|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 91 No. 5 (March 1), 1998:
pp. 1749-1756
Genetic Polymorphism in MDR-1: A Tool for Examining
Allelic Expression in Normal Cells, Unselected and Drug-Selected
Cell Lines, and Human Tumors
By
Lyn A. Mickley,
Jong-Seok Lee,
Zheng Weng,
Zhirong Zhan,
Manuel Alvarez,
Wyndham Wilson,
Susan E. Bates, and
Tito Fojo
From the Medicine Branch, Division of Clinical Sciences
(DCS), National Cancer Institute (NCI), Bethesda, MD; and
the Department of Internal Medicine, Gyeongsang National University,
Chinju, Kyungnam, South Korea.
 |
ABSTRACT |
By using RNase protection analysis, residues 2677 and 2995 of
MDR-1 were identified as sites of genetic polymorphism. Through use of oligonucleotide hybridization, the genomic content and expression of individual MDR-1 alleles were examined in normal tissues, unselected and drug selected cell lines, and malignant lymphomas. In normal tissues, unselected cell lines, and untreated malignant lymphoma samples, expression of MDR-1 from both
alleles was similar. In contrast, in drug selected cell lines, and in relapsed malignant lymphoma samples, expression of one allele was found
in a large percentage of samples. To understand how expression of one
allele occurs, two multidrug resistant sublines were isolated by
exposing a Burkitt lymphoma cell line to increasing concentrations of
vincristine. The resistant sublines expressed only one allele and had a
hybrid MDR-1 gene composed of non-MDR-1 sequences
proximal to MDR-1. Previous studies showing hybrid
MDR-1 genes after rearrangements provided a potential
explanation for activation and expression of one MDR-1 allele.
We conclude that oligonucleotide hybridization can be used as a
sensitive tool to examine relative allelic expression of MDR-1,
and can identify abnormal expression from a single allele. Acquired
drug resistance in vitro and in patients is often associated with
expression of a single MDR-1 allele, and this can be a marker
of a hybrid MDR-1 gene.
| |
INTRODUCTION |
ALTHOUGH MULTIDRUG resistance mediated by
MDR-1/P-glycoprotein was initially identified in vitro in
models of acquired resistance, subsequent studies have shown expression
of this protein in both unselected cell lines and in normal
tissues.1,2 In vitro, models of acquired resistance express
increasing levels of MDR-1 with advancing drug pressure, and
this has been shown to occur without or with gene
amplification.3 Although extensively characterized as a
mechanism of drug resistance, very little is known about the regulation
of MDR-1 expression.
Coexpression of alleles forms the basis of Mendelian genetics, but with
the exception of selected genes which have been shown to be imprinted,
surprisingly little has been done to examine the regulation of
expression of individual alleles in normal tissues or human
cancers.4,5 Although the advent of polymerase chain reaction (PCR) technology has offered this possibility, most studies have been confined to analysis of genetic polymorphism at the DNA
level, with rare attempts to determine allele-specific
expression.6-9
The expression of genetic polymorphism in the MDR-1 gene
afforded an opportunity to examine allelic expression in normal tissues and unselected cell lines, providing a basis for comparison with expression after drug treatment in vitro or in the clinic. The present
report describes the results of these studies.
| |
MATERIALS AND METHODS |
Tissue culture, cell lines, and normal tissues.
Cells obtained from American Type Culture Collection were grown in RPMI
supplemented with 10% fetal bovine serum, 2 mmol/L glutamine, and 100 U/mL Pen/Strep. Individual clones were obtained by limiting dilution at
1 cell/10 wells in 96-well plates.
Both unselected and drug selected cell lines were used. Unselected cell
lines, maintained as described above, included (1) breast:
MCF-710; (2) epidermoid: KB 3-111; (3)
neuroblastoma: SH-SY5Y and LA-N-112; (4) hepatoma:
HepG213; (5) renal cell: A498, CAKI-1, RXF 393L, and RXF
631L14; (6) colon: HCT-1116, SW620, DLD-1, LS180, and
HCT-1514,15; and (7) malignant lymphoma:
EW-36.16 Drug selected cell lines included (1) colon: SW620
Vb300, SW20, Ad1000, LS180 Vb20, LS180 Ad50, DLD-1 Vb300, and DLD-1
Ad100017,18; (2) epidermoid: KB 8-5, KB C-1, KB V-1, and KB
A-111; (3) ovarian: 2780 Ad19; and (4) breast:
MCF-7 AdrR.20 Normal tissues were obtained from surgical or
autopsy specimens. Normal circulating cells were obtained by
venipuncture; tumor samples were obtained surgically or by needle
aspiration from patients with newly diagnosed lymphoma, or from
patients with relapsed lymphoma enrolled on a salvage protocol termed
EPOCH(etoposide, predisone, oncovin, cytoxan, hydroxy
daunorubicin).21
RNase protection assay.
MDR-1 fragments used to synthesize probes in the RNase
protection assay were isolated by restriction enzyme digests of the KB
C-1 cDNA and subcloned in pGEM-3Z. The hybrid fragment consisting of
non-MDR-1 sequences fused to MDR-1 was obtained by PCR
amplification using primers A5 and B3 described in the Fig 8 legend
and was subcloned in pCR II (Invitrogen, Carlsbad, CA).
Total RNA was hybridized with 2 × 105 cpm of antisense
RNA probes synthesized using a modification of the method of Melton et
al.22 RNase protection analysis was performed on these
hybrids as described.23
View larger version (50K):
[in this window]
[in a new window]
| Fig 8.
