|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 91 No. 5 (March 1), 1998:
pp. 1802-1809
Inverse Targeting of Retroviral Vectors: Selective Gene Transfer in a
Mixed Population of Hematopoietic and Nonhematopoietic Cells
By
Adele K. Fielding,
Marielle Maurice,
Frances J. Morling,
François-Löic Cosset, and
Stephen J. Russell
From the Cambridge Centre for Protein Engineering and Cambridge
University Dept Haematology, MRC Centre, Cambridge, UK; and the Centre
Genetique Moleculaire et Cellulaire, CNRS UMR 5534, Université
Claude-Bernard Lyon-1, Villeurbanne Cedex, France.
 |
ABSTRACT |
We previously reported that retroviral vectors displaying epidermal
growth factor (EGF) as part of a chimeric envelope glycoprotein are
sequestered upon binding to EGF receptor (EGFR)-positive target cells,
leading to loss of infectivity. In the current study, we have displayed
stem cell factor (SCF) on  -galactosidase-transducing ecotropic and amphotropic retroviral vector particles as a factor Xa
protease-cleavable N-terminal extension of the envelope glycoprotein. Viral incorporation of the SCF chimeric envelopes was demonstrated by
immunoblotting of pelleted virions and their specific attachment to Kit
receptors was demonstrated by flow cytometry. Gene transfer studies
showed that when SCF was displayed on an amphotropic envelope, the
infectivity of the SCF-displaying vectors was selectively inhibited on
Kit-expressing cells, but could be restored by adding soluble SCF to
block the Kit receptors or by cleaving the displayed SCF domain from
the vector particles with factor Xa protease. The host range properties
of EGF-displaying and SCF-displaying vectors were then compared in cell
mixing experiments. When EGFR-positive cancer cells and Kit-positive
hematopoietic cells were mixed and exposed to the different engineered
vector particles, the cancer cells were selectively transduced by the
SCF-displaying vector and the hematopoietic cells were selectively
transduced by the EGF-displaying vector. Retroviral display of
polypeptide growth factors can therefore provide the basis for a novel
inverse targeting strategy with potential use for selective
transduction of hematopoietic or nonhematopoietic cells (eg, cancer
cells) in a mixed cell population.
| |
INTRODUCTION |
PLURIPOTENT hematopoietic stem cells
(HSC) are attractive targets for gene therapy of a wide variety of
hereditary and acquired disorders and several studies have shown that
committed human hematopoietic progenitor cells can be efficiently
transduced by retroviral vectors in ex vivo transduction
protocols.1-4 However, long-term follow-up of patients who
have been reconstituted with genetically marked progenitor cells shows
that pluripotent HSC are highly resistant to retroviral
transduction,5-7 in part because their relative
quiescence8 makes them relatively resistant to retroviral
transduction9 and in part because the cell surface density
of amphotropic retroviral receptors on human HSC is very low.10 A major deficiency of current retroviral vectors is
that they lack specificity for particular target cell types and are therefore unsuitable for protocols requiring selectivity of gene transfer to HSCs in mixed cell populations. Thus, vector targeting is
highly desirable for certain ex vivo stem cell gene therapy protocols
and will be a prerequisite for the more distant goal of in vivo
transduction of mitotically active HSCs.
Murine leukemia virus (MLV)-based vectors are the most common
retroviral vectors in clinical use. Their host range is determined by
their envelope glycoproteins, which mediate attachment to specific receptors on target cells. The N-terminal domain of the surface (SU)
glycoprotein confers receptor specificity and and exhibits a high
degree of conservation between MLVs with different host ranges.11 The Moloney (Mo) MLV envelope binds to a murine
cationic amino acid transporter Rec-1 and has an ecotropic host range
infecting only mouse cells.12 The amphotropic or 4070A MLV
envelope binds to a ubiquitous phosphate transporter
RAM-1, which is conserved throughout many mammalian
species.13 It thus infects both human and murine cells.
Towards the goal of targeting MLV-based vectors, we previously
described a strategy for the display of polypeptide binding domains on
retroviral vectors as N-terminal extensions of their envelope SU
glycoproteins.14 Subsequent work has shown that various
chimeric envelopes can be efficiently incorporated into retroviral
vector particles and that vector attachment can be redirected via the
displayed binding domains.15-17 However, such redirected
vectors do not always result in gene transfer. The choice of receptor
through which vectors are targeted has been shown to be an important
determinant of gene transfer efficiency following redirected
attachment. Ecotropic vectors displaying a domain that targeted their
attachment to the amphotropic retrovirus receptor (RAM-1) gave a
relatively high efficiency of targeted gene transfer on human
cells,17 whereas ecotropic vectors displaying antibodies to
the CD3 complex, or to various antigens on human colonic cells, gave a
very low efficiency of gene delivery to the targeted
cells.16 In addition, it was found that amphotropic vectors
incorporating chimeric envelopes in which epidermal growth factor (EGF)
was the displayed domain were able to actively and selectively
interfere with gene delivery to EGF receptor-positive cells.15,18 Thus, the EGF-displaying vectors gave very low efficiency of gene transfer to EGF receptor-positive cells, but were
fully infectious on EGF receptor-negative cells.
In the current study, we sought to determine whether stem cell factor
(SCF), a large glycosylated growth factor domain that recognizes a
receptor present on HSC, could be displayed on retroviral vectors and
to determine what influence this would have on the host range
properties of the chimeric vector particles. The SCF receptor, Kit, is
a tyrosine kinase receptor, which is known to be expressed on
hematopoietic progenitor cells,19 and plays an important
role in hematopoietic cell biology. Kit is therefore a potentially
suitable receptor target for selective stem cell transduction. SCF
exists as both soluble and membrane bound forms and binds to the Kit
receptor with an affinity variously reported to be between 27 and 240 picomolar.20,21 The soluble form is released from the 248 amino acid membrane anchored species by proteolytic cleavage to yield a
165 amino acid glycosylated extracellular domain,22-24
which has an approximate serum concentration of 3.4 ng/mL.25
We therefore generated chimeric envelopes in which SCF was fused to the
SU glycoproteins of the ecotropic Mo MLV whose receptor is absent on
human cells and to the amphotropic 4070A MLV, which promiscuously
infects both murine and human cells. Our results show that, like EGF, a
virally displayed SCF domain can actively and selectively interfere
with gene transfer on Kit receptor-positive cells. We therefore
performed cell mixing experiments to determine whether
receptor-mediated sequestration of vector particles displaying EGF or
SCF could provide the basis for a novel `inverse' targeting strategy
to achieve selective transduction of receptor-negative target cells in
a mixed cell population.
| |
MATERIALS AND METHODS |
Construction of chimeric envelope expression plasmids.
