|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 91 No. 6 (March 15), 1998:
pp. 1858-1863
Human Herpesvirus Type 8 Interleukin-6 Homologue Is Functionally
Active on Human Myeloma Cells
By
Renate Burger,
Frank Neipel,
Bernhard Fleckenstein,
Rocco Savino,
Gennaro Ciliberto,
Joachim R. Kalden, and
Martin Gramatzki
From the Division of Hematology/Oncology, Department of Medicine III,
the Institute for Clinical and Molecular Virology, University of
Erlangen-Nuernberg, Erlangen, Germany; and Istituto di Ricerche di
Biologia Molecolare P. Angeletti, Rome, Italy.
 |
ABSTRACT |
Seroepidemiology and polymerase chain reaction studies have strongly
suggested that human herpesvirus type 8 (HHV-8) is associated with
Kaposi's sarcoma, Castleman's disease, and body cavity-based lymphoma. The genome of HHV-8 harbors a viral analogue of the interleukin-6 (IL-6) gene. The amino acid sequence of the viral IL-6
(vIL-6) protein is 24.7% identical to human IL-6 (hIL-6). IL-6 as a
B-cell growth and differentiation factor is known to play an essential
role in the pathophysiology of B-cell tumors. Thus, it seems possible
that virus-encoded IL-6 contributes to malignant growth of
HHV-8-positive B-cell lymphatic tumors. We have tested a preparation
of HHV-8-derived IL-6 for the ability to promote the proliferation of
the human myeloma cell line INA-6, which is strictly dependent on
exogenous IL-6 for growth and survival. Viral IL-6 significantly
induced DNA synthesis of INA-6 cells, but required much more protein on
a weight basis when compared with hIL-6 for maximal proliferation. The
proliferative effect of vIL-6 was almost completely inhibited by a
combination of anti-IL-6 receptor (IL-6R) and anti-gp130 antibodies or
IL-6R superantagonist Sant7 and anti-gp130 antibodies. This report
demonstrates that vIL-6 has proliferative activity on human cells and
that the IL-6R and gp130 are involved in vIL-6 signaling in the myeloma
cell line INA-6.
 |
INTRODUCTION |
HUMAN HERPESVIRUS type 8 (HHV-8) or
Kaposi's sarcoma (KS)-associated herpesvirus (KSHV) was first
identified by Chang et al1 in KS tissues of acquired
immunodeficiency syndrome patients and appears to be the first human
member of the -2 herpesviruses (rhadinoviruses) with herpesvirus
saimiri as a well-characterized prototype of this group. The viral
genome consists of linear double-stranded DNA of about 165 kb in length
and, like other rhadinoviruses, contains numerous open reading frames
with homology to known cellular genes.2,3 However, several
of the homologous genes encoded by HHV-8 are not shared by other
rhadinoviruses or any other viruses as far as it is known. One of these
genes encodes a structural equivalent of interleukin-6 (IL-6) with
striking similarity to human and murine IL-6.4,5 IL-6 has
long been suggested to be involved in the pathogenesis of a variety of
diseases, including KS, body cavity-based lymphoma (BCBL), and
Castleman's disease (CMD).6,7 Interestingly, HHV-8
sequences have been consistently detected in human immunodeficiency
virus (HIV)-related and HIV-unrelated forms of these diseases. The
detection of an IL-6 gene homologue in HHV-8 and its respective gene
product led to the suggestion that viral IL-6 (vIL-6) may play a
functional role in the pathogenesis of KS, BCBL, CMD, and possibly
other lymphoproliferative diseases. Recently, Rettig et al8
reported to have found HHV-8 in dendritic cells cultured from the bone
marrow of patients with multiple myeloma. IL-6 has long been known to
be a growth factor for plasma cells and a central role in the
pathophysiology of multiple myeloma has been
suggested.7,9-11
Whereas the predicted proteins derived from the viral gene homologues
were named without reference to their potential in vivo functions, the
vIL-6 gene product has already been shown to support the in vitro
proliferation and to prevent apoptosis of the IL-6-dependent mouse
hybridoma cell line B9 in a dose-dependent manner.4 We have
tested a recombinant protein preparation of HHV-8 IL-6 on its ability
to bind to and promote proliferation of the IL-6-dependent human
myeloma cell line INA-6. This is the first report demonstrating biologic activity of HHV-8 IL-6 on human myeloma cells.
 |
MATERIALS AND METHODS |
Cell lines and culture.
The human myeloma cell line INA-6 was established from the pleural
effusion of a patient with (IgG)- plasma cell leukemia and is
strictly dependent on exogeneous IL-6 for growth and
survival.12 The B9 cell line was kindly provided by Dr L.A.
Aarden (Amsterdam, The Netherlands).13 The cells were
routinely maintained in RPMI 1640 medium supplemented with 20% or 10%
heat-inactivated fetal calf serum (FCS; GIBCO/BRL, Eggenstein,
Germany), 2 mmol/L L-glutamine, antibiotics, 50 µmol/L
2- -mercaptoethanol and 500 (INA-6) or 20 (B9) U/mL human IL-6
(hIL-6) at 37°C in a humidified atmosphere with 6%
CO2.
Reagents.