Expression of MDR-1 and novel 252 bp in cell
lines and normal tissues. (A) Northern analysis analyzing expression of
MDR-1 in parental Burkitt cells (EW 36) and two mulridrug
resistant sublines (VCR.25 and VCR60). (B) Oligonucleotide
hybridization of EW 36 and two resistant sublines (VCR.25 and VCR60).
DNA blot shows the presence of two alleles in parental EW 36 cells.
Amplification of the G allele occurs with vincristine selection. EW 36 cells do not express MDR-1 but selection in vincristine induces
expression of the G allele. (C) RNase protection using a 319-bp hybrid
MDR-1 probe described in panel E. EW 36 and VCR60 cells protect
a 252-bp band representing the non-MDR-1 sequences. In
addition, VCR60 cells protect the full-length hybrid probe composed of
non-MDR-1 and MDR-1 sequences. (D) PCR examining the
expression in normal tissues and unselected cell lines, of the novel
252-bp sequences and a hybrid composed of the 3 162.bp of the novel
sequence and 67 bp of MDR-1. The primers used for PCR are
underlined in panel E. The novel 252 bp are constitutively expressed in
all cells. In contrast, a hybrid MDR-1 product is detected only
in the vincristine selected EW 36 cells. (E) Sequence of hybrid probe
used in panel C. The 252 bp of novel non-MDR-1 sequence are
represented in upper case, whereas the MDR-1 sequences are
shown in lower case.
|
|
Oligonucleotide hybridization.
Both DNA and RNA were used as templates in the PCR. Primers used in the
PCR reaction are as follows: 5,2521GCAAATCTTGGGACAGGAAT;
3 RNA,2796CTCCTTTCGTGTGTAGAAAC; 3
DNA,2681CCTTC2687cactcagtttgattt. To evaluate
RNA expression, reverse transcription preceded amplification; otherwise
the technical aspects were identical. All amplifications included
controls without DNA or RNA. After amplification of 1 µg of template,
30% of the PCR product was loaded in each of two adjacent wells of a
slot-blot apparatus. The nitrocellulose filter was cut into two halves
and each half was hybridized with a different oligonucleotide. Four
19-bp allele-specific oligonucleotide probes (HMO5, HMO6, HMO7, and
HMO8) were 5-phosphorylated with  32P-ATP and
T4 polynucleotide kinase. HMO5 and HMO6 cover residues 2669 to 2687 and were used for RNA hybridizations. HMO7 and HMO8 cover
residues 2667 to 2685 and were used for DNA hybridizations. HMO5 and
HMO7 possess a G at position 2677 and HMO6 and HMO8 contain a T at this
position. Hybridizations and washes were performed as described by
Mullis et al.24
For quantitation of the oligonucleotide hybridizations, internal
controls were included in all experiments. This was accomplished by
using synthetic oligonucleotides as controls. Two 30-bp
oligonucleotides, designated HMC3 and HMC4, were used. These
oligonucleotides cover residues 2656 to 2685 of the MDR-1 gene,
with HMC3 possessing a G at position 2677 and HMC4 a T at this
position. Equal amounts of each control were slotted on both sides of
the filter, thus providing a means of quantitation and an indicator of
specificity. Because the hybridizations were performed under identical
conditions, with probes labeled to similar specific activities, the
signals from the control oligonucleotides were usually similar. Where differences were observed, different exposures with similar intensities of the control slots were obtained to allow direct comparisons. This
approach compensated for differences in hybridization conditions.
PCR.
One microgram of genomic DNA was used as template in PCR for 40 cycles
to detect genetic polymorphism at the DNA level. To detect allelic
expression, 1 µg of RNA was reverse transcribed and cDNA template was
subjected to 35 cycles of PCR. The primers used for DNA and RNA
oligonucleotide hybridizations are described above. Primers used to
detect the expression of the novel non-MDR-1 sequences and the
hybrid composed of non-MDR-1 sequences fused to MDR-1
in Fig 8 are as follows: A5, CCTCGCTCTGGCCCTGCA; A3, CTGGGGCAGAAGGCAGC; B5, CGCCTTCAGGTCTTGGCGCA; B3, ATTCCTCGAGAAACTCGA.
5 RACE.
The 5 RACE system (Life Technologies, Gaithersburg, MD)
was used to isolate the 5 residues of the novel MDR-1 hybrid
gene in the EW 36 VCR60 cell line. mRNA was reverse transcribed using a
3 MDR-1 gene specific primer
GSP-1: 8GGCTTCCTGTGGCAAAGAG26. The
dC-tailed cDNA was amplified by PCR using the 5 Anchor Primer provided
in the 5 RACE kit (Life Technologies) and a second internal 3
MDR-1 gene specific primer, designated B3 and described in PCR
methods.25 Direct sequencing of the PCR product was
performed using Sequenase (Amersham Life Sciences, Arlington Heights,
IL).26
Northern analysis.
From the EW 36 cell line and its two vincristine resistant sublines
(VCR.25 and VCR60), 10µg of total RNA were electrophoresed in a 1%
agarose/6% formamide gel. The gel was transferred onto nitrocellulose
and hybridized with the MDR-1 specific probe, 5A.27
| |
RESULTS |
Identification of genetic polymorphism in the MDR-1 gene.
