|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 91 No. 5 (March 1), 1998:
pp. 1757-1761
Origin of the Hodgkin/Reed-Sternberg Cells in Chronic Lymphocytic
Leukemia With "Hodgkin's Transformation"
By
Toshiyuki Ohno,
Bassam N. Smir,
Dennis D. Weisenburger,
Randy D. Gascoyne,
Steven D. Hinrichs, and
Wing C. Chan
From the Department of Pathology and Microbiology, University of
Nebraska Medical Center, Omaha; the Department of Pathology, University
of Texas Health Science Center at San Antonio, San Antonio; and the
Cancer Control Agency of British Columbia, Vancouver, British Columbia,
Canada.
 |
ABSTRACT |
A lymphoma with the characteristic features of Hodgkin's disease
(HD) occasionally develops in patients with B-cell chronic lymphocytic
leukemia (CLL), and has been called Richter's syndrome with HD
features. In such cases, large tumor cells have the morphological and
immunophenotypic features of classical Hodgkin and Reed-Sternberg (H-RS) cells. However, it is not known whether the H-RS cells arise
from transformation of the underlying CLL cells or from a different
pathological process. We report herein a study of the clonal
relationship between the CLL cells and the H-RS cells in three cases of
Richter's syndrome with HD features by using a single cell assay. We
isolated single CLL cells and H-RS cells from immunostained tissue
sections by micromanipulation. The immunoglobulin heavy chain gene
(IgH) complementarity determining region (CDR) III of each cell was
amplified by the polymerase chain reaction (PCR). The products were
then compared by gel electrophoresis and nucleotide sequencing. The IgH
CDRIII sequences from the H-RS cells were identical to those from the
CLL cells in two cases. In one case, the clonal relationship between
the two types of cells could not be determined because PCR products
could not be obtained from any of the H-RS cells. This study shows that
the H-RS cells and the CLL cells belong to the same clonal population in some cases of Richter's syndrome with HD features. Furthermore, our
findings indicate that mature B cells can undergo transformation to
cells with the features of H-RS cells, in association with a cellular
background typical of HD. This study also supports recent findings
suggesting that the H-RS cells in classical HD are derived from
transformed B cells.
| |
INTRODUCTION |
B-CELL CHRONIC lymphocytic leukemia (CLL)
is an indolent lymphoproliferative disease derived from mature B cells.
Approximately 3% to 10% of cases of CLL develop high-grade lymphoma,
a process known as Richter's syndrome.1,2 Usually, these
high-grade lymphomas consist of monomorphic large cells and are
classified morphologically as large-cell non-Hodgkin's lymphoma. In
most cases, the high-grade component is considered to represent a
blastic transformation of the CLL cells.3-5 However, in a
small number of the cases, the high-grade component has characteristics
of Hodgkin's disease (HD).6-17 In some of these cases, the
large cells not only resemble Hodgkin and Reed-Sternberg (H-RS) cells, but also exhibit the typical H-RS cell immunophenotype
(CD15+, CD30+, and lineage  ). An
interesting question is whether the H-RS cells in this form of
Richter's syndrome represent transformation of the underlying CLL
cells or a different pathological process. However, it is impossible to
answer this question with the usual study methods such as Southern
blotting, because of the paucity of H-RS cells, or polymerase chain
reaction (PCR) using DNA extracted from whole sections, because of the
presence of multiple cell populations. In this study, the clonal
relationship between the CLL cells and the H-RS cells in three cases of
Richter's syndrome with HD features was determined using a single cell
assay. Single CLL cells and H-RS cells were isolated from immunostained
sections of these cases by micromanipulation, and the immunoglobulin
heavy chain gene (IgH) complementarity determining region (CDR) III of
each cell was amplified by PCR. The products were then compared by gel
electrophoresis and nucleotide sequencing.
| |
MATERIALS AND METHODS |
Patients.
Three cases of Richter's syndrome with HD features were selected from
the database of the Lymphoma Registry at the University of Nebraska
Medical Center, the Cancer Control Agency of British Columbia, and the
consultation files of one of the authors (W.C.C.). All of the patients
were men, ages 59 to 61 years, with a previous history of CLL before
presenting with a lymphoma resembling HD. Tissue samples fixed in
formalin solution and embedded in paraffin were available for study.