Recombinant human (rh) IL-6 (specific activity, 2 to 4 × 108 U/mg) was purchased from Pharma Biotechnologie Hannover
(Hannover, Germany). Neutralizing polyclonal goat anti-IL-6,
monoclonal antihuman IL-6R (CD126; clone 17506.1), and antihuman gp130
(CD130; clone 28126.111) antibodies were purchased from R&D Systems
(Minneapolis, MN). Monoclonal antibodies IKR6 (anti-IL-6R) and IKR3
(anti-gp130) were from ImmunoKontact (Frankfurt, Germany) and
correspond to clones B-R6 and B-R3.14 The IL-6R
superantagonist Sant7 was prepared as described.15
Preparation of HHV-8 IL-6.
A genomic fragment of HHV-8 vIL-6 was amplified using synthetic
oligonucleotides vIL6-5H-Bam
(AGCTGGATCCAAGTTGCCGGACGCCCCCGAGTTTG) and vIL6-3-Hind
(AGCTAAGCTTATCGTGGACGTCAGGAGTCAC). After digestion with
BamHI and HindIII, the polymerase chain reaction
product was ligated into expression vector pQE9 (Quiagen Inc, Hilden, Germany). The resulting expression plasmid (pQEvIL-6) codes for an
amino terminal tag of 6 histidin residues (MRGSHHHHHHGS) and amino
acids 23-204 of vIL-6. It does thus not include the putative amino
terminal signal peptide.5 The recombinant protein has a
calculated relative molecular weight of 22.6 kD. It was expressed in
Escherichia coli strain JM109 and purified under denaturating conditions according to the manufacturer's instructions (Quiagen). Briefly, 500 mL of LB medium containing 100 µg ampicillin/mL was inoculated with 20 mL of an overnight culture of E coli JM109 harboring expression plasmid pQEvIL-6.
Isopropyl- -D-thiogalactopyranoside (IPTG) was added to a final
concentration of 2.5 mmol/L at an optical density at 600 nm of 0.5, and
the bacteria were grown for another 3 hours. Cells were harvested by
centrifugation at 4,000g and lysed in 30 mL of 6 mol/L
guanidinum rhodanide/10 mmol/L Tris, pH 8.0. The lysate was cleared by
centrifugation at 10,000g and applied immediately to a column
of 5 mL Ni-NTA resin (Quiagen). The column was rinsed with 5 vol of
wash-buffer (8 mol/L urea, 100 mmol/L sodium phosphate, 10 mmol/L
Tris/HCl, pH 6.3). Wash-buffer containing increasing amounts of
imidazole (10 to 400 mmol/L) was applied to the column to elute
recombinant protein. Collected fractions were checked for the presence
of recombinant protein by electrophoretic separation on a 12%
polyacrylamide gel and staining with Coomassie blue. Recombinant vIL-6
was eluted at 200 mmol/L imidazole (Fig 1,
lane 1). Recombinant vIL-6 was then renaturated by dialysis against 20 mmol/L HEPES, pH 8.0, 1 mmol/L MgCl2, 20 mmol/L KCl, 0.5 mmol/L dithiotreitol, 0.5 mmol/L phenylmethylsulfonyl fluoride, 0.1 mmol/L EDTA, and 10% glycerol. An aliquot of the renaturated
recombinant vIL-6 was loaded on a 12% polyacrylamide gel and checked
for the absence of degradation (Fig 1, lane 2). The protein
concentration of the renaturated recombinant vIL-6 was determined by
the colorimetric bicinchonic acid assay as described by the
manufacturer (Pierce Inc, Rockford, IL).

View larger version (39K):
[in this window]
[in a new window]
| Fig 1.
Coomassie brilliant blue-stained polyacrylamide gel of
procaryotically expressed vIL-6. The apparent molecular weight of vIL-6 observed here is 24 kD, which is in agreement with the calculated molecular weight of 22.6 kD. M, molecular weight marker; lane 1, 4 µg
vIL-6, eluted from Ni-NTA with 200 mmol/L imidazole; lane 2, 2 µg of
the same protein preparation as lane 1 after dialysis.
|
|
Cell proliferation assay.
INA-6 and B9 cells were washed three times in media without IL-6,
resuspended, and cultured in flat-bottom microtiter plates at a density
of 104 cells per well in a final volume of 200 µL culture
media containing 10% FCS for 72 hours. Cytokines, Sant7, or antibodies
were added as indicated. Antibodies were used at a final concentration
of 10 µg/mL. Cells were pulsed with [3H]-thymidine
(TdR; 1 µCi/well; specific activity, 2.0 Ci/mmol/L; Amersham,
Braunschweig, Germany) 6 hours before harvesting and counted in a -scintillation counter (1205 Betaplate; LKB Wallac, Turku, Finland). Values represent the mean [3H]-TdR
incorporation (cpm) of triplicate cultures.
 |
RESULTS |
Effects of vIL-6 on the human myeloma cell line INA-6.