As part of a study examining the frequency and nature of point
mutations, overlapping fragments representing the entire MDR-1 coding sequence were isolated from a full-length KB C-1 cDNA, and
subcloned in pGEM-3Z vectors. These fragments were used to generate
probes which allowed examination of the complete coding sequence. Two
fragments identified mismatches representing transcripts from different
alleles. Figure 1 presents the results
using the 791-bp Hae III fragment which covers residues 2166 to
2957 to screen a panel of 24 samples including normal tissues,
unselected cell lines, and drug selected cell lines. Protection of only
full-length probe was found in 11 of 24 samples, indicating that in
these samples the sequence of all transcripts was complementary to the probe and hence identical to that of the KB C-1 cDNA from which the
probe was derived (SH-SY5Y, HTB46, HTB44, HepG2, SW620 Vb300, DLD-1
Ad1000, KB 8-5, KB C-1, KB V-1, KB A-1, 2780 Ad). In 12 samples (shown
in bold), protection of full-length probe as well as two additional
fragments was observed, representing transcripts from two different
alleles (Adrenal, LA-N-1, Kidney, Liver, HCT-15, SW620, SW620 Ad1000,
LS180, LS180 Vb20, LS180 Ad50, DLD-1, and DLD-1 Vb300; smaller size
fragments poorly visualized in this figure for HCT-15, LS 180, LS 180 Ad50, and DLD-1). The additional two fragments resulted from a single
base pair mismatch at position 2677, a difference previously reported
as a G to T change which results in an amino acid change from Ala to
Ser.28,29 Samples expressing both messages have three bands
which represent either full protection of the probe (791 bp) or the
fragments arising as a result of the single base pair mismatch (511 bp
and 280 bp). No signal was detected in KB 3-1.
View larger version (57K):
[in this window]
[in a new window]
| Fig 1.
RNase protection analysis with the 791-bp Hae III
probe (residues 2166 to 2957). RNA from 11 of 24 samples protects a
full-length fragment, indicating that 791 bp of sequence identify with
KB C-1 from which the probe was derived. RNA from 12 of 13 remaining samples (bold) protects both full-length probe and two additional fragments of 511 bp and 280 bp as a result of a mismatch at position 2677 (includes HCT-15, LS180, LS180 Ad50, DLD-1, and DLD-1 Vb300 not
well visualized here). Vb, vinblastine; Ad, adriamycin.
|
|
Similar observations were made with the 656-bp Nde/Nci probe which
covers residues 2751 to 3407, as shown in Fig
2. With this probe, 19 of the 23 samples
showed only full-length protection of the probe representing identity
of sequence to the KB C-1 cDNA from which the probe was obtained. No
signal was detected in KB 3-1. Four other samples (designated in bold
type) showed two additional bands representing fragments protected by
transcripts arising from a different allele. These samples were HCT-15,
DLD-1 Vb300, DLD-1 Ad1000, and DLD-1; results not shown for parental
DLD-1 cells. These samples protect fragments of 412 and 244 bp in
length which result from a single base pair mismatch at position 2995. Sequence analysis of a PCR-amplified fragment showed a G to A substitution at this site. (GCC to ACC; Ala to
Thr). In the screen, only these two sites of genetic polymorphism were
identified, indicating that the coding sequence of the MDR-1
gene exhibits a high degree of conservation. Most unselected cell lines
and normal tissues had no mismatches, or one mismatch, and only two (DLD-1 and HCT-15) had two.
View larger version (56K):
[in this window]
[in a new window]
| Fig 2.
RNase protection analysis with the 656-bp Nde/Nci probe
(residues 2751 to 3407). RNA from 19 of 23 samples protects a
full-length fragment, indicating 656 bp of sequence homology with the
KB C-1 cDNA from which this probe was derived. RNA from three samples (bold) protects two additional fragments of 412 bp and 244 bp in length
as a result of a mismatch at 2995 (similar results in DLD-1, RNA not
shown). Vb, vinblastine; Ad, adriamycin.
|
|
Frequency of genetic polymorphism and relative expression in normal
tissues and in unselected cell lines.
Having identified the sites of genetic polymorphism, and for residue
2995, having deduced the nucleotide sequence, we sought to answer two
additional questions: (1) the frequency of genetic polymorphism, and
(2) the relative expression of alleles, with emphasis on whether the
relative expression from individual alleles in normal tissues,
unselected and drug selected lines, and patient samples differed.
We recognized that expression from individual alleles could differ, and
that a genetically heterozygous cell could appear at the RNA level to
be homozygous. Thus, we chose oligonucleotide hybridization, as our
method of screening, having previously established that this method
could be accurately used to quantitate relative levels of expression,
provided that appropriate controls were used (L.A.M., unpublished
observations). The analyses were performed by carrying out
PCR for 30 cycles. For many samples this meant that plateau had been
reached, and thus the results do not provide an accurate representation
of the absolute levels of MDR-1 expression, precluding a
comparison of absolute levels among samples. This was not the intent of
this analysis. However, the analysis does provide a reliable measure of
the relative levels of expression (or for DNA, the relative number of
copies) of each allele in a given sample. Representative results are
shown in Figs 3 and 4. For each
sample, the relative amounts of genomic copies and the relative levels
of RNA expression are depicted on the left and right, respectively. It
was expected that heterozygous normal tissues would have equal amounts
of each allele in genomic DNA and equal allelic expression. However,
the frequent occurrence of aneuploidy in human tumor cell lines raised
the possibility that differences in the number of copies of each allele
could result in differences in the relative levels of expression. Thus, relative levels of expression were determined by dividing the relative
values obtained in analyzing RNA expression by the relative levels of
each allele in genomic DNA. These are presented numerically in the
middle column of both figures. In the normal tissues shown in Fig 3,
comparable levels of genomic copies and allelic expression were
observed. Likewise, in the unselected cell lines shown in Fig 4, the
relative levels of expression also approached unity (similar results
were observed in a larger set of samples described below, data not
shown). These results thus established equal expression from individual
alleles as the norm and allowed us to expand our sample size for
determining the frequency of polymorphism by using a large number of
previously isolated RNAs from unselected cell lines and normal tissues.