The unmodified envelopes of 4070A MLV and MoMLV were encoded by the
expression plasmids FB4070ASALF and FBMoSALF.15 Plasmids were constructed encoding chimeric envelopes in which SCF was fused to
the first codon of the Moloney (ecotropic) and 4070A (amphotropic) MLV
SU envelope glycoproteins by a factor Xa cleavable linker. The
construct SCFXA was derived from the construct EXA, in which EGF is
fused to amino acid +1 of the 4070A MLV SU by a linker consisting of
three alanines (Not 1 site ) or three alanines and the IEGR
factor Xa cleavage site.18 The cDNA coding for the
extracellular domain of SCF was polymerase chain reaction (PCR)
amplified and tailed with Sfi 1 and Not 1 restriction
sites using primers SCFforNot and SCFbackSfi. The PCR products were cloned into EXA after digestion with the restriction enzymes Sfi 1 and Not 1.
The construct SCFXMo was derived from the EXMo,17 in which
EGF is fused to amino acid +1 of the MoMLV SU, also by a Not 1 site and the IEGR (single-letter amino acid code) factor
Xa cleavage signal. The cDNA coding for the extracellular domain of SCF
was PCR amplified and tailed with Sfi 1 and Not 1 restriction sites using primers SCFforNot and SCFbackSfi. The PCR
products were cloned into EXMo after digestion with the restriction
enzymes Sfi 1 and Not 1. The sequences of the
portions of constructs generated by PCR were confirmed between the
Sfi 1 and Not 1 sites by dideoxysequencing. Oligonucleotides used were as follows (with restriction enzyme sites
underlined) SCFforNot:
GCAAATCTGCGGCCGCGTGTAGGCTGGAGTCTCCAGG; SCFBackSfi:
GTCCATGCGGCCCAGCCGGCCGAAGGGATGCAGGAATCG.
Production of viruses.
The chimeric envelope and control (Mo and 4070A) envelope expression
constructs were expressed in TELCeB.6 complementing cells, which
express MLV gag-pol core particles and a nlsLacZ retroviral vector.26 Envelope expression plasmids were transfected by
calcium phosphate coprecipitation into the TELCeB.6
cells.27 Transfected cells were selected with phleomycin
(50 µg/mL) and stable transfectants were expanded and pooled. Cells
were grown in Dulbecco's modified Eagle's medium (DMEM)
supplemented with 10% fetal calf serum (FCS). Viral supernatants were
harvested after overnight incubation in either serum-free DMEM or DMEM
containing 10% FCS and filtered with a 0.45 µm filter for immediate
use in infection or binding experiments. For immunoblotting, viral
supernatants were filtered (0.45 µm) and then pelleted by
ultracentrifugation at 30,000 rpm in a SW40 rotor (Beckman, Palo Alto,
CA) for 1 hour at 4°C. The pelleted viral particles were
resuspended in 100 µL of phosphate-buffered saline (PBS) and stored
at  20°C.
Target cells.
The murine cell line NIH 3T3 and the human (Kit-negative) cell line
A431 were grown in DMEM supplemented with 10% FCS. The human SCF
receptor (Kit)-expressing cell line HMC-1, kindly provided by Dr J.H.
Butterfield,28 was grown in Iscove's modified Dulbecco's Eagle medium (IMDM) supplemented with 10% FCS and monothioglycerol. Jurkat (Kit-negative ) cells were grown in RPMI supplemented with 10%
FCS. TF-1 (Kit-positive) human cells were grown in RPMI supplemented with 10% FCS and 1 ng/mL recombinant human granulocyte-macrophage colony-stimulating factor (rHuGM-CSF). The Kit receptor
status of all cell lines had been previously
determined29,30 and was verified using
fluorescence-activated cell sorting (FACS) analysis with
an anti-Kit antibody (Sigma Biosciences, St Loius, MO) and a secondary
antimouse fluorescein isothiocyanate (FITC)-conjugated IgG
(Santa Cruz Biotechnology, Santa Cruz, CA).
Immunoblots.
Ten microlitres of the pelleted viral particles was separated on a 10%
polyacrylamide gel under reducing conditions and subsequently transferred onto nitrocellulose. For demonstration of factor Xa cleavage, 10 µL of the pelleted virus was incubated with 4 µg/mL of
factor Xa protease (New England Biolabs, Beverly, MA) in the presence
of 2.5 mmol/L CaCl2. The viral SU proteins were detected using a first layer goat antienvelope antiserum raised against Rausher
murine leukemia virus envelope glycoproteins (Quality Biotech, Camden,
NJ). Blots were developed using a secondary rabbit antigoat antibody
conjugated to horseradish peroxidase (Dako, Glostrup, Denmark) and an
enhanced chemiluminesence kit (Amersham Life Science, Bucks, UK).
Infections.
Target cells were plated into six-well plates at approximately
105 cells per well and incubated overnight at 37°C
(adherent cells) or plated into six-well plates at approximately
106 cells per well 1 hour before infection (suspension
cells). Filtered viral supernatant in serum-free medium was added to
the target cells and incubated for 2 to 4 hours in the presence of 8 µg/mL polybrene.
The retroviral supernatant was then removed from the target cells, the
medium was replaced with the usual medium, and the cells were placed at
37°C for a further 48 to 72 hours. X gal staining for detection of
-galactosidase activity was performed as previously
described.31 Viral titer was calculated by counting blue
stained colonies microscopically and expressed as enzyme-forming units
per mL for the adherent cells. For suspension cells, 300 to 500 individual cells were counted and the percentage of blue stained
cells was calculated. For infections involving factor Xa cleavage, the
virus was incubated with 4 µg/mL of factor Xa protease in the
presence of 2.5 mmol/L CaCl2 for 90 minutes before infection. The competition experiments were performed as above after
preincubation of the target cells for 2 hours at 37°C with 100 nmol/L rHuSCF (Amgen, Thousand Oaks, CA, a kind gift from Stephen
Devereux, University College, London, UK).