Immunohistochemistry.
Four-micron paraffin sections were cut and stained using a three-step
immunoperoxidase method.18 The following antibodies were
used as primary antibodies: L26 (anti-CD20), polyclonal anti-CD3, UCHL1
(anti-CD45RO), leukocyte common antigen (anti-CD45), and BerH2
(anti-CD30), purchased from Dako Corporation (Carpinteria, CA); Leu22
(anti-CD43) and LeuM1 (anti-CD15) from Becton Dickinson (San Jose, CA);
and MB2 from Biotest (Dreieich, Germany).
Single cell isolation from tissue sections.
Four-micron sections were cut from a formalin-fixed, paraffin-embedded
tissue specimen and stained with antibodies against CD20 (cases 1 and
3) or MB2 (case 2) for isolating B-CLL cells, with antibodies against
CD15 (case 2) or CD30 (cases 1 and 3) for isolating H-RS cells, and
with an antibody against CD3 (cases 1 and 2) for isolating T cells.
Before immunostaining with anti-CD15, CD30, or CD3, the sections were
digested with trypsin (0.1%, type II; Sigma, St Louis, MO) in
Tris-buffer (pH 7.6) for 30 minutes at 37°C. By using an inverted
microscope (Nikon, New York, NY), stained single cells were isolated
with a microknife and micropipette attached to hydraulic
micromanipulators (Narishige, New York, NY), and expelled into a tube
containing PCR buffer.19 Before cell harvest, sections
stained with anti-CD20 were digested for 20 to 30 minutes at 37°C
with a mixture of collagenase (0.3%, type XI; Sigma) and trypsin
(0.25%, type II; Sigma) dissolved in phosphate-buffered saline (pH
7.4). During the micromanipulation, the section was overlaid with
sterile distilled water which was replaced after the isolation of each
cell. The distilled water overlying the section was sampled
periodically to serve as a negative supernatant control.
PCR amplification of single cells.
The IgH CDRIII of each single cell was amplified by a seminested
PCR.20 In both PCR rounds, a consensus primer to the 3 end
of the third framework region of the VH genes (sequence:
5CTGTCGACACGGCCGTGTATTACTG3) was used.21 Two different
consensus primers to the 3 end of the antisense JH segments, a JH
external primer (sequence: 5ACCTGAGGAGACGGTGACC3), and a JH nested
primer (sequence: 5ACCAGGGTCCCTTGGCCCCA3) were used in the first and
second rounds of the PCR, respectively. Single cells were placed into
25 µL PCR buffer (50 mmol/L KCI, 10 mmol/L Tris-HCl at pH 8.3, 2.5 mmol/L MgCl2, 0.1 mg/mL gelatin, 0.45% Nonidet P40, 0.45%
Tween 20) containing 200 µg/mL proteinase K. The reaction mixture was
covered with 50 µL of mineral oil and incubated at 55°C for 3 hours. Proteinase K was then inactivated at 96°C for 10 minutes. A
PCR cycle consisted of annealing for 40 seconds at 55°C, extension
for 40 seconds at 72°C, and denaturation for 40 seconds at 94°C.
The first round of PCR was performed for 30 cycles and the second round
for 35 cycles. Two microliters of a 1:200 dilution of the PCR product
from the first round was used as the template for the second round of
PCR. In both rounds, the PCR mixture contained 200 µmol/L of each
dNTP and 0.2 µmol/L of each primer in a total volume of 50 µL of
PCR buffer. Taq polymerase, 1.5 U, was added to each reaction by using
a hot start procedure. The amplified products were electrophoresed on
8% polyacrylamide gels and visualized with UV light after
ethidium-bromide staining.
DNA sequencing.
In cases 1 and 2, representative IgH CDRIII PCR products of the
amplifiable CLL and H-RS cells were sequenced to determine their clonal
relationship. For this purpose, the original IgH CDRIII PCR product was
reamplified in a 50 µL volume by using VH and JH nested primers with
M13 sequences attached to their 5 end (sequence: M13 + VH,
TGTAAAACGACGGCCAGTCTGTCGACACGGCCGTGTATTACTG; M13R + JH,
GGAAACAGCTATGACCATGACCAGGGTCCCTTGGCCCCA). The products were
gel-purified and directly sequenced with primers complementary to M13
or M13R by means of a cycle sequencing procedure with fluorescent dideoxynucleotide terminators (Applied Biosystems, Foster City, CA).22 The sequences were analyzed with the Applied
Biosystem 373A sequenator (Applied Biosystems).
| |
RESULTS |
Histological and immunohistochemical findings.