Thus, when polymorphism at residue 2677 was examined in an additional
26 unselected cell lines previously identified as expressing Pgp, 15 were found to be heterozygous, with the rest homozygous for either
allele (8 for G and 3 for T at position 2677). A similar analysis
performed with RNA from 42 normal tissues expressing
MDR-1/P-glycoprotein found 13 heterozygous samples and 29 homozygous (21 for G and 8 for T at position 2677). Combining the
normal tissues and unselected cell lines in the initial screen (Fig 1)
with the findings in the additional 26 cell lines and 42 normal
tissues, the following results were obtained in 83 samples: 36 (43%)
heterozygous; 35 (42%) homozygous for G, and 12 (15%) homozygous for
T at position 2677.
View larger version (46K):
[in this window]
[in a new window]
| Fig 3.
Normal tissues: Oligonucleotide hybridization of
PCR-amplified DNA and RNA is shown on the left and right of the figure,
respectively. The results were quantified by dividing the ratio of RNA
expression by the ratio of genomic copies in DNA. A ratio of 1 indicates that both alleles are expressed at comparable levels. HMC-3
and HMC-4 are control oligonucleotides having a G and a T at position 2677. Samples 1 through 6, normal adrenal gland; 7, normal kidney; 8 and 9, normal lung; 10 and 11, normal colon.
|
|
View larger version (53K):
[in this window]
[in a new window]
| Fig 4.
Unselected human cancer cell lines: Oligonucleotide
hybridization of PCR-amplified DNA and RNA from unselected human cancer cell lines is shown on the left and right of the figure, respectively. The results are quantified as in Fig 3. Cell lines homozygous for one
allele show expression of this allele exclusively. Most heterozygous
cell lines have relative levels of expression approaching unity. KB 3-1 and MCF-7 express no MDR-1. HMC-3 and HMC-4 are control
oligonucleotides slotted as internal controls as described in Fig 3.
|
|
When similar studies were performed to evaluate the frequency of
genetic polymorphism at position 2995, different results were obtained.
At this site, 4 (11%) samples were heterozygous, whereas the remaining
32 (89%) were homozygous for G. Because of the low frequency of
heterozygous samples at this site, subsequent studies examining genetic
polymorphism principally examined heterozygosity at position 2677.
Allelic expression in drug selected cell lines and in circulating
cells and tumor samples from patients with relapsed lymphoma.
Having established equal expression from individual alleles as the
norm, we examined relative allelic expression in drug selected cell
lines. In a number of cell lines isolated after exposure to increasing
concentrations of adriamycin, vinblastine, or vincristine, preferential
overexpression of a single allele was observed (Fig 8 and data not
shown). Although in many cases gene amplification had occurred and
preferential expression of a single allele (the amplified allele) would
be expected, similar results were observed in cell lines without gene
amplification (Fig 8 and data not shown). Because expression of both
alleles had been established as the norm for normal tissues and
unselected cell lines, overexpression of a single allele was identified
as an acquired phenotype.
When we examined samples obtained from patients with refractory
lymphoma, observations similar to those in the selected cell lines were
made. Figure 5 shows the results in tumor
samples obtained from patients with refractory lymphoma before
enrollment on a salvage therapy regimen termed EPOCH.21 The
figure contains predominant samples whose genomic analysis showed a
heterozygous pattern. As can be seen, a large percentage of such
patient samples express only one allele, in the same way that the drug
selected cell lines expressed one allele. In all, we examined 60 specimens, and found 34 to be homozygous at position 2677 and
consequently not helpful in determining allelic expression. However, 26 patients were genetically heterozygous, and 8 (30%) of these were
shown to express one allele exclusively or predominantly. That this pattern of expression is not a consequence of prior drug exposure of
any cell is supported by the results in Fig
6, which shows allelic expression in the
circulating mononuclear cells of four patients who were genetically
heterozygous. These normal cells express both alleles at comparable
levels, as had been previously shown for normal tissues (similar
results were observed in two other patient samples). In addition, in
five tumor samples obtained from patients at the time of presentation
(before any therapy), disproportionate expression of alleles was not
observed (not shown). Further evidence that the expression of a single
allele is an acquired phenotype during the course of drug therapy and
the development of drug resistance is shown in Fig 7.
This composite shows the relative expression of individual alleles in
serial samples obtained from a patient treated over several years with
six different chemotherapy regimens, all of which contained
"MDR-1 drugs." Initial samples show a normal pattern of
expression of both alleles, but over time, this pattern evolves to that
seen in drug resistant cell lines, predominant expression of a single
allele, coincident with the increases in the levels of MDR-1.
Note that the MDR-1 expression increased nearly 24-fold during
this period (0.5 to 11.7) and that the relative expression which was
close to unity at the outset increased to 17.7 in the last sample, even
as the relative genomic levels remained unchanged.
View larger version (27K):
[in this window]
[in a new window]
| Fig 5.
Expression of individual alleles in tumor samples
obtained from patients with refractory lymphoma.
|
|
View larger version (64K):
[in this window]
[in a new window]
| Fig 6.
Expression of individual alleles in circulating
mononuclear cells obtained from patients with refractory lymphoma.
|
|
View larger version (18K):
[in this window]
[in a new window]
| Fig 7.
Expression of individual alleles in a patient with
refractory lymphoma over time. The MDR-1 level determined by
quantitative PCR as well the percent of normal and malignant cells in
the biopsies are tabulated. Over time, the patient was treated with
multiple regimens, all of which contained "MDR-1 drugs."
|
|
We have previously identified gene rearrangement as a mechanism of
activation of MDR-1 expression.26 We considered
this a possible mechanism for expression of a single allele, because rearrangements are rare events and would not be expected to occur twice
in one cell activating both alleles. Because we had only minimal
amounts of sample from the patients, precluding in-depth molecular
studies, we isolated two multidrug resistant sublines from a Burkitt
lymphoma cell line (EW 36)16 by exposing cells to
increasing concentrations of vincristine. As shown in Fig
8A, compared with parental cells, the resistant sublines
have elevated levels of MDR-1 as detected by Northern analysis
using an MDR-1 probe. Furthermore, when expression was examined
by oligonucleotide hybridization as shown in Fig 8B, the parental cell
line was shown to be heterozygous, without detectable RNA expression.