Binding assays.
Target cells were washed with 2% bovine serum albumin (BSA)/PBS and
aliquots of approximately 106 cells were incubated with
viral supernatant at 32°C for 45 minutes. The cells were then
washed again and incubated with 100 µL of 83A25 monoclonal anti-SU
antibody32 at 4°C for 45 minutes. After a further wash,
dichlorotriazinyl amino fluorescein (DTAF)-conjugated affinity purified
F(ab)2 fragment goat antirat IgG (Immunotech, Marseille,
France) was added and the incubation continued at 4°C. Cells were
counterstained with 10 µg/mL propidium iodide 1 to 2 minutes before
the final washes. Fluorescence of live cells was analyzed using a
fluorescent-activated cell sorter (FACSCalibur or FACScan; Becton
Dickinson, San Jose, CA).
| |
RESULTS |
SCF chimeric envelope expression constructs were made in which a cDNA
coding for the extracellular portion (165 aa) of human SCF was fused to
the amino terminal codon of both the Moloney and 4070A MLV envelope
glycoproteins via a factor Xa cleavable linker
(Fig 1). For incorporation into
-galactosidase transducing retroviral vectors particles,
the chimeric envelope expression constructs and control Moloney and
4070A unmodified envelope expression constructs were stably transfected
into the TELCeB6 complementing cell line. Phleomycin-resistant colonies
were pooled and the pooled transfectants were used as a source of
vector for subsequent analysis.
View larger version (10K):
[in this window]
[in a new window]
| Fig 1.
The chimeric envelope expression constructs. Plasmid
constructs encoding SCFXMo and SCFXA. The general format is shown
diagrammatically and the amino acid sequence surrounding the site of
fusion between the displayed ligand and the envelope protein is shown
in detail. LTR, long terminal repeat; L, envelope signal peptide;
phleor, phleomycin resistance gene. The Sfi 1 and
Not 1 cloning sites are shown.
|
|
The SCF chimeric envelopes are incorporated into retroviral vector
particles and are susceptible to factor Xa cleavage.
Viral supernatant was harvested from confluent plates of pooled TELCeB6
transfectants and pelleted viral particles were immunoblotted. Figure 2 shows that the chimeric envelopes
were incorporated into virions and that their mobility on the
immunoblot was retarded relative to that of the wild-type envelope
glycoproteins. Chimeric envelope incorporation into virions is reduced
approximately 10-fold compared with the wild-type envelope
incorporation. Upon factor Xa cleavage of the pelleted virions, the
mobility of the chimeric envelopes SCFXMo and SCFXA become
indistinguishable from the mobility of the unmodified Moloney and 4070A
envelope glycoproteins. Thus, the FXa signals in the interdomain
linkers of SCFXMo and SCFXA are correctly recognized and cleaved by
factor Xa.
View larger version (46K):
[in this window]
[in a new window]
| Fig 2.
Immunoblotting shows that the chimeric envelopes are
incorporated into retroviral vector particles and are susceptible to factor Xa cleavage. Vectors incorporating the SCF-Moloney and SCF-4070A
chimeric envelopes were pelleted by ultracentrifugation and subjected
to denaturing sodium dodecyl sulfate (SDS)-polyacrylamide gel
electrophoresis. Vectors incorporating the wild-type Moloney and 4070A
envelopes were used as a control. After transfer to nitrocellulose, the
blots were probed with an anti-SU antiserum and developed using
enhanced chemiluminescense. The mobility of the chimeric envelopes is
retarded relative to that of the unmodified Moloney and 4070A envelope
glycoproteins, but becomes indistinguishable from them upon factor Xa
cleavage.
|
|
The SCF-Moloney chimeric envelope binds to the SCF receptor, Kit.
To determine if the chimeric envelopes could bind to Kit, SU binding
assays were performed by FACS analysis. The wild-type 4070A SU was
capable of binding to both Kit-positive and Kit-negative human cells
and was used as a positive control. The Kit receptor status of all cell
lines was verified using FACS analysis with an anti-Kit antibody (Santa
Cruz Biotechnology) and a secondary antimouse FITC-conjugated IgG
(Sigma, Poole, UK), data not shown. As expected, the wild-type Moloney
ecotropic SU did not bind to any of the human cells tested, whereas
SCFXMo SU was able to bind to Kit-positive, but not to Kit-negative
human cells (Fig 3). To confirm the
specificity of binding, the target cells were preincubated with 100 nmol/L SCF for 30 minutes and the subsequent viral binding step was
performed in the presence of SCF. Under these conditions, the binding
of SCFXMo SU was competitively inhibited (Fig 3). Thus, the Moloney SCF
chimeric SU glycoproteins are capable of specific binding to Kit.
View larger version (21K):
[in this window]
[in a new window]
| Fig 3.
The SCF-Moloney chimeric envelope binds to the SCF
receptor, Kit. Binding assays were performed on both Kit-positive
(HMC-1) and Kit-negative (Jurkat) human cell lines using unmodified
Moloney and 4070A envelopes and the SCFXMo chimeric envelope. The fine line represents Moloney binding (negative control), the dashed line,
4070A binding (positive control), the thick line, SCFXMo binding, and
the dotted line, SCFXMo binding in the presence of exogenous rHuSCF.
SCFXMo binds only to the Kit-positive cell line and the binding is
competitively inhibited by the addition of rHuSCF.
|
|
The SCF-Moloney chimeras retain the ability to infect mouse cells,
but are unable to infect Kit-positive or Kit-negative human cells.
The vectors were titrated on murine NIH3T3 cells and on human
Kit-positive (HMC-1 and TF-1) and Kit-negative (A431) cells. Vectors
incorporating the SCFXMo chimeric envelopes gave a titer of 2.4 × 106 cfu/mL on NIH3T3 cells. This was slightly lower than
the titer of 7.2 × 106 cfu/mL seen with the vectors
incorporating unmodified Moloney envelope, in keeping with the reduced
envelope incorporation. Vectors incorporating the SCFXMo chimeric
envelopes did not infect human Kit-positive cells; there was
no detectable -galactosidase gene transfer when HMC-1
cells were infected with 1 mL of SCFXMo viral supernatant. Thus,
retroviral vectors displaying SCF as an extension of the Moloney
envelope glycoprotein are able to bind to human Kit, but subsequent
steps in the virus entry pathway are not permitted.