Based on the sequence similarity of HHV-8 IL-6 to hIL-6 and regarding
its functional activity on murine B9 cells, binding of vIL-6 to the
human IL-6R appeared possible. Therefore, we looked for the ability of
HHV-8 IL-6 to support the proliferation of the human myeloma cell line
INA-6 developed in our laboratory, which is strictly dependent on IL-6
for proliferation and survival.12 IL-11, oncostatin M (OM),
leukemia inhibitory factor (LIF), and ciliary neurotrophic factor
(CNTF) in concentrations up to 100 ng/mL have no effect on the
proliferation of INA-6 cells. As shown in
Fig 2, vIL-6 induced DNA synthesis of INA-6
cells in a dose-dependent manner and to an extent comparable to human
IL-6. However, whereas maximal proliferation with hIL-6 was achieved at
5 ng/mL, 20 µg/mL of the vIL-6 preparation, a 4,000-fold larger
amount of protein, was necessary to yield maximal proliferation. The
same difference in activity between human and viral IL-6 was seen in
proliferation assays using another human IL-6-responsive (but not
human IL-6-dependent) plasma cell line, JK-6.12 With the
murine B9 cell line, which is about 100 times more sensitive to IL-6
than the human INA-6 cell line, a similar magnitude of difference
between vIL-6 and hIL-6 activity was seen, with maximal DNA synthesis
at 200 ng/mL vIL-6 and 0.05 to 0.2 ng/mL hIL-6. Moreover, a different
batch of vIL-6 was used and yielded the same results.

View larger version (13K):
[in this window]
[in a new window]
| Fig 2.
Effects of human and viral IL-6 at different
concentrations on the proliferation of the IL-6-dependent human
myeloma cell line INA-6. [3H]-thymidine was measured
during the last 6 hours of 72 hours of incubation. Values represent the
mean [3H]-TdR incorporation (cpm) of triplicate
cultures.
|
|
Effect of antibodies specific for hIL-6, hIL-6R and gp130 on hIL-6-
and vIL-6-induced proliferation.
Stimulation of INA-6 myeloma cells by vIL-6 was not inhibited by a
polyclonal antihuman IL-6 antiserum (Fig
3). Whereas 2.5 ng/mL hIL-6 were completely neutralized (Fig 3), 200 ng/mL hIL-6 could not be blocked (data not shown). The proliferative
activity of hIL-6 as well as vIL-6 on INA-6 cells was almost completely inhibited by a combination of neutralizing antibodies specific for the
human IL-6R (gp80) and the gp130 molecule (Fig 3), the latter forming a
complex with the IL-6R on the cell surface necessary for signal
transduction. Contrary to the situation with hIL-6, the anti-gp130
antibody alone led to significant inhibition of vIL-6-induced INA-6
proliferation, whereas anti-gp80 had little effect. These results
suggest that, although both IL-6R and gp130 seem to be involved in
vIL-6 function, the relative interaction and affinity of the two
receptor chains for human and viral IL-6 are likely to be substantially
different.

View larger version (15K):
[in this window]
[in a new window]
| Fig 3.
Human and viral IL-6-induced DNA synthesis of INA-6
cells in the absence or presence of antibodies specific for hIL-6,
hIL-6R (gp80), and gp130. A polyclonal antiserum was used for
neutralization of IL-6 protein. Monoclonal antibodies 17506.1 and
28126.111 were used as IL-6R- and gp130-specific reagents. All
antibodies were added at initiation of cultures at a final
concentration of 10 µg/mL.
|
|
Effect of vIL-6 on hIL-6-induced proliferation.
Because large quantities of vIL-6 are necessary to exert similar
effects on cell proliferation as do small amounts of hIL-6, vIL-6 might
lead to receptor blockade. Therefore, various concentrations of hIL-6
and vIL-6 were tested in different combinations. When both cytokines
were used at concentrations that yield almost maximal proliferation of
INA-6 cells (2 ng/mL hIL-6 and 2 µg/mL vIL-6), no inhibitory effects
were seen (Fig 4). The proliferative effect of intermediate doses of hIL-6 could be marginally increased with the
addition of high quantities of vIL-6. However, this additive effect was
clearly seen using suboptimal quantities of hIL-6 and vIL-6 (0.02 ng/mL
and 0.2 µg/mL, respectively).

View larger version (14K):
[in this window]
[in a new window]
| Fig 4.
Effects of human and viral IL-6 alone and in different
combinations on the proliferation of human INA-6 cells. IL-6
concentrations in the combination were the same as indicated for each
hIL-6 and vIL-6 alone.
|
|
Effect of IL-6R superantagonist Sant7 on hIL-6- and vIL-6-induced
proliferation.
IL-6R antagonists have already been shown to efficiently inhibit
IL-6-induced proliferation of malignant plasma cells and to induce
apoptosis.15-17 Superantagonist Sant7 is one of several IL-6 variants that has increased affinity for the IL-6R but has completely lost the ability to bind gp130.15 Sant7, which
specifically binds to the human IL-6R, was not able to inhibit hIL-6-
as well as vIL-6-induced proliferation of B9 cells and, thus, is not
active in the mouse system (Fig 5). This
finding is in line with lack of Sant7 binding in vitro to recombinant
mouse IL-6R (G. Ciliberto, unpublished observations).
However, when tested in different concentrations on the human INA-6
cell line, Sant7 was able to inhibit hIL-6-induced proliferation in a
dose-dependent manner (Fig 6). The effects of 0.5 ng/mL hIL-6 were blocked completely by 1 µg/mL Sant7; 10 µg/mL Sant7 was required when 2.5 ng/mL hIL-6 were present. In line
with previously published results,15 a 2,000- to 4,000-fold excess of Sant7 was necessary for the inhibition of hIL-6 activity. A
total of 2 µg/mL of vIL-6, the quantity required to achieve significant proliferation of INA-6 cells, could not be blocked by 10 µg/mL Sant7. In an experiment with the same quantity of hIL-6, which
is a 1,000-fold more than what is required for maximal DNA synthesis,
10 µg/mL Sant7 could only partially block proliferation (data not
shown).

