|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 91 No. 6 (March 15), 1998:
pp. 2085-2091
A Syndrome of Peripheral Blood T-Cell Infection With Epstein-Barr
Virus (EBV) Followed by EBV-Positive T-Cell Lymphoma
By
Hirokazu Kanegane,
Kishor Bhatia,
Marina Gutierrez,
Hisashi Kaneda,
Taizo Wada,
Akihiro Yachie,
Hidetoshi Seki,
Takashi Arai,
Sei-ichi Kagimoto,
Minoru Okazaki,
Tsutomu-ishi, OhAmir Moghaddam,
Fred Wang, and
Giovanna Tosato
From the Center for Biologics Evaluation and Research, Bethesda MD;
National Cancer Institute, National Institutes of Health, Bethesda,
Maryland; Kanazawa University School of Medicine, Kanazawa, Ishikawa,
Japan; Saitama Children's Medical Center, Iwatsuki, Saitama, Japan;
and the Infectious Disease Division, Brigham and Women's Hospital,
Harvard Medical School, Boston, MA.
 |
ABSTRACT |
The role of Epstein-Barr virus (EBV) in the pathogenesis of severe,
chronic active EBV infection and its complications is unclear. We
investigated two Japanese patients diagnosed with severe, chronic
active EBV infection who subsequently developed EBV-positive T-cell
lymphoma. The patients displayed abnormally high antibody titers to EBV
antigens, and had evidence of peripheral blood CD4+
T-cell infection with EBV, 19 months and 3 months, respectively, before
the diagnosis of EBV-positive T-cell lymphoma. The lymphomas were
infected with monoclonal EBV and expressed the EBV latency genes
EBNA-1, LMP-1, and LMP-2. Genetic studies showed that the virus
detected in the T-cell lymphoma was indistinguishable, with respect to
type and previously defined LMP-1 and EBNA-1 gene variations, from
virus detected in the peripheral blood T cells 19 months earlier. These
studies support an important pathogenetic role of T-cell infection with
EBV in chronic active EBV infection and in the EBV-positive T-cell
lymphoma that followed.
| |
INTRODUCTION |
EPSTEIN-BARR VIRUS (EBV) is a ubiquitous
herpes virus in the human population. Most primary EBV infections are
inapparent, but occasionally, EBV may cause acute infectious
mononucleosis (IM), and in association with severe immunodeficiency,
B-cell lymphoproliferative disorders.1 Infection with EBV
has also been linked with a variety of malignancies, including
Burkitt's lymphoma, nasopharyngeal carcinoma,2 Hodgkin's
disease,3,4 smooth muscle tumors,5,6 and
gastric carcinoma.7,8 Recently, the virus has been
associated with lymphoproliferative disorders of T and NK cells,
including cases of fulminant infectious mononucleosis,9 chronic active EBV infections,10,11 nasal or nasal-type
lymphomas,12,13 and nodal and extranodal lymphomas of
various histologies.14-17
Studies in vitro have generally failed to show normal T-cell
immortalization by exposure to EBV. In one study, transfection of EBV
DNA into normal T cells was reported to induce T-cell
immortalization.18 In other studies, exposure to EBV caused
transient infection of normal peripheral blood T cells and
thymocytes.19 In vivo T-cell infection with EBV has only
rarely been documented in otherwise normal individuals. Recently, EBV
was found to infect circulating T cells and NK cells in some patients
with chronic active EBV infection,10,11,20-22 and
spontaneously outgrowing EBV-infected T-cell lines were derived from
three patients diagnosed with this illness.23
The difficulties with which normal T cells are infected with EBV in
vitro and the rare occurrence of benign T-cell infections with EBV in
vivo raise unresolved questions on the pathogenesis of EBV-positive
lymphoproliferative diseases of T-cell lineage. Most importantly, it is
unclear what role, if any, the virus might play when it infects the
unusual T-cell target. We report here on two patients diagnosed with
severe, chronic active EBV infection who subsequently developed
EBV-positive T-cell lymphoma.
| |
MATERIALS AND METHODS |
Study subjects.
Case 1 is a 2-year-old girl who visited a local hospital, complaining
of fever and cough, in May 1994. She was treated for pneumonia.
Laboratory tests showed elevated liver function tests. In
October 1994, liver function tests had deteriorated and
hepatosplenomegaly was diagnosed. In November 1994, physical
examination showed cervical lymphadenopathy and hepatosplenomegaly, and
laboratory tests detected high titer antibodies to EBV antigens. The
blood count included a white cell count of 3700/µL with 48%
neutrophils, 2% monocytes, and 50% lymphocytes; a red cell count of
391 × 104/µL, hemoglobin of 9.9 g/dL, hematocrit of
30.2%, and a platelet count of 36.8 x 104/µL. Serum
alkaline phosphatase (ALP), aspartate aminotransferase (AST), alanine
aminotransferase (ALT), and lactate dehydrogenase (LDH) were all
abnormally elevated (1897, 314, 204, and 1044 IU/L, respectively).
Total protein was also elevated (7.8 g/dl), with hypergammaglobulinemia. All other chemistries were within normal limits. In May 1996, 2 years after the onset of symptoms, the lymphadenopathy deteriorated and a lymph node biopsy was diagnostic for
T-cell lymphoma. Combination chemotherapy with vincristine and
prednisone resulted in clinical remission.