However, with drug selection, overexpression of a single allele (G
allele) was observed, with evidence in the VCR60 subline of gene
amplification as evidenced by the greater intensity of the G signal
compared with the T in the DNA blot. Using the 5 RACE methodology, 252 bp of novel sequence not found in GenBank were identified proximal to
the MDR-1 gene, in agreement with previous observations showing that gene rearrangements lead to the generation of hybrid genes composed of non-MDR-1 sequences fused to MDR-1
proximal to residue  194 (Fig 8E).16 Somatic Cell Hybrid
analysis localized these sequences to chromosome 7 (data not shown). A
hybrid product composed of the novel 252 bp and the first 67 bp of
MDR-1 was isolated, cloned, and used in an RNase protection
assay. As shown in Fig 8C, in RNA from the parental cell line,
expression of the hybrid product cannot be detected, although the 252 bp of novel sequence are protected, suggesting these are constitutively
expressed in the parental cells. In contrast, in RNA from the resistant
subline, full-length protection of the 319-bp hybrid product was
observed consistent with expression of this hybrid MDR-1 gene
in the resistant cell line. Protection of the 252 bp corresponding to
the novel sequences continues to be observed in RNA from the resistant
subline, an observation that would be consistent with continued
expression of these sequences from another allele that was not involved
in the rearrangement with MDR-1. These observations are
extended in Fig 8D, which shows expression of the 252 bp of novel
sequence using the PCR in all cell lines and normal tissues examined.
In contrast, a hybrid product of 229 bp composed of a portion of the
252 bp of novel sequence and MDR-1 was only detected in the resistant subline, and not in the other samples, which include numerous cell lines and normal tissues which express MDR-1
endogenously.
| |
DISCUSSION |
With the exception of the X chromosome, which in men is present in
single copy and in women is rendered single copy by the random
inactivation of one of the two X chromosomes in each cell, all other
chromosomes and the genes therein are present in duplicate in most
normal cells. Classical Mendelian genetics is predicated on the
expression of each of these two alleles, be they dominant or recessive.
Hybrid physical features have long been recognized as evidence of this
coexpression, and studies of hemoglobinopathies have documented
expression of both normal and mutant proteins. However, with the
exception of a select group of genes which are imprinted during
development, surprisingly little has been reported about allele
expression at a molecular level.4-9 The expression of
genetic polymorphism in the MDR-1 gene provided a tool to
examine the expression of individual alleles. With the goal of
examining differential expression during the course of drug selection
both in vitro and in patients, we proceeded to characterize expression in normal tissues, unselected and drug selected cell lines, and human
tumors to determine the degree of coregulation and under what
conditions deviations from this may occur. Our results show that
normal tissues and unselected cell lines express both alleles. However,
disproportionate expression of one allele can occur during the course
of drug selection in vitro or in the clinic. Also, expression of a
single allele can be a manifestation of a hybrid gene product,
which previous studies have shown occur after gene rearrangements
leading to activation of MDR-1.26
The first step in this analysis involved the screening of a large
number of samples by RNase protection. These samples, including normal
tissues, unselected, and drug selected cell lines, were screened for
mutations using overlapping fragments encoding the entire MDR-1
sequence. Using this approach, the sequence of MDR-1 was shown
to be highly conserved, with mismatches representing allelic
polymorphism identified at only two sites nucleotide residues 2677 and
2995. The majority of unselected cell lines and normal tissues had no
or one mismatch, and only two (DLD-1 and HCT-15) had two.
To determine expression from individual alleles in a large number of
samples, we used the technique of oligonucleotide hybridization. Recognizing the frequency with which aneuploidy occurs in tumors, we
corrected all ratios of RNA expression by dividing by the ratio of
alleles in genomic DNA. We sought first to examine normal tissues expressing MDR-1. Tissues which were heterozygous were found to have similar genomic levels of each allele, and these were similarly expressed. Although this observation was in part anticipated, it
established coexpression at similar levels as the norm, and any
significant deviation from this as an acquired change. Similar analyses
in unselected cell lines found comparable levels of expression in all
cell lines with only a single exception, suggesting that in malignant
cells, expression continues to be under normal regulatory controls. The
identification of genetic polymorphism also allowed the investigation
of the control of expression after the addition of agents known to
induce MDR-1 expression, including sodium butyrate, cycloheximide, and calcium channel blockers.23,30 Treatment of parental LS 180, DLD-1, and HCT-15 cells with these agents resulted in a comparable increase in expression of both alleles, suggesting that both alleles are under similar regulatory
controls (data not shown).
In contrast, in drug selected cell lines and in patient samples
obtained from previously treated patients, overexpression of a single
allele occurs frequently. Because this was observed in vitro in cell
lines with acquired resistance, it suggests that a large percentage of
our samples obtained from patients with refractory lymphoma have
acquired overexpression of MDR-1 during the course of therapy.
How this might occur is shown by the results in the resistant sublines
derived from the malignant Burkitt lymphoma cell line. A hybrid message
composed of non-MDR-1 sequences fused proximal to
MDR-1 at residue 194 was identified. Similar observations have been previously shown to occur after gene rearrangement
(unpublished results and Mickley et al26).