View larger version (13K):
[in this window]
[in a new window]
| Fig 5.
Human IL-6R superantagonist Sant7 up to a concentration
of 10 µg/mL does not inhibit human and viral IL-6-induced
proliferation of the B9 mouse cell line. Sant7 was added at initiation
of cultures together with IL-6.
|
|

View larger version (14K):
[in this window]
[in a new window]
| Fig 6.
IL-6R superantagonist Sant7 is able to inhibit
proliferation of INA-6 cells induced by hIL-6 in a dose-dependent
manner. Effects of 0.5 ng/mL and 2.5 ng/mL hIL-6 could be blocked by 1 µg/mL and 10 µg/mL Sant7, respectively. A total of 2 µg/mL of
vIL-6 could not be blocked with up to 10 µg/mL Sant7.
|
|
When Sant7 was administered in addition to anti-gp130 antibodies that
partially inhibited INA-6 growth, a complete stop of proliferation
could be achieved even with suboptimal Sant7 concentrations (Fig 7). This coblocking of signal
transduction was also exerted when vIL-6 was used.

View larger version (12K):
[in this window]
[in a new window]
| Fig 7.
Human and viral IL-6-induced proliferation of INA-6
cells is only partially inhibited by 10 µg/mL anti-gp130 antibodies
(clone IKR3). The addition of IL-6R superantagonist Sant7 at low
concentrations led to a marked increase in inhibition of hIL-6 as well
as vIL-6 effects. Anti-gp130 antibodies and Sant7 were added at
initiation of cultures together with IL-6.
|
|
 |
DISCUSSION |
This report describes for the first time a growth-promoting activity
for HHV-8 IL-6 on human cells. The inhibition studies with antibodies
specific for IL-6R/gp130 as well as with IL-6R superantagonist Sant7
clearly demonstrate that the proliferative activity of vIL-6 was
specific. The dose-dependent activity and the same magnitude of
difference in activity between vIL-6 and hIL-6 when tested on a human
and a mouse cell line argue in the same direction. It is unlikely that
the comparatively low specific activity is due to incorrect folding of
vIL-6 during renaturation, and avoiding this step in control batches
gave similar activities. Log step differences in activity as seen with
hIL-6 and vIL-6 are not unusual and have been described for IL-6,
IL-11, and OM in the mouse system with the B9 cell line
before.18,19 Posttranslational modifications in eukaryotic
cells, particularly glycosylation, have been reported not to be
important for the biologic activity of hIL-6.20 Thus, the
rather low activity of vIL-6 is likely to be the result of its low
binding affinity to receptor structures due to limited sequence
homology. Indeed, 4 residues of hIL-6 have been found to be crucial for
interaction of the cytokine with the human IL-6R21: Phe74,
Phe78, Arg 179, and Arg182. Alignment of hIL-6 sequence against vIL-6
sequence shows that, although Phe78 and Arg179 are conserved, a Glycine
is present in position 74 and an Aspartate is present in position 182 of vIL-6 sequence.5 Because amino acid changes of hIL-6
Phe74 and Arg182 have been shown to strongly reduce binding to human
IL-6R,21 this observation furnishes an elegant molecular
explanation for the postulated low binding affinity of vIL-6 to the
human IL-6R.
There are at least two possible explanations for the finding that
antihuman IL-6 antibodies do not inhibit vIL-6. Firstly, the
quantitative amount of vIL-6 protein needed to induce proliferation may
exceed the blocking capacity of the anti-IL-6 antibody used. Alternatively or in addition, structurally different vIL-6 may not be
sufficiently detected by polyclonal antibodies selected for binding of
hIL-6.
The results obtained with antibodies specific for the IL-6R and gp130
clearly show that both receptor chains are involved in vIL-6 binding
and activity. The complete inhibition of INA-6 proliferation with a
combination of IL-6R/gp130 antibodies and with IL-6R superantagonist
Sant7 together with anti-gp130 antibodies confirms the important role
that gp80 plays for vIL-6 signaling in plasma cells. Partial inhibition
of hIL-6-induced proliferation of INA-6 cells with anti-gp80
antibodies alone is consistent with sequential binding of hIL-6 to the
IL-6R with low affinity first, and then this complex associates with
gp130 resulting in high-affinity binding and intracellular
signaling.22 In contrast, vIL-6 activity was significantly
inhibited by anti-gp130 antibodies only. This may be due to differenes
in binding affinities and sequence. Another cytokine that uses gp130 as
signaling subunit, OM, has been shown to bind directly to gp130 with
low affinity, but without a biological response.23 When
present at a high molar excess, OM acts as an IL-6 antagonist on cells
that do not express a functional OM receptor. However, in our system, a
10,000-fold excess of vIL-6 on a per weight basis did not show an
antagonistic effect on hIL-6-induced proliferation of INA-6 cells. On
the contrary, both hIL-6 and vIL-6 have an additive effect that is best
seen at suboptimal doses. Further studies with soluble IL-6R and IL-6R
antagonists may further clarify the receptor binding properties of
vIL-6.