Case 2 was an 11-year-old boy who was hospitalized in August 1993 because of fever, hepatosplenomegaly, and left parotid swelling that
were first noted 2 to 3 months earlier. Physical examination showed
hepatosplenomegaly and lymphadenopathy. The blood count included a
white cell count of 1500/µL with 57% neutrophils, 2% monocytes, and
41% lymphocytes; a red cell count of 439 × 104/µL,
hemoglobin of 11.9 g/dL, and a platelet count of 13.5 × 104/µL. Serum AST, ALT, and LDH were elevated (119, 141, and 2160 IU/L, respectively), and IgG levels were also abnormally
elevated (3218 mg/dL). In October 1993, a lymph node biopsy showed
disruption of the normal lymph node structure by lymphocytes with
plasma cell infiltration, and a diagnosis of lymphoma was made. Fever and hepatosplenomegaly transiently improved on  -interferon
treatment, but this was stopped after 2 weeks because of evidence of
hepatic toxicity and emotional changes. Splenectomy and treatment with cyclosporin A, etoposide, and prednisone did not control the disease, and the patient died with multiple organ failure and systemic fungal
infection, 2 years and 4 months after the onset of symptoms.
Virological studies.
Serum antibodies to viral capsid antigen (VCA), early antigen (EA), and
nuclear antigen (EBNA) of EBV were determined by conventional immunofluorescence methods. Serum antibodies to hepatitis A, B, and C
were detected by passive hemagglutination tests. Antibodies to
cytomegalovirus were determined by complement fixation or
immunofluorescence.
In situ hybridization for EBV RNA.
The presence of EBV in cell populations was assessed by in situ
hybridization for EBV-encoded small nuclear RNAs
(EBER).22,24 CD4+ T, CD8+ T, B, and
NK cells were separated from the patient's peripheral blood
mononuclear cells by incubating with monoclonal antibodies to CD4, CD8,
CD20, and CD16, followed by isolation of each subpopulation by
electronic cell sorting, using an Epics Elite flow cytometer (Coulter
Immunology, Hialeah, PA) or a FACStar Plus (Becton Dickinson, San Jose,
CA). Each sorted population was more than 97% pure. Subpopulations of
CD4+ T, CD8+ T, B, NK cells, and control cells
were centrifuged on 3-aminopropyltriethoxy-silane-coated glass slides
and fixed in 4% formaldehyde in 0.1 mol/L phosphate buffer. After
rinsing and rehydration, hybridization was performed with an
ALP-conjugated sense and antisense oligonucleotide probe to EBER-1, as
described.22, 24
Southern blot analysis for EBV clonality.
DNA was prepared from frozen patient tissues and from B95-8, Raji, and
Louckes cell lines with the QIAamp Tissue Kit (Qiagen, Inc, Chatsworth,
CA) according to the manufacturer's protocol. Ten µg of genomic DNA
was digested with BamHI separated on a 0.7% agarose gel and
transferred to a nitrocellulose membrane. The membrane was hybridized
with a 32P-labeled B95-8 DNA fragment (167,129-169, 566)
that contains the LMP-1 open reading frame and detects the right
terminal repeats.25 The membrane was washed with 0.2% SSC
and 1% SDS at 68 oC and visualized by autoradiography.
Polymerase chain reaction (PCR) for EBV DNA.
The oligonucleotide sequences for amplification of the EBV U2 region
encoding EBNA-2 were 5 -TTTCACCAATACATGAACC-3 and
5-TGGCAAAGTGCTGAAAGCAA-3. Amplification was performed as
described previously.22,26 Expected lengths of the
amplified products derived from type 1 and type 2 EBV were 378 bp and
483 bp, respectively. Sequences within the C-terminal region of LMP-1
gene were amplified, as described,27 by using the following
primers: 5-GCGACTCTGCTGGAAATGAT-3 and 5-GACATGGTAATGCCTAGAAG-3. The expected size of the
amplified products from wild-type EBV is 260 bp; the expected size from the 30 bp LMP-1 deletion mutant is 230 bp. EBNA-1 typing
by PCR was performed as described.28 Two EBNA-1 fragments
were amplified including a 284 bp fragment (nucleotides 50-334) and a
330 bp fragment (nucleotides 1341-1671). The primer pairs used for
amplifications were: ACAGGACCTGGGAAATGGCCTA and CCTCCCTGCTCCTGCCCCTC
(284 bp fragment), and CCCGCAGATGACCCAGGAGA and GGGTCCAGGGGCCATTCCAA
(330 bp fragment). The amplified fragments were directly sequenced from
PCR amplified products by using the Sequenase (US Biochem, Cleveland,
OH) protocol, as described.28
RNA preparation and reverse transcriptase-mediated PCR (RT-PCR).