Amphotropic vectors displaying SCF are competitively sequestered by
Kit receptors on Kit-expressing cells.
The host-range properties of the amphotropic vectors incorporating the
chimeric envelope SCFXA were then tested on Kit-expressing and
nonexpressing cell lines. The EXA and wild-type 4070A vectors were used
as controls. The titer of SCFXA was greatly reduced compared with EXA
and 4070A on the Kit-positive cell lines HMC-1 and TF-1. All of these
vectors were then treated with factor Xa protease to cleave off the
displayed binding domains before infection. Preincubation with 4 µg/mL FXa had no effect on the titer of the EXA or wild-type vectors,
but restored the titer of SCFXA towards that of the wild-type vector on
the Kit-positive cell lines. The titer of SCFXA was unaffected by
factor Xa cleavage on the Kit-negative cell lines. These data show that
infectivity of the SCFXA vector on Kit-positive cells is blocked by the
display of SCF and can be restored by cleavage of the displayed domain
(Table 1).
We then investigated the specificity of this block to infectivity on
Kit-positive cells by retroviral display of SCF. If binding of the
vector particles via the displayed domain prevents infection, the
addition of exogenous SCF at the time of infection would be expected to
restore infectivity by introducing competition with the vector
particles for binding to Kit. Vector binding to Ram-1 will be favored
under these conditions, thus enhancing infection and gene delivery.
Infection experiments were therefore performed in the presence of
soluble SCF as competitor. Kit-positive cells were preincubated with
100 nmol/L rHuSCF (Amgen, a kind gift from Stephen Devereux) for 2 hours before performing the infections with SCFXA1 and 4070A wild-type
virus, as previously described. The infectivity of the SCFXA chimera
was increased fivefold on HMC-1 cells and 11-fold on TF-1 cells
(Fig 4). No increase in infectivity was
seen with the wild-type control vectors. This indicates that the
reduced ability of the chimeric vectors to infect Kit-positive cells is
a consequence of targeted binding to SCF receptors.
View larger version (24K):
[in this window]
[in a new window]
| Fig 4.
The infectivity of vectors incorporating SCFXA chimeric
envelopes is increased by the addition of exogenous rHuSCF. Infection of two different Kit-positive cells lines was performed in the presence
of 100 nmol/L SCF. There was no change in the titer of wild-type 4070A
vectors, but the titer of the vectors incorporating SCFXA chimeric
envelopes increased fivefold on HMC-1 cells and 11-fold on TF-1 cells.
The plain bars represent the background level of infectivity and the
striped bars represent the fold increase in titer on addition of SCF.
|
|
Inverse targeting by SCF and EGF displaying retroviruses.
To determine whether EGF and SCF displaying vectors are capable of
discriminating between receptor-positive and receptor-negative cell
types in a cell mixture, cell mixing experiments were performed. Two
milliliters of EXA, SCFXA, or 4070A viral supernatant was used to
infect a mixed population of adherent A431 cells (kit-negative, EGF-R-positive) and either HMC-1 or TF-1 suspension cells
(kit-positive, EGF-R-negative). After infection, the cells were
separated and propagated in their respective media for 72 hours before
X-gal staining. Infection with the wild-type control vector gave high titers on both cell types with 100% of the EGF-R-positive,
kit-negative A431 cells being infected and 52% or 51% of the
kit-positive, EGF-R-negative TF-1, or HMC-1 cells, respectively. In
contrast, the chimeric vectors could efficiently discriminate between
the different cell types as shown by the big difference between the cell types in the percentage of cells infected. The SCFXA vector preferentially infected the Kit-negative A431 cells, infecting 50% of
the A431 cells, but only 3.6% and 4.3% of the TF-1 and HMC-1 cells,
respectively, whereas EXA vectors preferentially infected the
EGF-R-negative TF-1 or HMC-1 cells (42% and 37%, respectively), but
infected less than 1% of the A431 cells. These data show that EXA and
SCFXA vectors can be used to target diferent cell types in a cell
mixing experiment. Pooled data showing the average percentage of cells
infected from three separate experiments are shown in
Table 2. A photomicrgraph of a
representative experiment is shown in Fig
5.
View larger version (77K):
[in this window]
[in a new window]
| Fig 5.
Inverse targeting by SCF and EGF displaying retroviruses.
When a mixed population of A431 (Kit-negative, EGF-R-positive) and TF-1 cells (Kit-positive, EGF-R-negative) was infected by vectors incorporating either the SCFXA or the EXA chimeric envelopes, the SCFXA
vectors preferentially infected the Kit-negative cells and the EXA
vectors preferentially infected the EGF-R-negative cells. A
photomicrograph of a representative experiment is shown here. Upon
X-gal staining, infected cells turn blue.
|
|
| |
DISCUSSION |
We have shown that SCF can be displayed on retroviral vector particles
as an N-terminal extension of the Moloney (ecotropic) and 4070A
(amphotropic) MLV SU glycoproteins. The MLV envelope glycoproteins are
incorporated into virions as a homotrimeric complex,33,34
whereas, at least at high concentrations, soluble SCF exists as a
glycosylated noncovalently associated dimer.35 Theoretically, dimerization of an N-terminal SCF domain on the chimeric
MLV envelopes might be expected to interfere with trimer assembly,
leading to protein aggregation in the endoplasmic reticulum, failure of
transport to the cell surface, and reduced incorporation into the
vector particles. However, at physiologic concentrations, SCF dimers
are known to dissociate such that the majority of circulating SCF is
probably in monomeric form.36 In the current study, the SCF
chimeric envelopes were incorporated into virions with approximately 10-fold reduced efficiency compared with the incorporation of wild-type
unmodified envelopes. However, we have no direct evidence that the
virally displayed SCF domains are associating into dimers at the tips
of the envelope glycoprotein subunits on which they are displayed, and
we have observed a similar reduction in the efficiency of viral
incorporation of chimeric envelopes displaying an N-terminal
interleukin-2 (IL-2) domain, which is of a similar size to SCF, but is
not known to be capable of dimer formation (A.K. Fielding, F.J.