The finding that HHV-8 IL-6 is functionally active on human malignant
plasma cells seems particularly important, because IL-6 has been shown
to be a major growth factor for human myeloma cells.10 In a
study published recently, the presence of HHV-8 in dendritic cells
cultured from bone marrow of patients with multiple myeloma and plasma
cell leukemia was reported and a causative role for HHV-8 in the
pathophysiology has been suggested.8
On the basis of proliferative activity, the INA-6 and B9 cell lines
provide a functional assay allowing to dissect between cellular and viral IL-6. Whereas hIL-6 could be completely inhibited by neutralizing antibodies specific for hIL-6 and by the receptor antagonist Sant7, vIL-6 was only active in high concentrations and
could not be blocked. It remains to be seen if such large quantities of
vIL-6 are produced physiologically and, if so, whether this is
clinically relevant. The cell line system described here should be
helpful to further elucidate the role of viral IL-6 in the pathogenesis
of HHV-8-associated diseases.
 |
FOOTNOTES |
Submitted September 11, 1997;
accepted December 11, 1997.
Supported by the Wilhelm Sander-Stiftung (Grant No. 96.019.1) and by
the Dr. Mildred Scheel-Stiftung (Grant No. W134/94/FL2).
Address reprint requests to Martin Gramatzki, MD, Division of
Hematology/Oncology, Department of Medicine III, University of
Erlangen-Nuernberg, Krankenhausstrasse 12, D-91054 Erlangen, Germany.
The publication costs of this article were defrayed in part by
page charge payment. This article must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. section 1734 solely to indicate this fact.
 |
REFERENCES |
1.
Chang Y,
Cesarman E,
Pessin MS,
Lee F,
Culpepper J,
Knowles DM,
Moore PS:
Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposi's sarcoma.
Science
266:1865,
1994[Abstract/Free Full Text]
2.
Russo JJ,
Bohenzky RA,
Chen MC,
Chen J,
Yan M,
Maddalena D,
Parry JP,
Peruzzi D,
Edelman IS,
Chang Y,
Moore PS:
Nucleotide sequence of the Kaposi's sarcoma-associated herpesvirus (HHV8).
Proc Natl Acad Sci USA
93:14862,
1996[Abstract/Free Full Text]
3.
Neipel F,
Albrecht J,
Fleckenstein B:
Cell-homologous genes in the Kaposi's sarcoma-associated rhadinovirus HHV-8 Determinants of its pathogenicity?
J Virol
71:4187,
1997[Medline]
[Order article via Infotrieve]
4.
Moore PS,
Boshoff C,
Weiss RA,
Chang Y:
Molecular mimicry of human cytokine and cytokine response pathway genes by KSHV.
Science
274:1739,
1996[Abstract/Free Full Text]
5.
Neipel F,
Albrecht J,
Ensser A,
Huang Y,
Li JJ,
Friedman-Kien AE,
Fleckenstein B:
Human herpesvirus 8 encodes a homolog of interleukin-6.
J Virol
71:839,
1997[Abstract]
6.
Hirano T,
Akira S,
Taga T,
Kishimoto T:
Biological and clinical aspects of interleukin 6.
Immunol Today
11:443,
1990[Medline]
[Order article via Infotrieve]
7.
Burger R,
Wendler J,
Antoni K,
Helm G,
Kalden JR,
Gramatzki M:
Interleukin-6 production in B-cell neoplasias and Castleman's disease: Evidence for an additional paracrine loop.
Ann Hematol
69:25,
1994[Medline]
[Order article via Infotrieve]
8.
Rettig MB,
Ma HJ,
Vescio RA,
Põld M,
Schiller G,
Belson D,
Savage A,
Nishikubo C,
Wu C,
Fraser J,
Said JW,
Berenson JR:
Kaposi's sarcoma-associated herpesvirus infection of bone marrow dendritic cells from multiple myeloma patients.
Science
276:1851,
1997[Abstract/Free Full Text]
9.
Kawano M,
Hirano T,
Matsuda T,
Taga T,
Horii Y,
Iwato K,
Asaoku H,
Tang B,
Tanabe O,
Tanaka H,
Kuramoto A,
Kishimoto T:
Autocrine generation and requirement of BSF-2/IL-6 for human multiple myelomas.
Nature
332:83,
1988[Medline]
[Order article via Infotrieve]
10.
Klein B,
Zhang X,
Lu Z,
Bataille R:
Interleukin-6 in human multiple myeloma.
Blood
85:863,
1995[Free Full Text]
11.
Anderson KC,
Jones RM,
Morimoto C,
Leavitt P,
Barut BA:
Response patterns of purified myeloma cells to hematopoietic growth factors.
Blood
73:1915,
1989[Abstract/Free Full Text]
12. (abstr, suppl 1)
Burger R,
Gebhart E,
Trautmann U,
Hansen-Hagge TE,
Strobel G,
Bartram C,
Kalden JR,
Gramatzki M:
Two new interleukin-6 dependent plasma cell lines carrying a chromosomal abnormality involving the IL-6 gene locus.
Br J Haematol
87:212,
1994[Medline]
[Order article via Infotrieve]
13.
Aarden LA,
De Groot ER,
Schaap OL,
Lansdorp PM:
Production of hybridoma growth factor by human monocytes.
Eur J Immunol
17:1411,
1987[Medline]
[Order article via Infotrieve]
14.
Wijdenes J,
Heinrich PC,
Müller-Newen G,
Roche C,
Gu Z,
Clément C,
Klein B:
Interleukin-6 signal transducer gp130 has specific binding sites for different cytokines as determined by antagonistic and agonistic anti-gp130 monoclonal antibodies.