In case 1, the cervical lymph nodes showed a proliferation of small
lymphocytes with round nuclei, consistent with CLL. In addition, large
highly pleomorphic cells resembling H-RS cells were present in small
clusters among small lymphocytes (Fig 1A).In case 2, the lymph nodes showed subtotal obliteration of the
architecture by a polymorphic infiltrate of small lymphocytes and
histiocytes, with scattered H-RS cells admixed. In case 3, an axillary
lymph node exhibited nodules of HD, with H-RS cells present in a
typical polymorphous inflammatory background (Fig 1B), which was
sharply delineated from areas with CLL.
View larger version (151K):
[in this window]
[in a new window]
View larger version (140K):
[in this window]
[in a new window]
| Fig 1.
H-RS cells in case 1 (A) and case 3 (B), (hematoxylin and
eosin, original magnification × 400). H-RS cells were present among small lymphocytes in case 1, whereas they were present in a
polymorphous inflammatory background in case 3.
|
|
The results of the immunohistochemical studies are shown in Table
1 and Fig 2.The CLL cells were reactive with B-cell markers in all three cases, and
also expressed CD43 in cases 2 and 3, as is commonly observed in
B-CLL.23 The H-RS cells expressed CD15 and CD30 in all
three cases. In case 1, a small subset of the H-RS cells also expressed
CD20. The small lymphocytes forming the inflammatory background of the
HD component in cases 2 and 3 were mostly T cells. Scattered B
lymphocytes were also present, more prominently in case 2 where the
Hodgkin's foci were less sharply demarcated from the CLL areas as
compared with case 3. In case 1, although the typical cellular
background of HD was absent, most of the small lymphocytes associated
with the H-RS cell areas were T cells which often formed a ring around
the H-RS cells.
View larger version (139K):
[in this window]
[in a new window]
View larger version (134K):
[in this window]
[in a new window]
View larger version (134K):
[in this window]
[in a new window]
View larger version (121K):
[in this window]
[in a new window]
| Fig 2.
Immunohistochemistry of CD3 in case 1: (A) low (40×),
(B) high (400×). CD3+ T cells are associated with
clusters of H-RS cells, often forming a ring around the H-RS cells.
Inset shows CD30+ H-RS cells. Immunohistochemistry of MB2
in case 2: (C) low (40×), (D) high (400×). MB2
+ CLL cells are present around a nodule of HD. H-RS
cells are admixed with T cells and histiocytes and only scattered
MB2+ small lymphocytes are present.
|
|
PCR amplification and sequence analysis of the IgH CDRIII.
The results of IgH CDRIII PCR performed on single cells are summarized
in Table 2 and illustrated in Fig
3. In all three cases, PCR products were
obtained from 20% to 30% of the small B cells. They showed an
identical length in each case, indicating that they were monoclonal. In
cases 1 and 2, PCR products which were identical in length to those
from the small B cells were also obtained from 40% to 45% of the H-RS
cells (Fig 3). Because a small population of H-RS cells in case 1 expressed CD20, the experiment was repeated after staining a section
with CD20, and negative H-RS cells were isolated and studied. The PCR
products obtained from these CD20 cells were also
identical in size to those obtained from the small B cells. In case 3, IgH CDRIII products were obtained from 12/40 small B cells and they
were of identical size, but PCR products could not be obtained from the
H-RS cells. In cases 1 and 2, T cells were isolated as negative
controls. No PCR products were obtained from the T cells in case 1, as
expected. However, in case 2, a PCR product was obtained from one of 20 T cells, but it was different in length from the PCR products obtained
from the B cells and the H-RS cells. A total of 54 supernatants were sampled as negative controls in the three cases, and a PCR product was
amplified from only one supernatant, again different in size from those
obtained from the corresponding CLL cells.
View larger version (52K):
[in this window]
[in a new window]
| Fig 3.