Morling, and S.J. Russell, unpublished data, September
1995).
The extracellular domain of SCF is a large (165 amino acid) heavily
glycosylated structure, which might be expected to interfere with the
ability of the N-terminal domain of the underlying viral SU
glycoprotein (to which it is grafted) to bind to its specific receptor.
NIH3T3 cells express Rec-1 (ecotropic) and RAM-1 (amphotropic) receptors, but do not express Kit receptors. Therefore, infectivity on
NIH3T3 cells reflects the interaction (attachment and fusion triggering) between the chimeric envelopes and the natural virus receptors. It is therefore notable that the vectors incorporating the
SCF chimeric envelopes (SCFXA and SCFXMo) retain their capacity to
infect NIH3T3 cells. Although they show slightly reduced infectious titers on these cells compared with wild-type controls, these reductions in titer are fully in keeping with the reduced levels of SCF
chimeric envelope incorporation in the vector particles. This suggests
that the displayed SCF in the chimeric envelopes does not strongly
hinder attachment of the MLVs to their natural receptors, or interfere
with subsequent fusion triggering. Nevertheless, a small part of the
reduction in titer on NIH3T3 is probably due to a weak steric blocking
effect because there was a slight (twofold) increase in infectious
titer on these cells when the displayed SCF domain was first cleaved
from the vector particles by factor Xa protease.
Our results show that the retrovirally displayed SCF domains can bind
specifically to Kit receptors, but that this does not lead to efficient
gene delivery into Kit-expressing cells. Thus, vector particles
incorporating SCFXMo chimeric envelopes could bind to Kit receptors on
human cells, but this did not lead to detectable transfer of the
-galactosidase gene. This result is fully consistent with previous
experiments from several laboratories that have reported very low
infectivity of ecotropic vectors, which have been retargeted to
different human cell surface receptors.37-43
The results obtained with the amphotropic 4070A-SCF chimeric envelope
show that, in the same way that EGF-displaying vectors are actively
sequestered away from their entry pathway by binding to EGF receptors
on EGF receptor-positive cells,18 SCF-displaying viruses
are sequestered by SCF receptors on Kit-expressing cells. The SCFXA
vectors could readily infect Kit-negative human cells, but gave greatly
reduced titers on Kit-positive human cells, unless the displayed SCF
domain was first cleaved from the vector particles using factor Xa
protease. Moreover, their infectivity on the Kit-expressing cells was
greatly enhanced when soluble SCF was added to the culture medium at
the time of infection, indicating that the chimeric vector particles
were being actively sequestered by the Kit receptors.
This is the first study to show that a displayed growth factor domain
other than EGF can actively inhibit retrovirus infectivity by a
receptor-dependent mechanism. It will be interesting to determine whether receptor-mediated sequestration of ligand-displaying retroviral vectors can be mediated by other tyrosine kinase growth factor receptors or by other classes of cell surface receptor. These experiments are ongoing.
Receptor-mediated sequestration of ligand-displaying retroviral vectors
can provide the basis for a novel inverse targeting strategy allowing
selective transduction of receptor-negative cells (or nontransduction
of receptor-positive cells) in a mixed cell population. The cell mixing
experiments presented in this study convincingly show the feasibility
of the inverse targeting strategy. When the SCF-displaying vector was
used to infect a mixture of carcinoma cells and hematopoietic cells,
the Kit-negative carcinoma cells were efficiently transduced, whereas
the Kit-positive hematopoietic cells were very poorly transduced (Table
2). Conversely, when the EGF-displaying vector was used to infect the
same cell mixture, the hematopoietic cells (which lack EGF receptors)
were efficiently transduced, whereas the EGF receptor-positive
carcinoma cells were hardly infected at all.
Inverse targeting can now be added to a growing list of retroviral
targeting strategies. The classical approach is to extend the host
range of vectors that do not naturally bind to human cells by domain
substitution.37-40,42 Indeed, when
erythropoietin37 or a single chain variable fragment
against the low-density lipoprotein receptor41 were
displayed on the Moloney MLV envelope and coincorporated into
retroviral particles with unmodified envelopes, targeted entry to human
cells was observed. Although these studies establish the principle of
targeting, the very low titers seen abrogate the use of this approach
for clinical applications. A recent attempt to target gene transfer to
Kit-positive cells using a plasmid DNA vector conjugated to SCF also
showed a small transient increase in reporter gene activity over a
control vector in the Kit-positive cells.44 Unlike targeted
retroviral vectors, entry into the endosomal pathway is the predominant
route for these vectors to enter the cell. For retroviral vectors,
entry into the endosomal pathway probably reduces the likelihood of
viral fusion with the cell membrane and hence leads to failure to
infect the cell. Molecular conjugate vectors however remain unsuitable
for applications involving HSC, as they do not permit integration of a
therapeutic gene into the cellular DNA. An alternative approach using
retroviral vectors has been to generate protease-activatable vectors
whose infectivity is dependent on the presence of a specific
protease.18,45,46 In contrast to these previously described
targeting strategies, inverse targeting is ideally suited to protocols
in which it is important to avoid infecting a specific population of
cells (see below).
The strength of the use of EGF-displaying retroviruses for `inverse
targeting' of hematopoietic cells lies in the fact that EGF receptors
are widely expressed on many different cell types. A high-density of
EGF receptors has been found on many nonhematologic malignancies,47 but there are no EGF receptors on
hematopoietic cells.48 EGF displaying retroviral vectors
will be preferable to the nontargeted vectors that are currently being
used in clinical studies for the transduction of hematopoietic stem
cells with chemotherapy resistance genes such as the multiple drug
resistance-1 (MDR-1) gene.1,49 In this strategy, a drug
resistance gene is introduced into HSCs of patients undergoing
high-dose therapy with stem cell rescue for the treatment of
malignancy. After engraftment, it is envisaged that the transduced
hematopoietic cells will have increased resistance to cytotoxic
chemotherapy, allowing multiple cycles of intensive therapy to be
delivered with minimal myelotoxicity to patients with chemosensitive
tumors, such as carcinoma of the breast. A major weakness in the
approach is that, even in patients with no overt evidence of bone marow
involvment by tumor, it has been shown that bone marrow and peripheral
blood stem cell harvests may be contaminated by malignant
cells.50,51 Avoidance of transduction of contaminating
tumor cells with the MDR-1 gene is clearly desirable and, for EGF
receptor-positive solid tumors such as breast carcinoma, might
conveniently be achieved by using an EGF-displaying vector.