Eur J Immunol
25:3474,
1995[Medline]
[Order article via Infotrieve]
15.
Sporeno E,
Savino R,
Ciapponi L,
Paonessa G,
Cabibbo A,
Lahm A,
Pulkki K,
Sun R,
Toniatti C,
Klein B,
Ciliberto G:
Human interleukin-6 receptor super-antagonists with high potency and wide spectrum on multiple myeloma cells.
Blood
87:4510,
1996[Abstract/Free Full Text]
16.
Demartis A,
Bernassola F,
Savino R,
Melino G,
Ciliberto G:
Interleukin 6 receptor superantagonists are potent inducers of human multiple myeloma cell death.
Cancer Res
56:4213,
1996[Abstract/Free Full Text]
17.
Ehlers M,
de Hon FD,
Klaasse Bos H,
Horsten U,
Kurapkat G,
Schmitz van De Leur H,
Grötzinger J,
Wollmer A,
Brakenhoff JPJ,
Rose-John S:
Combining two mutations of human interleukin-6 that affect gp130 activation results in a potent interleukin-6 receptor antagonist on human myeloma cells.
J Biol Chem
270:8158,
1995[Abstract/Free Full Text]
18.
Burger R,
Gramatzki M:
Responsiveness of the interleukin (IL)-6-dependent cell line B9 to IL-11.
J Immunol Methods
158:147,
1993[Medline]
[Order article via Infotrieve]
19.
Barton BE,
Jackson JV,
Lee F,
Wagner J:
Oncostatin M stimulates proliferation in B9 hybridoma cells: Potential role of oncostatin M in plasmacytoma development.
Cytokine
6:147,
1994[Medline]
[Order article via Infotrieve]
20.
Van Snick:
Interleukin-6: An overview.
Annu Rev Immunol
8:253,
1990[Medline]
[Order article via Infotrieve]
21.
Grotzinger J,
Kurapkat G,
Wollmer A,
Kalai M,
Rose-John S:
The family of the IL-6-type cytokines: Specificity and promiscuity of the receptor complexes.
Proteins
27:96,
1997[Medline]
[Order article via Infotrieve]
22.
Kishimoto T,
Akira S,
Narazaki M,
Taga T:
Interleukin-6 family of cytokines and gp130.
Blood
86:1243,
1995[Free Full Text]
23.
Sporeno E,
Paonessa G,
Salvati AL,
Graziani R,
Delmastro P,
Ciliberto G,
Toniatti C:
Oncostatin M binds directly to gp130 and behaves as interleukin-6 antagonist on a cell line expressing gp130 but lacking functional oncostatin M receptors.
J Biol Chem
269:10991,
1994[Abstract/Free Full Text]

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
N. Adam, B. Rabe, J. Suthaus, J. Grotzinger, S. Rose-John, and J. Scheller
Unraveling Viral Interleukin-6 Binding to gp130 and Activation of STAT-Signaling Pathways Independently of the Interleukin-6 Receptor
J. Virol.,
May 15, 2009;
83(10):
5117 - 5126.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Carbone, E. Cesarman, M. Spina, A. Gloghini, and T. F. Schulz
HIV-associated lymphomas and gamma-herpesviruses
Blood,
February 5, 2009;
113(6):
1213 - 1224.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Chen, G. Sandford, and J. Nicholas
Intracellular Signaling Mechanisms and Activities of Human Herpesvirus 8 Interleukin-6
J. Virol.,
January 15, 2009;
83(2):
722 - 733.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Burger, S. Le Gouill, Y.-T. Tai, R. Shringarpure, P. Tassone, P. Neri, K. Podar, L. Catley, T. Hideshima, D. Chauhan, et al.
Janus kinase inhibitor INCB20 has antiproliferative and apoptotic effects on human myeloma cells in vitro and in vivo
Mol. Cancer Ther.,
January 1, 2009;
8(1):
26 - 35.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M-Q Du, C M Bacon, and P G Isaacson
Kaposi sarcoma-associated herpesvirus/human herpesvirus 8 and lymphoproliferative disorders
J. Clin. Pathol.,
December 1, 2007;
60(12):
1350 - 1357.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Hu and J. Nicholas
Signal Transduction by Human Herpesvirus 8 Viral Interleukin-6 (vIL-6) Is Modulated by the Nonsignaling gp80 Subunit of the IL-6 Receptor Complex and Is Distinct from Signaling Induced by Human IL-6
J. Virol.,
November 1, 2006;
80(21):
10874 - 10878.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Chen and J. Nicholas
Structural Requirements for gp80 Independence of Human Herpesvirus 8 Interleukin-6 (vIL-6) and Evidence for gp80 Stabilization of gp130 Signaling Complexes Induced by vIL-6
J. Virol.,
October 1, 2006;
80(19):
9811 - 9821.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Kovaleva, I. Bussmeyer, B. Rabe, J. Grotzinger, E. Sudarman, J. Eichler, U. Conrad, S. Rose-John, and J. Scheller
Abrogation of Viral Interleukin-6 (vIL-6)-Induced Signaling by Intracellular Retention and Neutralization of vIL-6 with an Anti-vIL-6 Single-Chain Antibody Selected by Phage Display.