Polyacrylamide gel electrophoresis of IgH CDRIII PCR
products obtained from single CLL cells and H-RS cells: (A) case 1, (B) case 2. All PCR products are identical in size in each case. M, 100 basepair (bp) molecular size ladder with 100- and 200-bp markers shown.
H-RS(1) indicates that the PCR products were obtained from CD30+ H-RS cells. In a separate experiment,
CD20 H-RS cells were isolated for study and the PCR
products are shown under H-RS(2).
|
|
Sequence analysis was performed on three PCR products from the B-CLL
cells, four PCR products from the CD30+ H-RS cells, and two
PCR products from the CD20 H-RS cells in case 1. Sequence analysis was also performed on three PCR products from the
B-CLL cells and four PCR products from the H-RS cells in case 2. All of
the PCR products were identical in each case (Table
3).
| |
DISCUSSION |
To determine the clonal relationship between H-RS cells and CLL cells,
we examined the IgH CDRIII of both types of cells from three cases of
Richter's syndrome with HD features using single-cell analysis. The
H-RS cells had the morphological and immunophenotypical features
typical of classical HD in all three cases. We found that the IgH
CDRIII sequences from the H-RS cells were identical to those from the
CLL cells in two cases (cases 1 and 2). In one case (case 3), we could
not determine the clonal relationship between the CLL cells and the
H-RS cells because PCR products could not be obtained from any of the
single H-RS cells. These findings indicate that the H-RS cells and the
CLL cells belong to the same clonal population in some cases of
Richter's syndrome with HD features.
HD is reported to be occasionally associated with CLL,6-17
and a recent study showed that HD is one of the most common secondary neoplasms in patients with CLL.24 Two types of Richter's
syndrome with HD features have been reported: one type with H-RS cells scattered in a background of CLL cells (type 1)9-12 and the
other type with H-RS cells present in a typical polymorphous
inflammatory background separate from the CLL (type
2).6-8,14-17 Generally, it has been assumed that the H-RS
cells in type 1 disease represent histological progression of the
underlying CLL cells, especially when the H-RS cells also express
B-cell markers, whereas type 2 is thought to represent the occurrence
of two separate diseases, based on both the histological and
immunophenotypical findings. However, recent studies have suggested a
lymphoid, usually B-cell, origin for the H-RS cell, not only in
lymphocytic predominance HD but also in de novo classical
HD.25-27 Thus, it is necessary to reconsider the assumption
that the two lesions in type 2 disease are unrelated.
In case 1, the H-RS cells were present in clusters among the CLL cells.
Although the typical cellular background of HD was absent,
immunohistochemical stains showed that the lymphocytes associated with
the H-RS cell clusters were mostly T cells, which often formed rings
around the H-RS cells, as is characteristically seen in
HD.28 In case 2, the H-RS cells were present in a
polymorphous inflammatory background as in classical HD, but CLL cells
were also scattered within the inflammatory background, especially at
the edges of the HD component. Case 1 seems to fall into the above-mentioned type 1 category of disease, whereas case 2 is more
similar to type 2 disease. It has been reported that some cases of type
1 disease may progress to disseminated HD with the disappearance of
CLL.9,10 Our case 2 may represent such a case. In case 3, the HD component, in which the H-RS cells were present in a typical
inflammatory background, was sharply delineated from the CLL as seen in
type 2 disease. However, in this case we could not obtain IgH CDRIII
products from any of the H-RS cells. We must be careful before
concluding that the H-RS cells in case 3 are clonally unrelated to the
CLL cells and the two components are separate disease processes. The
possibility remains that somatic mutations on the IgH gene during the
progression from the CLL cells to the H-RS cells may hamper PCR
amplification of the gene. More type 2 cases need to be studied to
arrive at a general conclusion concerning the clonal relationship
between the CLL cells and the H-RS cells in this subtype.