Total RNA was extracted from cell pellets or tissue, by using guanidine
isothiocyanate-phenol (Trizol, Life Technologies). The first-strand
cDNA was synthesized from 5 µg of total RNA by using the Superscript
preamplification system (Life Technologies). For the detection of EBV
latent gene expression (EBNA-1,-2, and LMP-1, -2A, -2B), nested PCR was
performed essentially as described elsewhere.26,29
Expression of the other EBV genes (EBER1, BZLF1, vIL-10) and hIL-10 was
also assessed by RT-PCR. The sequences of the primer pair were
5-AAAACATGCGGACCACCAGC and 5-AGGACCTACGCTGCCCTAGAA (EBER1); 5-TTCCACAGCCTGCACCAGTG and
5-GGCAGCAGCCACCTCACGGT (BZLF1); 5-ATGGAGCGAAGGTTAGTGGTCACT and 5-AATTGGATCATTTCTGACAGCGCC
(vIL-10); and 5-CTTCGAGATCTCCGAGATGCCTTC and
5-ATTCTTCACCTGCTCCACGGCCTT (hIL-10).
| |
RESULTS |
EBV serologies from the two patients were consistent with chronic
active EBV infection 19 months (case 1) and 3 months (case 2) before
the diagnosis of T-cell lymphoma. Positive IgG, but not IgM, anti-VCA
antibodies and positive anti-EBNA antibodies indicated past infection
with EBV (Table 1). Abnormally elevated IgG
antibodies to VCA and EA and detection of IgA antibodies to VCA and EA
suggested ongoing viral replication. In both patients antibody titers
to EBV antigens did not change substantially during the following 2 years. Antibodies to hepatitis virus and cytomegalovirus were all
negative (data not shown).
To determine which cell populations were infected with EBV in these
patients, highly purified (>97% pure) populations of
CD4+ T cells, CD8+ T cells, CD16+
NK cells, and CD20+ B cells, obtained by cell sorting of
peripheral blood mononuclear cells, were evaluated for the presence of
EBV by in situ hybridization for EBER1. In patient 1 (Fig 1), 3.4% of CD4+ T cells
were EBER1 positive 19 months before the diagnosis of T-cell lymphoma
was made. At the same time point, occasional EBER1-positive cells were
also detected in the purified CD20+ B-cell population, but
no EBER1-positive cells were detected in CD8+ and
CD16+ cell populations (Fig 1). In patient 2 (not shown),
3.9% of peripheral blood CD4+ T cells were found to be
EBER1 positive, but no EBER1-positive cells were detected in the
CD20+ B cells, CD8+ T cells or
CD16+ NK cells 3 months before the diagnosis of T-cell
lymphoma. As expected, more than 95% of Daudi cells used as a positive
control were EBER1 positive, whereas all control purified peripheral
blood cell populations from two EBV-seropositive normal
individuals were EBER1 negative (data not shown).
View larger version (101K):
[in this window]
[in a new window]
| Fig 1.
Detection of EBER1 expression by in situ hybridization.
Purified populations of CD4+ T cells, CD8+
T cells, CD16+ NK cells, and CD20+ B cells
obtained from patient 1, 19 months before the development of lymphoma,
were cytocentrifuged and hybridized with an alkaline phosphatase-conjugated EBER1 antisense oligonucleotide probe.
|
|
Lymphomas were diagnosed in the lymph node from patient 1 and in the
spleen from patient 2 at 19 months and 3 months, respectively, after
peripheral blood CD4+ T-cell infection with EBV was
documented. Both lymphomas were EBV positive by EBER1 in situ
hybridization (Fig 2), and were of T-cell
lineage as determined by immunohistochemistry with an anti-CD45RO and
anti-CD4 MoAb, and Southern analysis that detected rearranged T-cell
receptor  - and  -chain genes with germline immunoglobulin JH genes
(not shown).
Both tumors contained monoclonal EBV determined by Southern analysis of
EBV terminal repeats (Fig 3). Two tumor
samples from patient 1, derived from distinct lymph nodes, displayed
indistinguishable clonality. The monoclonal EBV in the tumor sample
from patient 2 was distinct from that found in patient 1. As expected,
EBV in the B95-8 cell line was present at a high copy number in both episomal and linear forms, whereas EBV was monoclonal in the Raji cell
line; no EBV was detected in the EBV-negative Louckes cell line (Fig
3).
View larger version (69K):
[in this window]
[in a new window]
| Fig 3.
EBV clonality in lymphoma tissues assessed by Southern
analysis. Genomic DNA was digested with BamHI, separated on an
agarose gel, and transferred to a nitrocellulose membrane. The membrane was hybridized with 32P-labeled B95-8 fragment containing
the LMP open reading frame, washed, and visualized by autoradiography.
Tumors 1 and 2 were derived from different lymph nodes of case 1; one
tumor specimen was derived from case 2. B95-8 and Raji cell lines were
used as EBV-positive controls; Louckes cell line was used as an
EBV-negative control.
|
|
RT-PCR analysis for EBV-gene expression in the lymphoma tissue
specimens showed a type II form of EBV latency. EBER-1, EBNA-1, LMP-1,
and LMP-2A transcripts could be amplified readily from both lymphoma
specimens, whereas no EBNA-2 or LMP-2B transcripts were derived from
these tissues (Fig 4). The mRNAs for the
EBV replication genes BZLF1 and BCRF1 (vIL-10) were amplified from both
lymphomas, consistent with the occurrence of viral replication in these
tissues. The mRNA for the cellular genes hIL-10 and GAPDH were
amplified from all samples tested. As expected, the EBV-producing marmoset cell line B95-8 expressed all EBV genes, and the EBV-negative lymphoma cell line BJAB expressed the cellular hIL-10 and GAPDH genes,
but no EBV genes.
View larger version (48K):
[in this window]
[in a new window]
| Fig 4.