Similarly, vectors incorporating SCF chimeric envelopes may find
application in situations where it is desirable to transduce Kit-negative tumor cells, eg, with `suicide genes' such as the HSV-TK
gene52 and avoid transduction of hematopoietic stem cells.
| |
FOOTNOTES |
Submitted August 6, 1997;
accepted October 20, 1997.
Supported by the Leukaemia Research Fund of Great Britain (London, UK)
and by the Medical Research Council (London, UK).
Address reprint requests to Stephen J. Russell, MD, Centre
for Protein Engineering, MRC Centre, Hills Rd, Cambridge CB2 2QH, UK.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. section 1734 solely to indicate this fact.
| |
ACKNOWLEDGMENT |
We thank Dr C. Casimir for the SCF cDNA and the TF-1 cell line, Dr S. Devereux and Amgen UK for the rHuSCF, Dr J.H. Butterfield for the HMC-1
cell line, and Dr L. Evans for the 83A25 monoclonal antibody-producing
cell line.
| |
REFERENCES |
1.
Ward M,
Richardson C,
Pioli P,
Smith L,
Podda S,
Goff S,
Hesdorffer C,
Bank A:
Transfer and expression of the human multiple drug resistance gene in human CD34+ cells.
Blood
84:1408,
1994[Abstract/Free Full Text]
2.
Begni M,
Magni M,
Siena S,
DiNicola M,
Bonnadonna G,
Gianni AM:
Human peripheral blood hematopoietic progenitors are optimal targets of retroviral-mediated gene transfer.
Blood
80:1418,
1992[Abstract/Free Full Text]
3.
Dick JE,
Kamel-Reid S,
Murdoch B,
Deodnes M:
Gene transfer into normal human hematopoietic stem cells using in vitro and in vivo assays.
Blood
78:624,
1991[Abstract/Free Full Text]
4.
Hughes PF,
Thacker JD,
Hogge D,
Sutherland HJ,
Thomas TE,
Lansdorp PM,
Eaves CJ,
Humphries RK:
Retroviral gene transfer to primitive normal and leukaemic hematopoietic cells using clinically applicable procedures.
J Clin Invest
89:1817,
1992
5.
Brenner MK,
Rill DR,
Holladay MS,
Heslop HE,
Moen RC,
Buschle M,
Krance RA,
Santana VM,
Anderson WF,
Ihle JN:
Gene marking to determine whether autologous marrow infusion restores long-term haemopoiesis in cancer patients.
Lancet
342:1134,
1994
6.
Deisseroth AB,
Zu Z,
Claxton D,
Hanania EG,
Fu S,
Ellerson D,
Goldberg L,
Thomas M,
Janicek K,
Anderson WF:
Genetic marking shows that Ph+ cells present in autologous transplants of chronic myelogenous leukemia (CML) contribute to relapse after autologous bone marrow in CML.
Blood
83:3068,
1994[Abstract/Free Full Text]
7.
Dunbar CE,
Cottler-Fox M,
O'Shaughnessy JA,
Doren S,
Carter C,
Berenson R,
Brown S,
Moen R,
Greenblatt J,
Stewart M,
Leitman SF,
Wilson WH,
Cowan K,
Young NS,
Nienhuis AW:
Retrovirally marked CD34 enriched peripheral blood and bone marrow cells contribute to long term engraftment after autologous transplant.
Blood
85:3048,
1995[Abstract/Free Full Text]
8.
Berardi AC,
Wang A,
Levine JD,
Lopez P,
Scadden DT:
Functional isolation and characterisation of human hematopoietic stem cells.
Science
267:104,
1995[Abstract/Free Full Text]
9.
Miller DG,
Adam MA,
Miller AD:
Gene transfer by retrovirus vectors occurs only in cells that are actively replicating at the time of infection.
Mol Cell Biol
10:4239,
1990[Abstract/Free Full Text]
10.
Orlic D,
Girard LJ,
Jordan CT,
Anderson SM,
Cline AP,
Bodine DM:
The level of mRNA encoding the amphotropic retrovirus receptor in mouse and human hematopoietic stem cells is low and correlates with the efficiency of retrovirus transduction.
Proc Natl Acad Sci USA
93:11097,
1996[Abstract/Free Full Text]
11.
Battini JL,
Heard JM,
Danos O:
Receptor choice determinants in the envelope glycoproteins of amphotropic, xenotropic, and polytropic murine leukemia viruses.
J Virol
66:1468,
1992[Abstract/Free Full Text]
12.
Albritton LM,
Tseng L,
Scadden D,
Cunningham JM:
Envelope binding domain in the cationic amino acid transporter determines the host range of ecotropic murine retroviruses.
J Virol
67:2091,
1993[Abstract/Free Full Text]
13.
Kavanagh MP,
Miller DG,
Zhang W,
Law W,
Kozak SL,
Kabat D,
Miller AD:
Cell surface receptors for gibbon ape leukaemia virus and amphotropic murine retrovirus are inducible sodium dependent phosphate symporters.
Proc Natl Acad Sci USA
91:7071,
1994[Abstract/Free Full Text]
14.
Russell SJ,
Hawkins RE,
Winter G:
Retroviral vectors displaying functional antibody fragments.
Nucleic Acids Res
21:1081,
1993[Abstract/Free Full Text]
15.
Cosset FL,
Morling FJ,
Takeuchi Y,
Weiss RA,
Collins MKL,
Russell SJ:
Retroviral retargeting by envelopes expressing an N-terminal binding domain.
J Virol
69:6314,
1995[Abstract]
16.
Ager S,
Nilson BHK,
Morling FJ,
Peng KW,
Cosset F-L,
Russell SJ:
Retroviral display of antibody fragments: Interdomain spacing strongly influences vector infectivity.
Hum Gene Ther
7:2157,
1996[Medline]
[Order article via Infotrieve]
17.