In cases 1 and 2, we have shown conclusively that the H-RS cells and
the corresponding CLL cells had identically rearranged IgH genes. In
case 1, a small percentage of the H-RS cells expressed CD20. Therefore,
we repeated the experiment by isolating CD20 negative H-RS cells and
clonal identity with the CLL cells was again shown. In both cases, all
the CDRIII sequences, including those from the H-RS cells, were
identical, showing no intraclonal variation, as would be expected in
CLL.29 The possibility that the amplified CDRIII products
from the H-RS cells were caused by contamination is very unlikely
because all negative controls, except for one T cell (2.5%) and one
supernatant (2%), showed no amplified products. This contamination
rate is far lower than the amplification rate of the H-RS cells (39%)
and, in both instances, the amplicon differed in size from the
corresponding clonal products. Furthermore, the H-RS cells in case 1 were mostly surrounded by T cells and, in case 2, most of the
background lymphocytes were T cells. During micromanipulation, H-RS
cell nuclei, instead of whole cells, were removed to avoid disturbing
the surrounding cells and the sections were sufficiently thin so that
individual cells could be clearly identified. The higher amplification
rate of the H-RS cells compared with the CLL cells came as a surprise. It is possible that the H-RS cells were aneuploid or tetraploid and
therefore more copies of IgH genes were present per cell.30
Our findings have significant theoretical implications with regard to
the origin of H-RS cells. We have clearly shown that mature B cells can
transform into cells with the morphology and immunophenotype of H-RS
cells. This cellular transformation may also be accompanied by a change
in the cellular milieu with numerous T cells and histiocytes as seen in
case 2. These observations are consistent with the recent finding
suggesting that H-RS cells in classical HD are derived from transformed
B cells.27 Perhaps the H-RS cells occurring in CLL and
classical HD share common genetic alterations that result in the
morphologic and immunophenotypic features, cytokine production profile,
and stromal reactions that we recognize as HD.
| |
FOOTNOTES |
Submitted August 19, 1997;
accepted October 30, 1997.
Supported by Award No. LB595 from the Department of Health, State of
Nebraska.
Address reprint requests to Wing C. Chan, MD, Department of Pathology
and Microbiology, University of Nebraska Medical Center, 600 S 42nd St,
Omaha, NE 68198-3135.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. section 1784 solely to indicate this fact.
| |
ACKNOWLEDGMENT |
The author thanks the secretarial and technical assistance of Jannene
Sass, Michael Lambert, and George Pallas.
| |
REFERENCES |
1.
Armitage JO,
Dick FR,
Corder MP:
Diffuse histiocytic lymphoma complicating chronic lymphocytic leukemia.
Cancer
41:422,
1978[Medline]
[Order article via Infotrieve]
2.
Harousseau JL,
Flandrin G,
Tricot G,
Brouet JC,
Seligmann M,
Bernard J:
Malignant lymphoma supervening in chronic lymphocytic leukemia and related disorders, Richter's syndrome: A study of 25 cases.
Cancer
48:1302,
1981[Medline]
[Order article via Infotrieve]
3.
Cherepakhin V,
Baird SM,
Meisenholder GW,
Kipps TJ:
Common clonal origin of chronic lymphocytic leukemia and high-grade lymphoma of Richter's syndrome.
Blood
82:3141,
1993[Abstract/Free Full Text]
4.
Matolcsy A,
Inghirami G,
Knowles DM:
Molecular genetic demonstration of the diverse evolution of Richter's syndrome (chronic lymphocytic leukemia and subsequent large cell lymphoma).
Blood
83:1363,
1994[Abstract/Free Full Text]
5.
Bessudo A,
Kipps TJ:
Origin of high-grade lymphomas in Richter syndrome.
Leuk Lymphoma
18:367,
1995[Medline]
[Order article via Infotrieve]
6.
Choi H,
Keller RH:
Coexistence of chronic lymphocytic leukemia and Hodgkin's disease.
Cancer
48:48,
1981[Medline]
[Order article via Infotrieve]
7.
Hansmann ML,
Fellbaum CH,
Hui PK,
Lennert K:
Morphological and immunohistochemical investigation of non-Hodgkin's lymphoma combined with Hodgkin's disease.
Histopathology
15:35,
1989[Medline]
[Order article via Infotrieve]
8.
Brecher M,
Banks PM:
Hodgkin's disease variant of Richter's syndrome: Report of eight cases.
Am J Clin Pathol
93:333,
1990[Medline]
[Order article via Infotrieve]
9.
Williams J,
Schned A,
Cotelingam JD,
Jaffe ES:
Chronic lymphocytic leukemia with coexistent Hodgkin's disease: Implications for the origin of the Reed-Sternberg cell.