J. Virol.,
September 1, 2006;
80(17):
8510 - 8520.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. A. R. Rezaee, C. Cunningham, A. J. Davison, and D. J. Blackbourn
Kaposi's sarcoma-associated herpesvirus immune modulation: an overview
J. Gen. Virol.,
July 1, 2006;
87(7):
1781 - 1804.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. B. Meads and P. G. Medveczky
Kaposi's Sarcoma-associated Herpesvirus-encoded Viral Interleukin-6 Is Secreted and Modified Differently Than Human Interleukin-6: EVIDENCE FOR A UNIQUE AUTOCRINE SIGNALING MECHANISM
J. Biol. Chem.,
December 10, 2004;
279(50):
51793 - 51803.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. S. Dela Cruz, Y. Lee, S. R. Viswanathan, A. S. El-Guindy, J. Gerlach, S. Nikiforow, D. Shedd, L. Gradoville, and G. Miller
N-linked Glycosylation Is Required for Optimal Function of Kaposi's Sarcoma Herpesvirus-encoded, but Not Cellular, Interleukin 6
J. Exp. Med.,
February 17, 2004;
199(4):
503 - 514.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. M. Rose, J. T. Ryan, E. R. Schultz, B. W. Raden, and C.-C. Tsai
Analysis of 4.3 Kilobases of Divergent Locus B of Macaque Retroperitoneal Fibromatosis-Associated Herpesvirus Reveals a Close Similarity in Gene Sequence and Genome Organization to Kaposi's Sarcoma-Associated Herpesvirus
J. Virol.,
May 1, 2003;
77(9):
5084 - 5097.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Sarid, A. Klepfish, and A. Schattner
Virology, Pathogenetic Mechanisms, and Associated Diseases of Kaposi Sarcoma-Associated Herpesvirus (Human Herpesvirus 8)
Mayo Clin. Proc.,
September 1, 2002;
77(9):
941 - 949.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Li and J. Nicholas
Identification of Amino Acid Residues of gp130 Signal Transducer and gp80 {alpha} Receptor Subunit That Are Involved in Ligand Binding and Signaling by Human Herpesvirus 8-Encoded Interleukin-6
J. Virol.,
May 3, 2002;
76(11):
5627 - 5636.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Oksenhendler, E. Boulanger, L. Galicier, M.-Q. Du, N. Dupin, T. C. Diss, R. Hamoudi, M.-T. Daniel, F. Agbalika, C. Boshoff, et al.
High incidence of Kaposi sarcoma-associated herpesvirus-related non-Hodgkin lymphoma in patients with HIV infection and multicentric Castleman disease
Blood,
April 1, 2002;
99(7):
2331 - 2336.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Liu, Y. Okruzhnov, H. Li, and J. Nicholas
Human Herpesvirus 8 (HHV-8)-Encoded Cytokines Induce Expression of and Autocrine Signaling by Vascular Endothelial Growth Factor (VEGF) in HHV-8-Infected Primary-Effusion Lymphoma Cell Lines and Mediate VEGF-Independent Antiapoptotic Effects
J. Virol.,
November 15, 2001;
75(22):
10933 - 10940.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Aoki, M. Narazaki, T. Kishimoto, and G. Tosato
Receptor engagement by viral interleukin-6 encoded by Kaposi sarcoma-associated herpesvirus
Blood,
November 15, 2001;
98(10):
3042 - 3049.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. K. Groves, M. A. Cotter, C. Subramanian, and E. S. Robertson
The Latency-Associated Nuclear Antigen Encoded by Kaposi's Sarcoma-Associated Herpesvirus Activates Two Major Essential Epstein-Barr Virus Latent Promoters
J. Virol.,
October 1, 2001;
75(19):
9446 - 9457.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Li, H. Wang, and J. Nicholas
Detection of Direct Binding of Human Herpesvirus 8-Encoded Interleukin-6 (vIL-6) to both gp130 and IL-6 Receptor (IL-6R) and Identification of Amino Acid Residues of vIL-6 Important for IL-6R-Dependent and -Independent Signaling
J. Virol.,
April 1, 2001;
75(7):
3325 - 3334.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
M.-Q. Du, H. Liu, T. C. Diss, H. Ye, R. A. Hamoudi, N. Dupin, V. Meignin, E. Oksenhendler, C. Boshoff, and P. G. Isaacson
Kaposi sarcoma-associated herpesvirus infects monotypic (IgM{lambda}) but polyclonal naive B cells in Castleman disease and associated lymphoproliferative disorders
Blood,
April 1, 2001;
97(7):
2130 - 2136.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Aoki, R. Yarchoan, K. Wyvill, S.-i. Okamoto, R. F. Little, and G. Tosato
Detection of viral interleukin-6 in Kaposi sarcoma-associated herpesvirus-linked disorders
Blood,
April 1, 2001;
97(7):
2173 - 2176.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J Nicholas
Evolutionary aspects of oncogenic herpesviruses
Mol. Pathol.,
October 1, 2000;
53(5):
222 - 237.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
J. Chen, K. Ueda, S. Sakakibara, T. Okuno, and K. Yamanishi
Transcriptional Regulation of the Kaposi's Sarcoma-Associated Herpesvirus Viral Interferon Regulatory Factor Gene
J. Virol.,
September 15, 2000;
74(18):
8623 - 8634.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
E. Oksenhendler, G. Carcelain, Y. Aoki, E. Boulanger, A. Maillard, J.-P. Clauvel, and F. Agbalika
High levels of human herpesvirus 8 viral load, human interleukin-6, interleukin-10, and C reactive protein correlate with exacerbation of multicentric Castleman disease in HIV-infected patients
Blood,
September 15, 2000;
96(6):
2069 - 2073.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Aoki, R. Yarchoan, J. Braun, A. Iwamoto, and G. Tosato
Viral and cellular cytokines in AIDS-related malignant lymphomatous effusions
Blood,
August 15, 2000;
96(4):
1599 - 1601.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Mullberg, T. Geib, T. Jostock, S. H. Hoischen, P. Vollmer, N. Voltz, D. Heinz, P. R. Galle, M. Klouche, and S. Rose-John
IL-6 Receptor Independent Stimulation of Human gp130 by Viral IL-6
J. Immunol.,
May 1, 2000;
164(9):
4672 - 4677.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Haque, J. Chen, K. Ueda, Y. Mori, K. Nakano, Y. Hirata, S. Kanamori, Y. Uchiyama, R. Inagi, T. Okuno, et al.