Increased expression of MDR-1 after a chromosomal rearrangement
should lead to activation of a single allele, an observation we have
previously made in a number of drug selected cell lines and in a few
leukemia samples (Mickley et al26 and unpublished
observations). Alternately, mutations in a regulatory
element or changes in methylation patterns could lead to overexpression
of a single allele.
The results observed in the patient samples obtained from previously
treated refractory patients suggest that clonal selections occur during
the course of therapy. The most likely explanation for expression of
one allele is that all cells are the offspring of a single cell which
acquired a "one allele phenotype." It would be highly unlikely
that this occurred for the same allele in millions of individual cells.
We have made similar observations in cell culture. Furthermore, because
expression of a single allele is an acquired phenotype, the results in
these patient samples support the idea that MDR-1 played a role
in drug resistance in these tumors during the course of therapy.
Finally, although the patient samples shown in Fig 5 which express a
single allele are composed of samples which preferentially express the
WT allele, our results indicate that this is a random process.
Tabulation of results in numerous drug selected cell lines found an
equal likelihood of overexpression of either allele, suggesting that
neither has distinct advantage (data not shown).
In summary, the work described herein has documented a high degree of
conservation of the primary sequence of the MDR-1 gene. Identification of genetic polymorphism allowed us to examine expression from individual alleles. At a molecular level, expression of individual alleles has been shown to be similar in normal tissues and in unselected cell lines. Deviations from this pattern are likely to
represent an acquired change, as shown in drug resistant cell lines and
samples from patients with refractory lymphoma. A possible explanation
for this phenomenon is gene rearrangement with activation of
MDR-1 after juxtaposition of MDR-1 to a constitutively
transcribed gene. The sensitivity of the methodology described will
hopefully aid in understanding the mechanisms whereby gene activation
occurs during transformation, drug selection, and other disease states, both in vitro and in the clinic.
| |
FOOTNOTES |
Submitted July 23, 1997;
accepted October 28, 1997.
Address reprint requests to Tito Fojo, MD, PhD, Medicine Branch, DCS,
NCI, Bldg 10 Room 12N226, 9000 Rockville Pike, Bethesda, MD 20892.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. section 1784 solely to indicate this fact.
| |
REFERENCES |
1.
Fojo AT,
Ueda K,
Slamon DJ,
Poplack DG,
Gottesman MM,
Pastan I:
Expression of a multidrug resistance gene in human tumors and tissues.
Proc Natl Acad Sci USA
84:265,
1987[Abstract/Free Full Text]
2.
Fojo AT,
Shen D-W,
Mickley LA,
Pastan I,
Gottesman MM:
Intrinsic drug resistance in human kidney cancer is associated with expression of a human multidrug resistance gene.
J Clin Oncol
5:1922,
1987[Abstract/Free Full Text]
3.
Shen DW,
Fojo A,
Chin JE,
Roninson IB,
Richert N,
Pastan I,
Gottesman MM:
Human multidrug-resistant cell lines: Increased mdr-1 expression can precede gene amplification.
Science
232:643,
1986[Abstract/Free Full Text]
4.
Haig D,
Graham C:
Genomic imprinting and the strange case of the insulin-like growth factor II receptor.
Cell
64:1045,
1991[Medline]
[Order article via Infotrieve]
5.
Razin A,
Cedar H:
DNA methylation and genomic imprinting.
Cell
77:473,
1994[Medline]
[Order article via Infotrieve]
6.
Hobbs HH,
Russell DW,
Brown MS,
Goldstein JL:
The LDL receptor locus in familial hypercholesterolemia: Mutational analysis of a membrane protein.
Annu Rev Genet
24:133,
1990[Medline]
[Order article via Infotrieve]
7.
Top B,
Boorn NVD,
Zee AVD,
Havekes LM,
Frants RR:
Detection of allele-specific transcripts by the polymerase chain reaction (AST-PCR).
Biochem Biophys Res Commun
178:1319,
1991[Medline]
[Order article via Infotrieve]
8.
Schuster R:
Allele-specific and asymmetric polymerase chain reaction amplification in combination: A one step polymerase chain reaction protocol for rapid diagnosis of familial defective apolipoprotein B-100.
Anal Biochem
204:22,
1992[Medline]
[Order article via Infotrieve]
9.
Sommer R:
PCR amplification of specific alleles (PASA) is a general method for rapidly detecting known single-base changes.
Biotechniques
12:82,
1992[Medline]
[Order article via Infotrieve]
10.
Catterall WA:
Structure and function of voltage-sensitive ion channels.
Science
242:50,
1988[Abstract/Free Full Text]
11.
Shen DW,
Cardarelli C,
Hwang J,
Cornwell M,
Richert N,
Ishii S,
Pastan I,
Gottesman MM:
Multiple drug resistant human KB carcinoma cells independently selected for high-level resistance to colchicine, adriamycin, or vinblastine show changes in expression of specific proteins.
J Biol Chem
261:7762,
1986[Abstract/Free Full Text]
12.
Biedler JL,
Riehm H:
Cellular resistance to actinomycin D in Chinese hamster cells in vitro: Cross-resistance, radioautographic, and cytogenetic studies.
Cancer Res
30:1174,
1970[Abstract/Free Full Text]
13.
Aden DP,
Fogel A,
Plotkin S,
Damjanov I,
Knowles BB:
Controlled synthesis of HBsAg in a differentiated human liver carcinoma-derived cell line.
Nature
282:615,
1979[Medline]
[Order article via Infotrieve]
14.
Monks A,
Scudiero D,
Skehan P,
Shoemaker P,
Paull K,
Vistica D,
Hose C,
Langley J,
Cronise P,
Vaigro-Wolff A,
Gray-Goodrich M,
Campbell H,
Mayo J,
Boyd M:
Feasibility of a high-flux anticancer drug screen using a diverse panel of cultured human tumor cell lines.