Valsesia-Wittman S,
Morling FJ,
Nilson BHK,
Takeuchi Y,
Russell SJ,
Cosset F-L:
Improvment of retroviral re-targeting by using amino acid spacers between an additional binding domain and the N terminus of Moloney murine leukaemia virus SU.
J Virol
70:2059,
1996[Abstract]
18.
Nilson BHK,
Morling FJ,
Cosset FL,
Russell SJ:
Targeting of retroviral vectors by protease-substrate interactions.
Gene Ther
3:280,
1996[Medline]
[Order article via Infotrieve]
19.
Ogawa M,
Matsuzaki Y,
Nishikawa S,
Hayashi SI,
Kunisada T,
Sudo T,
Kina T,
Nakauchi H,
Nishikawa SI:
Expression and function of c-kit in hemopoietic progenitor cells.
J Exp Med
74:63,
1991
20.
Abkowitz JL,
Broudy VC,
Bennett LG,
Zsebo KM,
Martin FH:
Absence of abnormalities of c-kit or its ligand in two patients with Diamond-Blackfan anaemia.
Blood
79:25,
1992[Abstract/Free Full Text]
21.
Turner AM,
Zsebo KM,
Martin F,
Jacobsen FW,
Bennett LG,
Broudy VC:
Nonhematpoietic cell lines express stem cell factor and display c-kit receptors.
Blood
80:374,
1992[Abstract/Free Full Text]
22.
Flanagan G,
Chan DC,
Leder P:
Transmembrane form of the kit ligand growth factor is determined by alternative splicing and is missing in the Sld mutant.
Cell
64:1025,
1991[Medline]
[Order article via Infotrieve]
23.
Toksoz D,
Zsebo KM,
Smith KA,
Hu S,
Brankow D,
Suggs SV,
Martin FH,
Williams DA:
Support of human hematopoiesis in long-term bone marrow cultures by murine stromal cells selectively expressing the membrane-bound and secreted forms of the human homolog of the steel gene product, stem cell factor.
Proc Natl Acad Sci USA
89:7350,
1992[Abstract/Free Full Text]
24.
Lu HS,
Clogston CL,
Wypych J,
Parker VP,
Lee TD,
Swiderek K,
Baltera RF Jr,
Patel AC,
Chang DC,
Brankow DW:
Post-translational processing of membrane-associated recombinant human stem cell factor expressed in Chinese hamster ovary cells.
Arch Biochem Biophys
298:150,
1992[Medline]
[Order article via Infotrieve]
25.
Langley KE,
Bennett LG,
Wypuch J,
Yancik SA,
Liu XD,
Wesdtcott KR,
Chang DG,
Smith KA,
Zsebo KM:
Soluble stem cell factor in human serum.
Blood
81:656,
1993[Abstract/Free Full Text]
26.
Cosset F-L,
Takeuchi Y,
Battini J-L,
Weiss RA,
Collins MLK:
High titre cells producing recombinant retroviruses resistant to human serum.
J Virol
69:7430,
1995[Abstract]
27. Sambrook J, Fritsch EF, Maniatis T: Molecular Cloning: A
Laboratory Manual. Cold Spring Harbor, NY, Cold Spring Harbor Laboratory, 1989
28.
Butterfield JH,
Weiler D,
Dewald G,
Gleich GJ:
Establishment of an immature mast cell line from a patient with mast cell leukaemia.
Leuk Res
12:345,
1988[Medline]
[Order article via Infotrieve]
29.
Zhen-Bo H,
Weili M,
Uphoff CC,
Quentmeier H,
Drexler HG:
c-kit expression in human megakaryoblastic leukaemia cell lines.
Blood
83:2133,
1994[Abstract/Free Full Text]
30.
Cole SR,
Aylett GW,
Harvey NL,
Cambareri AC,
Ashman LK:
Increased expression of c-kit or its ligand Steel factor is not a common feature of adult acute myeloid leukaemia.
Leukemia
10:288,
1996[Medline]
[Order article via Infotrieve]
31.
Takeuchi Y,
Cosset F-L,
Lachmann PJ,
Okada H,
Weiss R,
Collins MLK:
Type C retrovirus inactivation by human complemement is determined by both the viral genome and producer cell.
J Virol
68:8001,
1994[Abstract/Free Full Text]
32. Evans LH, Morrison RP, Malik FG, Portis J, Britt: A
neutralizable epitope common to the enevelope glycoproteins of ecotropic, xenotropic and amphotropic murne leukaemia viruses. J Virol
64:6176, 1990
33.
Kamps CA,
Lin YC,
Wong PKY:
Oligomerization and transport of the envelope protein of Moloney murine leukemia virus-TB and of ts1, a neurovirulent temperature-sensitive mutant of MoMuLV-TB.
Virology
184:685,
1991
34.
Fass D,
Harrison SC,
Kim PS:
Retrovirus envelope domain at 1.7 A resolution.
Nature Struct Biol
3:465,
1996[Medline]
[Order article via Infotrieve]
35.
Lu HS,
Chang WC,
Mendiaz EA,
Mann MB,
Langley KE,
Hsu YR:
Spontaneous dissociation-association of monomers of the human-stem-cell-factor dimer.
Biochem J
305:563,
1995
36.
Hsu YR,
Wu GM,
Mendiaz EA,
Syed R,
Wypych J,
Toso R,
Mann MB,
Boone TC,
Nahri LO,
Lu HS,
Langley KE:
The majority of stem cell factor exists as monomer under physiological conditions. Implications for dimerization mediating biological activity.
J Biol Chem
272:6406,
1997[Abstract/Free Full Text]
37.
Kasahara N,
Dozy AM,
Kan YW:
Tissue-specific targeting of retroviral vectors through ligand receptor interactions.
Science
226:1373,
1994
38.
Han X,
Kasahara N,
Kan YW:
Ligand directed retroviral targeting of human breast cancer cells.
Proc Natl Acad Sci USA
92:9747,
1995[Abstract/Free Full Text]
39.
Chu THT,
Martinez I,
Sheay WC,
Dornburg R:
Cell targeting with retroviral vector particles containing antibody-envelope fusion proteins.
Gene Ther
1:292,
1994[Medline]
[Order article via Infotrieve]
40.
Chu THT,
Dornburg R:
Retroviral vector particles displaying the antigen binding site of an antibody enable cell type specific gene transfer.
J Virol
69:2659,
1995[Abstract]
41.