EBV gene expression in lymphoma tissues assessed by
RT-PCR analysis. Total RNA extracted from lymphoma tissues of case 1 (lymph node) and case 2 (spleen), and from control EBV-negative BJAB and EBV-positive B95-8 cell lines, was reverse transcribed and subjected to PCR amplification with specific primers. The amplified products containing -[32P]dCTP were electrophoresed
through 6% acrylamide Tris-borated EDTA gels, followed by
autoradiography. For GAPDH control, the amplified products were
electrophoresed through a 1.5% agarose gel prestained by ethidium
bromide.
|
|
To examine possible links between peripheral blood T-cell infection
with EBV and the subsequent development of EBV-positive T-cell
lymphoma, we compared EBNA-2, LMP, and EBNA-1 virus variants in the
purified CD4+ peripheral blood T cells from patient 1 (obtained 19 months before the diagnosis of T-cell lymphoma was made)
with the virus detected in two T-cell lymphoma tissue specimens from
the same patient (obtained at the time the diagnosis of lymphoma was
made). Two types of EBV, type 1 and 2, have been defined by differences
in the U2 region encoding EBNA-2 resulting in distinct serologic reactivities.30 PCR amplification with EBNA-2 specific
primers indicated that all samples from patient 1, including the
peripheral blood CD4+ T cells and the two lymphoma tissue
specimens, were infected with type-1 EBV
(Fig 5). Also infected with type-1 EBV was
the lymphoma tissue from patient 2 (Fig 5). As expected, type-1 EBV was
detected in the control B95-8 cells (378 bp amplification product),
whereas type-2 EBV was detected in Ag876 cells (483 bp amplification
product).
View larger version (39K):
[in this window]
[in a new window]
| Fig 5.
EBV typing of virus-infected patient peripheral blood and
lymphoma tissues. DNA, extracted from CD4+ peripheral
blood T cells and lymphoma specimens (from distinct lymph nodes) of
patient 1, from a lymphoma specimen (spleen) of patient 2, and from
control cell lines, was subjected to PCR amplification with specific
probes. The EBNA-2 primers were designed to distinguish type-1 and
type-2 EBV; the LMP primers were designed to distinguish full length
from deleted LMP-1 gene.
|
|
The presence of a 30 bp deletion in the LMP1 gene has defined a variant
EBV isolate,31 detectable in the Ag876 cell line (230 bp
amplification product), that can be distinguished from the full-length
product (260 bp amplification product) of the prototype B95-8 cell line
(Fig 5). All samples from patient 1, including peripheral blood
CD4-positive cells and lymphoma tissue from the two lymph nodes,
yielded the 230 bp PCR product (Fig 5) indicative of the presence of a
deleted LMP1 gene. In contrast, the lymphoma tissue from patient 2 yielded a 260 bp PCR product indicative of the presence of a
full-length LMP1 gene (Fig 5).
Sequence variations of the carboxy terminal region of
EBNA-128 have defined five EBV subtypes distinguished on
the basis of several amino acid substitutions, including substitutions
at position 487 (alanine, detected in the prototype B95-8 virus, and
substitutions with threonine, valine, proline, or leucine). Using PCR
to amplify EBNA-1 specific fragments, followed by DNA sequencing, all
five previously identified EBNA-1 subtypes were recovered from the
peripheral blood CD4+ T cells from patient 1 (Fig 6). In contrast, only the EBNA-1 subtype identified by valine at position 487 was detected in the lymphoma specimens from patient 1 (Fig 6). The same EBNA-1 subtype was
also detected in the lymphoma specimen from patient 2 (Fig 6). Thus,
patient 1 harbored EBV in the peripheral blood CD4+ T cells
that was indistinguishable from the virus detected 19 months later in
the T-cell lymphoma, with respect to previously defined EBNA-1, EBNA-2,
and LMP-1 variants.
View larger version (77K):
[in this window]
[in a new window]
| Fig 6.
Comparative sequence analysis of EBNA-1 from peripheral
blood CD4+ T cells and lymphoma specimens. An EBNA-1
carboxy terminal fragment comprising nucleotides 1341-1671 (330 bp
fragment) was PCR-amplified with DNA extracted from peripheral blood
CD4+ T cells from patient 1, from two lymphoma specimens
from patient 1 (distinct lymph nodes tumors 1, and 2), and from a
lymphoma specimen from patient 2 (spleen, tumor 3). Shown are the
results of direct sequencing of EBNA-1 codons 475 to 490. Nucleotide
substitutions compared to the prototype EBNA-1(B95-8) are highlighted
in bold. Multiple substitutions at the same position are indicative of multiple EBNA-1 variants.
|
|
| |
DISCUSSION |
In the present studies, we show that approximately 4% of the
peripheral blood CD4+ T cells from two Japanese patients
with serologic evidence of severe, chronic, active EBV infection were
infected with EBV at 19 months and 3 months, respectively, before the
development of EBV-positive T-cell lymphoma. Both T-cell lymphomas
contained monoclonal EBV and expressed the transforming EBV gene
LMP-1,32 suggesting that the virus might play a role in the
pathogenesis of these tumors. Genetic studies showed that EBV infecting
both the peripheral blood CD4+ T cells and the T-cell
lymphoma diagnosed 19 months later was of type 1 and displayed a 30 bp
deletion of LMP-1. In addition, the virus recovered from the T-cell
lymphoma tissue was characterized by a substitution at position 487 in
the EBNA-1 gene. The same virus variant was also detected in the
peripheral blood T cells, albeit in conjunction with four other EBNA-1
subtypes. Thus, we describe the previously unrecognized occurrence of
peripheral blood T-cell infection with EBV preceding the development of
malignant EBV--positive T-cell lymphoma. Genetic evidence in one of
the patients linked the virus from the peripheral blood
CD4+ T cells with the monoclonal virus later detected in
the T-cell lymphoma in which the pattern of viral gene expression
suggested a continued role for EBV as a transforming agent. Thus,
peripheral blood T-cell infection with EBV may be important to the
pathogenesis of certain EBV-positive T-cell lymphomas.