J Natl Cancer Inst
83:757,
1991[Abstract/Free Full Text]
15.
Dexter DL,
Barbosa JA,
Calabresi P:
N,N-Dimethylformamide-induced alteration of cell culture characteristics and loss of tumorigenicity in cultured human colon carcinoma cells.
Cancer Res
39:1020,
1979[Abstract/Free Full Text]
16.
Cherney BW,
Bhatia KG,
Sgadari C,
Gutierrez MI,
Mostowski H,
Pike SE,
Gupta G,
Magrath IT,
Tosato G:
Role of the p53 tumor suppressor gene in the tumorigenicity of Burkitt's lymphoma cells.
Cancer Res
57:2508,
1997[Abstract/Free Full Text]
17.
Lai G-M,
Chen Y-N,
Mickley LA,
Fojo AT,
Bates SE:
P-glycoprotein expression and schedule dependence of Adriamycin cytotoxicity in human colon carcinoma cell lines.
Int J Cancer
49:696,
1991[Medline]
[Order article via Infotrieve]
18.
Lai GM,
Moscow JA,
Alvarez M,
Fojo AT,
Bates SE:
Contribution of glutathione and glutathione dependent enzymes in the reversal of adriamycin resistance in colon carcinoma cell lines.
Int J Cancer
49:688,
1991[Medline]
[Order article via Infotrieve]
19.
Eva A,
Robbins K,
Anderson P,
Srinivasan A,
Tronick S,
Reddy E,
Ellmore N,
Gallen A,
Lautenberger J,
Papas T,
Westin E,
Wong-Staal F,
Gallo R,
Aaronson S:
Cellular genes analogous to retroviral onc genes are transcribed in human tumor cells.
Nature
295:116,
1982[Medline]
[Order article via Infotrieve]
20.
Fairchild CR,
Ivy SP,
Kao-Shan C-S,
Whang-Peng J,
Rosen N,
Israel MA,
Melera PW,
Cowan KH,
Goldsmith ME:
Isolation of amplified and overexpressed DNA sequences from adriamycin-resistant human breast cancer cells.
Cancer Res
47:5141,
1987[Abstract/Free Full Text]
21.
Wilson WH,
Bryant G,
Bates SE,
Fojo AT,
Wittes RE,
Steinberg SM,
Kohler DR,
Jaffe ES,
Herdt J,
Cheson BD,
Chabner BA:
EPOCH chemotherapy: Toxicity and efficacy in relapsed and refractory non-hodgkin's lymphoma.
J Clin Oncol
11:1573,
1993[Abstract/Free Full Text]
22.
Melton DA,
Krieg PA,
Rebagliati MR,
Maniatis T,
Zinn K,
Green MR:
Efficient in vitro synthesis of biologically active RNA and RNA hybridization probes from plasmids containing a bacteriophage SP6 promoter.
Nucleic Acids Res
12:7035,
1984[Abstract/Free Full Text]
23.
Mickley LA,
Bates SE,
Richert ND,
Currier S,
Tanaka S,
Foss F,
Rosen N,
Fojo AT:
Modulation of the expression of a multidrug resistance gene (mdr-1/P-glycoprotein) by differentiating agents.
J Biol Chem
264:18031,
1989[Abstract/Free Full Text]
24.
Mullis K,
Faloona F,
Scharf S,
Saiki R,
Horn G,
Erlich H:
Specific enzymatic amplification of DNA in vitro: The polymerase chain reaction.
Cold Spring Harb Symp Quant Biol
51:263,
1986
25.
Ohara O,
Dorit RL,
Gilbert W:
One sided polymerase chain reaction: The amplification of cDNA.
Proc Natl Acad Sci USA
85:8998,
1989
26.
Mickley LA,
Spengler BA,
Knutsen TA,
Biedler JL,
Fojo T:
Gene rearrangement: A novel mechanism for MDR-1 gene activation.
J Clin Invest
99:1947,
1997[Medline]
[Order article via Infotrieve]
27.
Chen CJ,
Chin JE,
Ueda K,
Clark DP,
Pasten I,
Gottesman M,
Roninson IB:
Internal duplication and homology with bacterial transport proteins in mdr-1 (P-glycoprotein) gene from multidrug-resistant human cells.
Cell
47:371,
1986[Medline]
[Order article via Infotrieve]
28.
Kioka N,
Tsubota J,
Kakehi Y,
Komano T,
Gottesman MM,
Pastan I,
Ueda K:
P-glycoprotein gene (MDR1) cDNA from human adrenal: Normal P-glycoprotein carries GLY185 with an altered pattern of multidrug resistance.
Biochem Biophys Res Comm
162:224,
1989[Medline]
[Order article via Infotrieve]
29.
Fairchild CR,
Moscow JA,
Obrien EE,
Cowan KH:
Multidrug resistance in cells transfected with human genes encoding a variant P-glycoprotein and glutathione S-transferase-alpha.
Mol Pharmacol
37:801,
1990[Abstract]
30.
Herzog CE,
Tsokos M,
Bates SE,
Fojo AT:
Increased mdr-1/P-glycoprotein expression after treatment of human colon carcinoma cells with P-glycoprotein antagonists.
J Biol Chem
268:2946,
1993[Abstract/Free Full Text]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
M. Pajic, J. K. Iyer, A. Kersbergen, E. van der Burg, A. O.H. Nygren, J. Jonkers, P. Borst, and S. Rottenberg
Moderate Increase in Mdr1a/1b Expression Causes In vivo Resistance to Doxorubicin in a Mouse Model for Hereditary Breast Cancer
Cancer Res.,
August 15, 2009;
69(16):
6396 - 6404.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. S. Streetman
Clinical Pharmacogenetics of the Major Adenosine Triphosphate Binding Cassette and Solute Carrier Drug Transporters
Journal of Pharmacy Practice,
June 1, 2007;
20(3):
219 - 233.