Am J Surg Pathol
15:33,
1991[Medline]
[Order article via Infotrieve]
10.
Momose H,
Jaffe ES,
Shin SS,
Chen YY,
Weiss LM:
Chronic lymphocytic leukemia/small lymphocytic lymphoma with Reed-Sternberg-like cells and possible transformation to Hodgkin's disease: Mediation by Epstein-Barr virus.
Am J Surg Pathol
16:859,
1992[Medline]
[Order article via Infotrieve]
11.
Shin SS,
Ben-Ezra J,
Burke JS,
Sheibani K,
Rappaport H:
Reed-Sternberg-like cells in low-grade lymphomas are transformed neoplastic cells of B-cell lineage.
Am J Clin Pathol
99:658,
1993[Medline]
[Order article via Infotrieve]
12.
Tsang WYW,
Chan JKC,
Ng CS:
The nature of Reed-Sternberg-like cells in chronic lymphocytic leukemia.
Am J Clin Pathol
99:317,
1993[Medline]
[Order article via Infotrieve]
13.
Rubin D,
Hudnall SD,
Aisenberg A,
Jacobson JO,
Harris NL:
Richter's transformation of chronic lymphocytic leukemia with Hodgkin's-like cells is associated with Epstein-Barr virus infection.
Mod Pathol
7:91,
1994[Medline]
[Order article via Infotrieve]
14.
Butts C,
Drouin J,
Taylor R,
Mcleish W:
Hodgkin's disease in CLL.
Am J Hematol
48:134,
1995[Medline]
[Order article via Infotrieve]
15.
Weisenberg E,
Anastasi J,
Adeyanju M,
Variakojis D,
Vardiman JW:
Hodgkin's disease associated with chronic lymphocytic leukemia: Eight additional cases, including two of the nodular lymphocyte predominant type.
Am J Clin Pathol
103:479,
1995[Medline]
[Order article via Infotrieve]
16.
Cha I,
Herndier BG,
Glassberg AB,
Hamill TR:
A case of composite Hodgkin's disease and chronic lymphocytic leukemia in bone marrow: Lack of Epstein-Barr virus.
Arch Pathol Lab Med
120:386,
1996[Medline]
[Order article via Infotrieve]
17.
Fayad L,
Robertson LE,
O'Brien S,
Manning JT,
Wright S,
Hagemeister F,
Cabanillas F,
Keating MJ:
Hodgkin's disease variant of Richter's syndrome: Experience at a single institution.
Leuk Lymphoma
23:333,
1996[Medline]
[Order article via Infotrieve]
18.
Hsu SM,
Raine L,
Fanger H:
Use of avidin-biotin-peroxidase complex (ABC) in immunoperoxidase techniques: A comparison between ABC and unlabeled antibody (PAP) procedures.
J Histochem Cytochem
29:577,
1981[Abstract]
19.
d'Amore F,
Stribley JA,
Ohno T,
Wu G,
Wickert RS,
Delabie J,
Hinrichs SH,
Chan WC:
Molecular studies on single cells harvested by micromanipulation from archival tissue sections previously stained by immunohistochemistry or nonisotopic in situ hybridization.
Lab Invest
76:219,
1997[Medline]
[Order article via Infotrieve]
20.
Delabie J,
Tierens A,
Wu G,
Weisenburger DD,
Chan WC:
Lymphocyte predominance Hodgkin's disease: Lineage and clonality determination using a single-cell assay.
Blood
84:3291,
1994[Abstract/Free Full Text]
21.
Yamada M,
Hudson S,
Tournay O,
Brittenbender S,
Shane SS,
Lange B,
Tsujimoto Y,
Caton AJ,
Rovera G:
Detection of minimal disease in hematopoietic malignancies of the B-cell lineage by using third-complementarity-determining region (CDRIII)-specific probes.
Proc Natl Acad Sci USA
86:5123,
1989[Abstract/Free Full Text]
22.
Wu G,
Greiner TC,
Chan WC:
Obtaining clone-specific primer and probe for the immunoglobulin heavy chain gene from paraffin-embedded tissue of B-cell lymphoma: Technical considerations.
Diagn Mol Pathol
6:147,
1997[Medline]
[Order article via Infotrieve]
23.