Recently, T-cell infection with EBV was reported with increasing
frequency in the context of certain leukemias and lymphomas, particularly in the Orient.9-17 Some of these cases have
presented as fatal lymphoproliferative disorders associated with
primary EBV infection that rapidly progressed toward multiple organ
failure, sepsis, and death.9-11 Other cases have presented
as extranodal lymphomas localized to the upper respiratory tract
exhibiting characteristic histological features of tissue necrosis,
vascular damage, and infiltration with inflammatory cells, and have
been variously identified as nasal or nasal-type T/NK cell lymphomas, lymphomatoid granulomatosis, lethal midline granuloma, or angiocentric lymphomas.12,13 Other cases included nodal or extranodal
T-cell lymphomas with various histologies and
phenotypes.14-17 Recently, four EBV-infected T-cell lines
were derived from culture of peripheral blood from three patients with
severe, chronic active EBV infection.23 In addition,
circulating T cells from two patients with severe, chronic active EBV
infection were reported to be infected with EBV, raising the
possibility that T-cell infection with this virus might be important to
the pathogenesis of this illness.23 However, the occurrence
of peripheral blood T-cell infection with EBV preceding the development
of EBV-positive T-cell lymphoma was not previously described.
In the patients described here, the relationship between the
EBV-infected circulating CD4+ T cells and the malignant
CD4+ T cells in the lymphomas that subsequently developed
could not be established. It is possible that the circulating
EBV-infected CD4+ cells were premalignant and contributed
to lymphomagenesis. Alternatively, they could have been normal
lymphocytes serving as a reservoir for virus later detected in the
lymphoma. T-cell receptor clonality analysis could not be performed on
the rare circulating CD4+ T cells that were infected with
EBV, and thus, cell clonality relationships could not be established.
Normal T-cells are not easily infected with EBV in vitro or in vivo,
and generally do not express the EBV receptor, CD21. Some studies have
documented expression of CD21 in a proportion of circulating CD4 and
CD8+ T cells, and on immature thymic T
cells.19,33,34 Some reports mention transient infection of
T cell with EBV, but no EBV-immortalized T-cell lines have been
generated in vitro by exposure to the virus.35,36 Recently,
an HTLV-1-infected T-cell line, MT-2, was developed that expresses
functional EBV receptors, and can be persistently infected with
EBV.37 Benign T-cell infections with EBV in vivo have
rarely been documented. One report describes a case of transient polyclonal benign proliferation of EBV-infected T cells in a Japanese individual presenting with an infectious mononucleosis-like
syndrome.38 Another documented the presence of
EBV-infected T cells in the lymph nodes of individuals with acute
infectious mononucleosis.39 Thus, T-cell infection with EBV
was reported rarely, and mostly in the context of severe illness.
The rare occurrence of T-cell infection with EBV suggests that the
necessary conditions are infrequently met. Susceptible T-cell targets
could be rare or represent an abnormal T-cell population, and
conditions permitting T-cell infection could be stringent and peculiar.
Rare viral mutants may be required for T-cell infection. Previously,
genetic studies of EBV have documented polymorphism in the EBNA2,
EBNA3, LMP-1 genes, and BamHI F region of the genome, but EBV
isolates from normal individuals and EBV-positive tumors in the same
geographic area generally exhibited similar gene
polymorphisms.27 We found that the EBNA-1 variant detected
here in both T cell lymphomas and in the peripheral blood T cells of
one of the patients was not previously identified in peripheral blood
of normal individuals,28 including ten normal Japanese
(data not shown), suggesting that further studies are necessary to
study the potential role of EBNA-1 mutations to EBV-associated
diseases. The severity of disease associated with T-cell infection with
EBV may be due, in part, to infection and secondary functional
impairment of the same immune T cells that are primarily involved in
host immunity against the virus.40 In addition, although
EBV has evolved an effective strategy for latent survival in B cells,
such strategy may not apply to the establishment of latency in T cells.
Severe, chronic active EBV infection is a life-threatening illness
leading to the development of lymphoma, myelodysplastic syndrome,
opportunistic infection, or multiple organ failure over a period of
months to several years. High titer antibodies to EBV and the abundance
of EBV DNA or antigens in the tissues have suggested a pathogenetic
role for the virus that remains undefined. The present study, in
conjunction with previous observations of EBV-infecting T cells,
raises the possibility that T-cell infection with EBV represents a key
step in the pathogenesis of the disease and its complications.
| |
FOOTNOTES |
Address correspondence to Dr G. Tosato, Center for Biologics Evaluation
and Research, Building 29A, Room 2D16, HFM-535, 1401 Rockville Pike,
Rockville, Maryland 20852.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
This is a US government work. There are no restrictions on its use.
| |
REFERENCES |
1.
