family A (4105T
Submitted July 7, 1997;
accepted October 17, 1997.
The authors thank Drs Robert C. Liddington (University of Leicester)
and Daniel J. Leahy (Johns Hopkins University) for providing coordinates of Mac-1 and LFA-1, respectively. We also thank Elizabeth A. Vokac, Naomi Blankenburg, Ming C. Du, and Todd Schroeder for assistance with the platelet- and collagen-binding studies, Thomas J. Barbour and Xio Liu for technical assistance with recombinant studies,
and Amy Frey for assistance with the multimer analysis. In addition, we
would like to thank Janet L. Endres for expert technical advice and
Philip A. Kroner for critical review of the manuscript.
1. Montgomery RR, Coller BS: von Willebrand Disease, in Colman RW,
Hirsh J, Marder VJ, Salzman EW (eds): Hemostasis and Thrombosis: Basic
Principles and Clinical Practice. Philadelphia, PA, Lippincott,
1994, p 134
2.
Mayadas TN,
Wagner DD:
von Willebrand factor biosynthesis and processing.
Ann N Y Acad Sci
614:153,
1991[Medline]
[Order article via Infotrieve]
3.
Santoro SA:
Adsorption of von Willebrand factor/factor VIII by the genetically distinct interstitial collagens.
Thromb Res
21:689,
1981[Medline]
[Order article via Infotrieve]
4.
Weiss HJ:
von Willebrand factor and platelet function.
Ann N Y Acad Sci
614:125,
1991[Medline]
[Order article via Infotrieve]
5.
Ruggeri ZM,
De Marco L,
Gatti L,
Bader R,
Montgomery RR:
Platelets have more than one binding site for von Willebrand factor.
J Clin Invest
72:1,
1983
6.
Nachman RL,
Jaffe EA,
Weksler BB:
Immunoinhibition of ristocetin-induced platelet aggregation.
J Clin Invest
59:143,
1977
7.
Fujimura Y,
Holland LZ,
Ruggeri ZM,
Zimmerman TS:
The von Willebrand factor domain-mediating botrocetin-induced binding to glycoprotein IB lies between Val449 and Lys728.
Blood
70:985,
1987
8.
Fujimura Y,
Titani K,
Holland LZ,
Russell SR,
Roberts JR,
Elder JH,
Ruggeri ZM,
Zimmerman TS:
von Willebrand factor. A reduced and alkylated 52/48-kDa fragment beginning at amino acid residue 449 contains the domain interacting with platelet glycoprotein Ib.
J Biol Chem
261:381,
1986
9.
Andrews RK,
Gorman JJ,
Booth WJ,
Corino GL,
Castaldi PA,
Berndt MC:
Cross-linking of a monomeric 39/34-kDa dispase fragment of von Willebrand factor (Leu-480/Val-481-Gly-718) to the N-terminal region of the alpha-chain of membrane glycoprotein Ib on intact platelets with bis(sulfosuccinimidyl) suberate.
Biochemistry
28:8326,
1989[Medline]
[Order article via Infotrieve]
10.
Marti T,
Rosselet SJ,
Titani K,
Walsh KA:
Identification of disulfide-bridged substructures within human von Willebrand factor.
Biochemistry
26:8099,
1987[Medline]
[Order article via Infotrieve]
11.
Sadler JE:
A revised classification of von Willebrand disease. For the Subcommittee on von Willebrand Factor of the Scientific and Standardization Committee of the International Society on Thrombosis and Haemostasis.
Thromb Haemost
71:520,
1994[Medline]
[Order article via Infotrieve]
12.
Ruggeri ZM:
Structure and function of von Willebrand factor: Relationship to von Willebrand's disease.
Mayo Clin Proc
66:847,
1991[Medline]
[Order article via Infotrieve]
13. Mancuso DJ, Kroner PA, Christopherson PA, Vokac EA, Gill JC,
Montgomery RR, Gill, JC: Type 2M:Milwaukee-1 von Willebrand disease: An
in-frame deletion in the Cys509-Cys695 loop of the von Willebrand
factor A1 domain causes deficient binding of von Willebrand factor to
platelets. Blood 88:2559, 1996
14.
Rabinowitz I,
Tuley EA,
Mancuso DJ,
Randi AM,
Firkin BG,
Howard MA,
Sadler JE:
von Willebrand disease type B: A missense mutation selectively abolishes ristocetin-induced von Willebrand factor binding to platelet glycoprot |
Abstract
Introduction
A resulted in a Phe606Ile amino acid substitution (F606I)
and in Family B, a missense mutation at nucleotide 4273A 
Abstract
R629-Q639) in
the large disulfide loop of the A1 domain of vWF. The only other type
2M variant to have been described and confirmed by recombinant
expression of mutant vWF is subtype B vWD that is due to the missense
mutation Gly561Ser (G561S).
80°C. vWF:Ag levels in
conditioned media were assayed by antigen-capture enzyme-linked
immunosorbent assay (ELISA) using monoclonal antibody (MoAb)
AvW-124 and detected by anti-vWF rabbit polyclonal Ab
followed by biotin-conjugated goat antirabbit IgG (Pierce, Rockford,
IL). Immune complexes were detected using avidin-horseradish
peroxidase, and o-phenylenediamine substrate
(Sigma, St Louis, MO).
M
(Mac-1)
), type
2MMilwaukee-1 vWD (
629-639, 
), affected
(
) or unaffected (
) members of Family A and affected (
) or
unaffected (
-sheet with a short sixth
antiparallel strand on one edge. This core is surrounded by amphipathic