Identification and Analysis of the K5 Gene of Kaposi's Sarcoma-Associated Herpesvirus
J. Virol.,
March 15, 2000;
74(6):
2867 - 2875.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
T. Hideshima, D. Chauhan, G. Teoh, N. Raje, S. P. Treon, Y.-T. Tai, Y. Shima, and K. C. Anderson
Characterization of Signaling Cascades Triggered by Human Interleukin-6 versus Kaposi's Sarcoma-associated Herpes Virus-encoded Viral Interleukin 6
Clin. Cancer Res.,
March 1, 2000;
6(3):
1180 - 1189.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
K. G. Mansfield, S. V. Westmoreland, C. D. DeBakker, S. Czajak, A. A. Lackner, and R. C. Desrosiers
Experimental Infection of Rhesus and Pig-Tailed Macaques with Macaque Rhadinoviruses
J. Virol.,
December 1, 1999;
73(12):
10320 - 10328.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
K. D. Jones, Y. Aoki, Y. Chang, P. S. Moore, R. Yarchoan, and G. Tosato
Involvement of Interleukin-10 (IL-10) and Viral IL-6 in the Spontaneous Growth of Kaposi's Sarcoma Herpesvirus-Associated Infected Primary Effusion Lymphoma Cells
Blood,
October 15, 1999;
94(8):
2871 - 2879.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Wan, H. Wang, and J. Nicholas
Human Herpesvirus 8 Interleukin-6 (vIL-6) Signals through gp130 but Has Structural and Receptor-Binding Properties Distinct from Those of Human IL-6
J. Virol.,
October 1, 1999;
73(10):
8268 - 8278.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. A. R. Kaleeba, E. P. Bergquam, and S. W. Wong
A Rhesus Macaque Rhadinovirus Related to Kaposi's Sarcoma-Associated Herpesvirus/Human Herpesvirus 8 Encodes a Functional Homologue of Interleukin-6
J. Virol.,
July 1, 1999;
73(7):
6177 - 6181.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
Y. Aoki, E. S. Jaffe, Y. Chang, K. Jones, J. Teruya-Feldstein, P. S. Moore, and G. Tosato
Angiogenesis and Hematopoiesis Induced by Kaposi's Sarcoma-Associated Herpesvirus-Encoded Interleukin-6
Blood,
June 15, 1999;
93(12):
4034 - 4043.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. R. Berenson and R. A. Vescio
HHV-8 Is Present in Multiple Myeloma Patients
Blood,
May 15, 1999;
93(10):
3157 - 3159.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Tarte, Y. Chang, and B. Klein
Kaposi's Sarcoma-Associated Herpesvirus and Multiple Myeloma: Lack of Criteria for Causality
Blood,
May 15, 1999;
93(10):
3159 - 3163.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Chauhan, A. Bharti, N. Raje, E. Gustafson, G. S. Pinkus, J. L. Pinkus, G. Teoh, T. Hideshima, S. P. Treon, J. D. Fingeroth, et al.
Detection of Kaposi's Sarcoma Herpesvirus DNA Sequences in Multiple Myeloma Bone Marrow Stromal Cells
Blood,
March 1, 1999;
93(5):
1482 - 1486.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Raje, J. Gong, D. Chauhan, G. Teoh, D. Avigan, Z. Wu, D. Chen, S. P. Treon, I. J. Webb, D. W. Kufe, et al.
Bone Marrow and Peripheral Blood Dendritic Cells From Patients With Multiple Myeloma Are Phenotypically and Functionally Normal Despite the Detection of Kaposi's Sarcoma Herpesvirus Gene Sequences
Blood,
March 1, 1999;
93(5):
1487 - 1495.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Tarte, S. J. Olsen, J.-F. Rossi, E. Legouffe, Z.-Y. Lu, M. Jourdan, Y. Chang, and B. Klein
Kaposi's Sarcoma-Associated Herpesvirus Is Not Detected With Immunosuppression in Multiple Myeloma
Blood,
September 15, 1998;
92(6):
2186 - 2188.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Jones, M. E. Ballestas, K. M. Kaye, J. M. Gulizia, G. L. Winters, J. Fletcher, D. T. Scadden, and J. C. Aster
Primary-Effusion Lymphoma and Kaposi's Sarcoma in a Cardiac-Transplant Recipient
N. Engl. J. Med.,
August 13, 1998;
339(7):
444 - 449.
[Full Text]
[PDF]
|
 |
|
|
|