Somia NV,
Zopee M,
Verma IM:
Generation of targeted retroviral vectors by using single-chain variable fragment: An approach to in vivo gene delivery.
Proc Natl Acad Sci USA
21:1081,
1993
42.
Chu THT,
Dornburg R:
Toward highly cell type specific gene transfer with retroviral vectors displaying single chain antibodies.
J Virol
71:720,
1997[Abstract]
43.
Cosset F-L,
Russell SJ:
Targeting retrovirus entry.
Gene Ther
3:946,
1996[Medline]
[Order article via Infotrieve]
44.
Schwarzenberger P,
Spence SE,
Gooya JM,
Michiel D,
Curiel DT,
Ruscetti FW,
Keller JR:
Targeted gene transfer to human hematopoietic progenitor cell lines through the c-kit receptor.
Blood
87:472,
1996[Abstract/Free Full Text]
45. Peng K-W, Morling FJ, Cosset F-L, Murphy G, Russell SJ: A gene
delivery system activatable by disease associated matrix
metalloproteinases Hum Gene Ther 8:729, 1997
46.
Morling FJ,
Peng K-W,
Cosset F-L,
Russell SJ:
Masking of retroviral envelope functions by oligomerising peptide adaptors.
Virology
24:51,
1997
47.
Modjtahedi H,
Dean C:
The receptor for EGF and its ligands: Expression, prognostic value and target for therapy in cancer.
Int J Oncol
4:277,
1994
48.
Gusterson B,
Cowley G,
Smith JA,
Ozanne B:
Cellular localisation of human epidermal growth factor receptor.
Cell Biol Int
8:649,
1994
49. Podda S, Ward M, Himelstein A, Richardson C, de la Flor Weiss E,
Smith L, Gottesman M, Pastan I, Bank A: Transfer and expression of the
human multiple drug resistance gene into live mice. Proc Natl Acad Sci
USA 89:9676, 1992
50.
Ross AA,
Cooper BW,
Lazarus HM,
Mackay W,
Moss TJ,
Ciobanu N,
Tallman MS,
Kennedy J,
Davidson NE,
Sweet D,
Winter C,
Akard L,
Jansen J,
Copelan E,
Meagher RC,
Herzig RH,
Klumpp TR,
Kahn DG,
Warner NE:
Detection and viability of tumour cells in peripheral blood stem cell collections from breast cancer patients using immunocytochemical and clonogenic assay techniques.
Blood
82:2605,
1993[Abstract/Free Full Text]
51.
Brugger W,
Bross KJ,
Glatt M,
Weber F,
Mertlesmann R,
Kanz L:
Mobilisation of tumour cells and hematopoietic progenitors into the peripheral blood of patients with solid tumours.
Blood
83:636,
1994[Abstract/Free Full Text]
52.
Bonini C,
Ferrari G,
Verzelltetti S,
Servida P,
Zappone E,
Ruggieri L,
Ponzoni M,
Rossini S,
Mavilio F,
Traversari C,
Bordignon C:
HSV-TK gene transfer into donor lymphocytes for control of allogenic graft-versus-leukemia.
Science
276:1719,
1997[Abstract/Free Full Text]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
E. Verhoeyen, M. Wiznerowicz, D. Olivier, B. Izac, D. Trono, A. Dubart-Kupperschmitt, and F.-L. Cosset
Novel lentiviral vectors displaying "early-acting cytokines" selectively promote survival and transduction of NOD/SCID repopulating human hematopoietic stem cells
Blood,
November 15, 2005;
106(10):
3386 - 3395.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Viejo-Borbolla, P. Thomas, E. D. Blair, and T. F. Schulz
Increase in infectivity of targeted Moloney murine leukemia virus-based gene-delivery vectors through lowering the threshold for fusion
J. Gen. Virol.,
September 1, 2005;
86(9):
2469 - 2480.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Chandrashekran, M. Y. Gordon, and C. Casimir
Targeted retroviral transduction of c-kit+ hematopoietic cells using novel ligand display technology
Blood,
November 1, 2004;
104(9):
2697 - 2703.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F. Martin, S. Chowdhury, S. J. Neil, K. A. Chester, F.-L. Cosset, and M. K. Collins
Targeted Retroviral Infection of Tumor Cells by Receptor Cooperation
J. Virol.,
February 15, 2003;
77(4):
2753 - 2756.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Q. Zhong, P. Oliver, W. Huang, D. Good, V. La Russa, Z. Zhang, J. R. Cork, R. W. Veith, C. Theodossiou, J. K. Kolls, et al.
Efficient c-kit Receptor-Targeted Gene Transfer to Primary Human CD34-Selected Hematopoietic Stem Cells
J. Virol.,
November 1, 2001;
75(21):
10393 - 10400.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Snitkovsky, T. M. J. Niederman, B. S. Carter, R. C. Mulligan, and J. A. T. Young
A TVA-Single-Chain Antibody Fusion Protein Mediates Specific Targeting of a Subgroup A Avian Leukosis Virus Vector to Cells Expressing a Tumor-Specific Form of Epidermal Growth Factor Receptor
J. Virol.,
October 15, 2000;
74(20):
9540 - 9545.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
F. Martin, S. Neil, J. Kupsch, M. Maurice, F.-L. Cosset, and M. Collins
Retrovirus Targeting by Tropism Restriction to Melanoma Cells
J. Virol.,
August 1, 1999;
73(8):
6923 - 6929.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
M. Maurice, S. Mazur, F. J. Bullough, A. Salvetti, M. K.L. Collins, S. J. Russell, and F.-L. Cosset
Efficient Gene Delivery to Quiescent Interleukin-2 (IL-2)-Dependent Cells by Murine Leukemia Virus-Derived Vectors Harboring IL-2 Chimeric Envelopes Glycoproteins
Blood,
July 15, 1999;
94(2):
401 - 410.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Q. Zhong, J. K. Kolls, and P. Schwarzenberger
Retrovirus Molecular Conjugates. A NOVEL, HIGH TRANSDUCTION EFFICIENCY, POTENTIALLY SAFETY-IMPROVED, GENE TRANSFER SYSTEM
J. Biol. Chem.,
June 29, 2001;
276(27):
24601 - 24607.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Abstract
Introduction
Abstract