Straus SE,
Cohen JI,
Tosato G,
Meier J:
Epstein-Barr virus infection: biology, pathogenesis, and management.
Ann Intern Med
118:45,
1993[Abstract/Free Full Text]
2.
Young LS,
Dawson CW,
Clark D,
Rupani H,
Busson P,
Tursz T,
Johnson A,
Rickinson AB:
Epstein-Barr virus gene expression in nasopharyngeal carcinoma.
J Gen Virol
69:1051,
1988[Abstract/Free Full Text]
3.
Pallesen G,
Hamilton-Dutoit SJ,
Rowe M,
Young LS:
Expression of Epstein-Barr virus latent gene products in tumour cells of Hodgkin's disease.
Lancet
337:320,
1991[Medline]
[Order article via Infotrieve]
4.
Weiss LS,
Chen YY,
Liu XF,
Shibata D:
Epstein-Barr virus and Hodgkin's disease. A correlative in situ hybridization and polymerase chin reaction study.
Am J Pathol
139:1259,
1991[Abstract]
5.
McClain KL,
Leach CT,
Jensen HB,
Joshi VJ,
Pollock BH,
Parmley RT,
DiCarlo FJ,
Chadwick EG,
Murphy SB:
Association of Epstein-Barr virus with leiomyosarcomas in young people with AIDS.
N Engl J Med
332:12,
1995[Abstract/Free Full Text]
6.
Lee,
ES,
Locker J,
Nalesnik M,
Reyes J,
Jaffe R,
Alashari M,
Nour B,
Tzakis A,
Dickman PS:
The association of Epstein-Barr virus with smooth-muscle tumors occurring after organ transplantation.
N Engl J Med
332:19,
1995[Abstract/Free Full Text]
7.
Shibata D,
Tokunaga M,
Uemura Y,
Sato E,
Tanaka S,
Weiss LM:
Association of Epstein-Barr virus with undifferentiated gastric carcinomas with intense lymphoid infiltration. Lymphoepithelioma-like carcinoma.
Am J Pathol
139:469,
1991[Abstract]
8.
Imai S,
Koizumi S,
Sugiura M,
Tokunaga M,
Uemura Y,
Yamamoto N,
Tanaka S,
Sato E,
Osato T:
Gastric carcinoma: Monoclonal epithelial malignant cells expressing Epstein-Barr virus latent infection protein.
Proc Natl Acad Sci USA
91:9131,
1994[Abstract/Free Full Text]
9.
Mori M,
Kurozumi H,
Akagi K,
Tanaka Y,
Imai S,
Osato T:
Monoclonal proliferation of T cells containing Epstein-Barr virus in fatal mononucleosis.
N Engl J Med
327:58,
1992[Medline]
[Order article via Infotrieve]
10.
Kikuta H,
Taguchi Y,
Tomizawa K,
Kojima K,
Kawamura N,
Ishizaka A,
Sakiyama Y,
Matsumoto S,
Imai S,
Kinoshita T,
Koizumi S,
Osato T,
Kobayashi I,
Hamada I,
Hirai K:
Nature
333:455,
1988[Medline]
[Order article via Infotrieve]
11.
Ishihara S,
Tawa A,
Yumura-Yagi K,
Murata M,
Hara J,
Yabuuchi H,
Hirai K,
Kawa-Ha K:
Clonal T-cell lymphoproliferation containing Epstein-Barr (EB) virus DNA in a patient with chronic active EB virus infection.
Jpn J Cancer Res
80:99,
1989[Medline]
[Order article via Infotrieve]
12.
Harabuchi Y,
Yamanaka N,
Kataura A,
Imai S,
Kinoshita T,
Mizuno F,
Osato T:
Epstein-Barr virus in nasal T-cell lymphomas in patients with lethal midline granuloma.
Lancet
335:128,
1990[Medline]
[Order article via Infotrieve]
13.
Jaffe ES:
Nasal and nasal T/NK cell lymphoma: A unique form of lymphoma associated with the Epstein-Barr virus.
Histopathology
27:581,
1995[Medline]
[Order article via Infotrieve]
14.
Jones JF,
Shurin S,
Abramowsky C,
Tubbs RR,
Sciotto CG,
Wahl R,
Sands J,
Gottman D,
Katz BZ,
Sklar J:
T-cell lymphomas containing Epstein-Barr viral DNA in patients with chronic Epstein-Barr virus infection.
N Engl J Med
318:733,
1988[Abstract]
15.
Bonagura VR,
Katz BZ,
Edwards BL,
Valacer DJ,
Nisen P,
Gloster E,
Mir R,
Lanzkowsky P:
Severe chronic EBV infection associated with specific EBV immunodeficiency and an EBNA+ T-cell lymphoma containing linear, EBV DNA.
Clin Immunol Immunopathol
57:32,
1990[Medline]
[Order article via Infotrieve]
16.
Su IJ,
Hsieh HC,
Lin KH,
Uen WC,
Kao CL,
Chen CJ,
Cheng AL,
Kadin ME,
Chen JY:
Aggressive peripheral T-cell lymphomas containing Epstein-Barr viral DNA: A clinicopathologic and molecular analysis.