Contos MJ,
Kornstein MJ,
Innes DJ,
Ben-Ezra J:
The utility of CD20 and CD43 in subclassification of low-grade B-cell lymphoma on paraffin sections.
Mod Pathol
5:631,
1992[Medline]
[Order article via Infotrieve]
24.
Travis LB,
Curtis RE,
Hankey BF,
Franmeni JF:
Second cancers in patients with chronic lymphocytic leukemia.
J Natl Cancer Inst
84:1422,
1992[Abstract/Free Full Text]
25.
Hummel M,
Ziemann K,
Lammert H,
Pileri S,
Sabattini E,
Stein H:
Hodgkin's disease with monoclonal and polyclonal populations of Reed-Sternberg cells.
N Engl J Med
333:901,
1995[Abstract/Free Full Text]
26.
Ohno T,
Stribley JA,
Wu G,
Hinrichs SH,
Weisenburger DD,
Chan WC:
Clonality in nodular lymphocytic predominance Hodgkin's disease: A report of single cell analysis.
N Engl J Med
337:459,
1997[Abstract/Free Full Text]
27.
Kanzler H,
Kuppers R,
Hansmann ML,
Rajewsky K:
Hodgkin and Reed-Sternberg cells in Hodgkin's disease represent the outgrowth of a dominant tumor clone derived from (crippled) germinal center B cells.
J Exp Med
184:1495,
1996[Abstract/Free Full Text]
28.
Poppema S:
The nature of the lymphocytes surrounding Reed-Sternberg cells in nodular lymphocyte predominance and in other types of Hodgkin's disease.
Am J Pathol
135:351,
1989[Abstract]
29.
Korganow AS,
Martin T,
Weber JC,
Lioure B,
Lutz P,
Knapp AM,
Pasquali JL:
Molecular analysis of rearranged VH genes during B cell chronic lymphocytic leukemia: Intraclonal stability is frequent but not constant.
Leuk Lymphoma
14:55,
1994[Medline]
[Order article via Infotrieve]
30.
Tilly H,
Bastard C,
Delastre T,
Dural C,
Bizet M,
Lenormand B,
Dauce JP,
Monconduit M,
Piguet H:
Cytogenetic studies in untreated Hodgkin's disease.
Blood
77:1298,
1991[Abstract/Free Full Text]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
R. J. Jones, C. D. Gocke, Y. L. Kasamon, C. B. Miller, B. Perkins, J. P. Barber, M. S. Vala, J. M. Gerber, L. L. Gellert, M. Siedner, et al.
Circulating clonotypic B cells in classic Hodgkin lymphoma
Blood,
June 4, 2009;
113(23):
5920 - 5926.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Ikeda, M. Merchant, L. Lev, R. Longnecker, and M. Ikeda
Latent Membrane Protein 2A, a Viral B Cell Receptor Homologue, Induces CD5+ B-1 Cell Development
J. Immunol.,
May 1, 2004;
172(9):
5329 - 5337.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Cerutti, H. Zan, E. C. Kim, S. Shah, E. J. Schattner, A. Schaffer, and P. Casali
Ongoing In Vivo Immunoglobulin Class Switch DNA Recombination in Chronic Lymphocytic Leukemia B Cells
J. Immunol.,
December 1, 2002;
169(11):
6594 - 6603.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. van den Berg, E. Maggio, R. Rust, K. Kooistra, A. Diepstra, and S. Poppema
Clonal relation in a case of CLL, ALCL, and Hodgkin composite lymphoma
Blood,
July 30, 2002;
100(4):
1425 - 1429.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S A Pileri, S Ascani, L Leoncini, E Sabattini, P L Zinzani, P P Piccaluga, A Pileri Jr, M Giunti, B Falini, G B Bolis, et al.
Hodgkin's lymphoma: the pathologist's viewpoint
J. Clin. Pathol.,
March 1, 2002;
55(3):
162 - 176.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Marafioti, M. Hummel, I. Anagnostopoulos, H.-D. Foss, D. Huhn, and H. Stein
Classical Hodgkin's Disease and Follicular Lymphoma Originating From the Same Germinal Center B Cell
J. Clin. Oncol.,
December 1, 1999;
17(12):
3804 - 3809.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Abstract
Introduction
Abstract