[Abstract]
[PDF]
|
|
|
|
|
|
|
L. M. Huff, J.-S. Lee, R. W. Robey, and T. Fojo
Characterization of Gene Rearrangements Leading to Activation of MDR-1
J. Biol. Chem.,
December 1, 2006;
281(48):
36501 - 36509.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. Mickley Huff, Z. Wang, A. Iglesias, T. Fojo, and J.-S. Lee
Aberrant Transcription from an Unrelated Promoter Can Result in MDR-1 Expression following Drug Selection In vitro and in Relapsed Lymphoma Samples
Cancer Res.,
December 15, 2005;
65(24):
11694 - 11703.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. G. Chen, Y. C. Wang, M. E. Schaner, B. Francisco, G. E. Duran, D. Juric, L. M. Huff, H. Padilla-Nash, T. Ried, T. Fojo, et al.
Genetic and Epigenetic Modeling of the Origins of Multidrug-Resistant Cells in a Human Sarcoma Cell Line
Cancer Res.,
October 15, 2005;
65(20):
9388 - 9397.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
W. S. Putnam, J. M. Woo, Y. Huang, and L. Z. Benet
Effect of the MDR1 C3435T Variant and P-Glycoprotein Induction on Dicloxacillin Pharmacokinetics
J. Clin. Pharmacol.,
April 1, 2005;
45(4):
411 - 421.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. Geromin, J.-F. Bourge, A. Soulie, R. Pawliuk, C. Fleet, E. Michel, Y. Denizot, C. Berthou, P. Leboulch, F. Sigaux, et al.
Glycoprotein 170 Induces Platelet-Activating Factor Receptor Membrane Expression and Confers Tumor Cell Hypersensitivity to NK-Dependent Cell Lysis
J. Immunol.,
March 15, 2004;
172(6):
3604 - 3611.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. C. Lockhart, R. G. Tirona, and R. B. Kim
Pharmacogenetics of ATP-binding Cassette Transporters in Cancer and Chemotherapy
Mol. Cancer Ther.,
July 1, 2003;
2(7):
685 - 698.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Illmer, U. S. Schuler, C. Thiede, U. I. Schwarz, R. B. Kim, S. Gotthard, D. Freund, U. Schakel, G. Ehninger, and M. Schaich
MDR1 Gene Polymorphisms Affect Therapy Outcome in Acute Myeloid Leukemia Patients
Cancer Res.,
September 1, 2002;
62(17):
4955 - 4962.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Kimchi-Sarfaty, J. J. Gribar, and M. M. Gottesman
Functional Characterization of Coding Polymorphisms in the Human MDR1 Gene Using a Vaccinia Virus Expression System
Mol. Pharmacol.,
July 1, 2002;
62(1):
1 - 6.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
U Potocnik, M Ravnik-Glavac, R Golouh, and D Glavac
Naturally occurring mutations and functional polymorphisms in multidrug resistance 1 gene: correlation with microsatellite instability and lymphoid infiltration in colorectal cancers
J. Med. Genet.,
May 1, 2002;
39(5):
340 - 346.
[Full Text]
[PDF]
|
|
|
|
|
|
|
E.-j. Wang, C. N. Casciano, R. P. Clement, and W. W. Johnson
Evaluation of the Interaction of Loratadine and desloratadine with P-glycoprotein
Drug Metab. Dispos.,
August 1, 2001;
29(8):
1080 - 1083.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Tanabe, I. Ieiri, N. Nagata, K. Inoue, S. Ito, Y. Kanamori, M. Takahashi, Y. Kurata, J. Kigawa, S. Higuchi, et al.
Expression of P-glycoprotein in Human Placenta: Relation to Genetic Polymorphism of the Multidrug Resistance (MDR)-1 Gene
J. Pharmacol. Exp. Ther.,
June 1, 2001;
297(3):
1137 - 1143.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
M. M. van den Heuvel-Eibrink, E. A. C. Wiemer, M. J. de Boevere, B. van der Holt, P. J. M. Vossebeld, R. Pieters, and P. Sonneveld
MDR1 gene-related clonal selection and P-glycoprotein function and expression in relapsed or refractory acute myeloid leukemia
Blood,
June 1, 2001;
97(11):
3605 - 3611.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. Verdier-Pinard, J. A. Kepler, G. R. Pettit, and E. Hamel
Sustained Intracellular Retention of Dolastatin 10 Causes Its Potent Antimitotic Activity
Mol. Pharmacol.,
January 1, 2000;
57(1):
180 - 187.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
S. E. Bates
Drug Resistance: Still on the Learning Curve
Clin. Cancer Res.,
November 1, 1999;
5(11):
3346 - 3348.
[Full Text]
[PDF]
|
|
|
|
|
|
|
W. E. Evans and M. V. Relling
Pharmacogenomics: Translating Functional Genomics into Rational Therapeutics
Science,
October 15, 1999;
286(5439):
487 - 491.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
S. Hoffmeyer, O. Burk, O. von Richter, H. P. Arnold, J. Brockmoller, A. Johne, I. Cascorbi, T. Gerloff, I. Roots, M. Eichelbaum, et al.
Functional polymorphisms of the human multidrug-resistance gene: Multiple sequence variations and correlation of one allele with P-glycoprotein expression and activity in vivo
PNAS,
March 28, 2000;
97(7):
3473 - 3478.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Abstract
Introduction
Abstract