Blood
77:799,
1991[Abstract/Free Full Text]
17.
Zhou XG,
Hamilton-Dutoit SJ,
Yan QH,
Pallesen G:
High frequency of Epstein-Barr virus in Chinese peripheral T-cell lymphoma.
Histopathology
24:115,
1994[Medline]
[Order article via Infotrieve]
18.
Stevenson M.,
Volsky B,
Hedenskog M,
Volsky DJ:
Immortalization of human T lymphocytes after transfection of Epstein-Barr virus DNA.
Science
233:980,
1986[Abstract/Free Full Text]
19.
Watry D,
Hedrick JA,
Siervo S,
Rhodes G,
Lamberti JJ,
Lambris JD,
Tsoukas CD:
Infection of human thymocytes by Epstein-Barr virus.
J Exp Med
173:971,
1991[Abstract/Free Full Text]
20.
Kawa-Ha K,
Ishihara S,
Ninomiya T,
Yumura-Yagi K,
Hara J,
Murayama F,
Tawa A,
Hirai K:
CD3-negative lymphoproliferative disease of granular lymphocytes containing Epstein-Barr virus DNA.
J Clin Invest
84:51,
1989
21.
Fukunaga Y,
Asano T,
Takehana J,
Ambo K,
Matsuoka K,
Yamamoto M:
CD3-negative lymphoproliferative disease of granular lymphocytes in a girl with an unusual pattern of anti-Epstein-Barr virus antibodies.
Eur J Pediatr
153:894,
1994[Medline]
[Order article via Infotrieve]
22.
Kanegane H,
Wada T,
Nunogami K,
Seki H,
Taniguchi N,
Tosato G:
Chronic persistent Epstein-Barr virus infection of natural killer cells and B cells associated with granular lymphocytes expansion.
Br J Haematol
95:116,
1996[Medline]
[Order article via Infotrieve]
23.
Imai S,
Sugiura M,
Oikawa O,
Koizumi S,
Hirao M,
Kimura H,
Hayashibara H,
Terai N,
Tsutsumi H,
Oda T,
Chiba S,
Osato T:
Epstein-Barr virus (EBV)-carrying and -expressing T-cell lines established from severe chronic active EBV infection.
Blood
87:1446,
1996[Abstract/Free Full Text]
24.
Hironaka T,
Nagasaki M,
Morikawa S,
Hirai K:
Detection of Epstein-Barr virus transcripts in chemically or immunologically-activated cells and in a null-cell line (HLN-STL-C) by in situ hybridization with alkaline phosphatase-linked oligonucleotide probes.
J Virol Method
44:141,
1993[Medline]
[Order article via Infotrieve]
25.
Raab-Traub N,
Flynn K:
The structure of the termini of the Epstein-Barr virus as a marker of clonal cellular proliferation.
Cell
47:883,
1986[Medline]
[Order article via Infotrieve]
26.
Kunimoto M,
Tamura S,
Tabata T,
Yoshie O:
One-step typing of Epstein-Barr virus by polymerase chain reaction: Predominance of type 1 in Japan.
J Gen Virol
73:455,
1992[Abstract/Free Full Text]
27.
Khanim F,
Yao QY,
Niedobitek G,
Sihota S,
Rickinson AB,
Young LS:
Analysis of Epstein-Barr virus gene polymorphisms in normal donors and in virus-associated tumors from different geographic locations.
Blood
88:3491,
1996[Abstract/Free Full Text]
28.
Bhatia K,
Raj A,
Guitierrez MI,
Judde JG,
Spangler G,
Venkatesh H,
Magrath IT:
Variation in the sequence of Epstein Barr virus nuclear antigen 1 in normal peripheral blood lymphocytes and in Burkitt's lymphomas.
Oncogene
13:177,
1996[Medline]
[Order article via Infotrieve]
29.
Kanegane H,
Wang F,
Tosato G:
Virus-cell interaction in a natural killer-like cell line from a patient with lymphoblastic lymphoma.
Blood
88:4667,
1996[Abstract/Free Full Text]
30.
Zimbe U,
Adldinger HK,
Lenoir GM,
Vuillaume M,
Knebel-Doeberitz MV,
Lauz G,
Desgranges C,
Wittmann P,
Freese UK,
Schneider U,
Bornkamm GW:
Geographic prevalence of two types of Epstein-Barr virus.
Virology
154:56,
1986[Medline]
[Order article via Infotrieve]
31.
Miller WE,
Edwards RH,
Walling DM,
Raab-Traub N:
Sequence variation in the Epstein-Barr virus latent membrane protein 1.
J Gen Virol
75:2729,
1994[Abstract/Free Full Text]
32.
Wang D,
Liebowitz D,
Kieff E:
An EBV membrane protein expressed in immortalized lymphocytes transforms established rodent cells.
Cell
43:831,
1986
33.
Koizumi S,
Zhang XK,
Imai S,
Sugiura M,
Usui N,
Osato T:
Infection of the HTLV-I-harbouring T-lymphoblastoid line MT-2 by Epstein-Barr virus.
Virology
188:859,
1992[Medline]
[Order article via Infotrieve]
34.
Sinha SK,
Todd SC,
Hedrick JA,
Speiser CL,
Lamris JD,
Tsoukas CD:
Characterization of the EBV/C3d receptor on the human Jurkat T cell line: Evidence for a novel transcript.
J Immunol
150:5311,
1993[Abstract]
35.
Yoshiyama H,
Shimizu N,
Takada K:
Persistent Epstein-Barr virus infection in a human T-cell line: Unique program of latent virus expression.
EMBO J
14:3706,
1995[Medline]
[Order article via Infotrieve]
36.
Kelleher CA,
Paterson RK,
Dreyfus DH,
Streib JE,
Wu Xu J,
Takase K,
Jones JF,
Gelfand EW:
Epstein-Barr virus replicative gene transcription during de novo infection of human thymocytes. Simultaneous early expression of BZLF-1 and its repressor RAZ.
Virology
208:685,
1995[Medline]
[Order article via Infotrieve]
37.
Paterson RK,
Kelleher C,
Amankonah TD,
Tstreib JE,
Wu Xu J,
Jones JF,
Gelfand EW:
Model of Epstein-Barr virus infection of human thymocytes: Expression of viral genome and impact on cellular receptor expression in the T-lymphoblastic cell line, HPB-ALL.
Blood
85:456,
1995[Abstract/Free Full Text]
38.
Yoneda N,
Tatsumi E,
Kawanishi M,
Teshigawara K,
Masuda S,
Yamamura Y,
Inui A,
Yoshio G,
Oimomi M,
Baba S,
Yamaguchi N:
Detection of Epstein-Barr virus genome in benign polyclonal proliferative T cells of a young male patient.
Blood
76:172,
1990[Abstract/Free Full Text]
39.
Anagnostopoulos I,
Hummel M,
Kreschel C,
Stein H:
Morphology, immunophenotype, and distribution of latently and/or productively Epstein-Barr virus-infected cells in acute infectious mononucleosis: Implications for the interindividual infection route of Epstein-Barr virus.
Blood
85:744,
1995[Abstract/Free Full Text]
40.
Masucci MG,
Ernberg I:
Epstein-Barr virus: Adaptation to a life within the immune system.
Trends Microbiol
2:125,
1994[Medline]
[Order article via Infotrieve]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
D. H. Dreyfus, A. J. Gross, and D. Thorley-Lawson
Role of T Cells in EBV-Infected Systemic Lupus Erythematosus Patients
J. Immunol.,
September 15, 2005;
175(6):
3460 - 3461.
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. K. Oyoshi, H. Nagata, N. Kimura, Y. Zhang, A. Demachi, T. Hara, H. Kanegane, Y. Matsuo, T. Yamaguchi, T. Morio, et al.
Preferential Expansion of V{gamma}9-J{gamma}P/V{delta}2-J{delta}3 {gamma}{delta} T Cells in Nasal T-Cell Lymphoma and Chronic Active Epstein-Barr Virus Infection
Am. J. Pathol.,
May 1, 2003;
162(5):
1629 - 1638.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Hayashi, Z. Jin, S. Onoda, H. Joko, N. Teramoto, N. Ohara, W. Oda, T. Tanaka, Y.-X. Liu, T. R. Koirala, et al.
Rabbit Model for Human EBV-Associated Hemophagocytic Syndrome (HPS): Sequential Autopsy Analysis and Characterization of IL-2-Dependent Cell Lines Established from Herpesvirus Papio-Induced Fatal Rabbit Lymphoproliferative Diseases with HPS
Am. J. Pathol.,
May 1, 2003;
162(5):
1721 - 1736.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. I. Gutierrez, M. M. Ibrahim, J. K. Dale, T. C. Greiner, S. E. Straus, and K. Bhatia
Discrete Alterations in the BZLF1 Promoter in Tumor and Non-Tumor-Associated Epstein-Barr Virus
J Natl Cancer Inst,
December 4, 2002;
94(23):
1757 - 1763.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. Neuhierl, R. Feederle, W. Hammerschmidt, and H. J. Delecluse
Glycoprotein gp110 of Epstein-Barr virus determines viral tropism and efficiency of infection
PNAS,
November 12, 2002;
99(23):
15036 - 15041.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. G. Ferrari, E. D. Rivadeneira, R. Jarrett, L. Stevceva, S. Takemoto, P. Markham, and G. Franchini
HVMNE, a novel lymphocryptovirus related to Epstein-Barr virus, induces lymphoma in New Zealand White rabbits
Blood,
October 1, 2001;
98(7):
2193 - 2199.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Kasahara, A. Yachie, K. Takei, C. Kanegane, K. Okada, K. Ohta, H. Seki, N. Igarashi, K. Maruhashi, K. Katayama, et al.
Differential cellular targets of Epstein-Barr virus (EBV) infection between acute EBV-associated hemophagocytic lymphohistiocytosis and chronic active EBV infection
Blood,
September 15, 2001;
98(6):
1882 - 1888.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Kimura, Y. Hoshino, H. Kanegane, I. Tsuge, T. Okamura, K. Kawa, and T. Morishima
Clinical and virologic characteristics of chronic active Epstein-Barr virus infection
Blood,
July 15, 2001;
98(2):
280 - 286.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. Quintanilla-Martinez, S. Kumar, F. Fend, E. Reyes, J. Teruya-Feldstein, D. W. Kingma, L. Sorbara, M. Raffeld, S. E. Straus, and E. S. Jaffe
Fulminant EBV+ T-cell lymphoproliferative disorder following acute/chronic EBV infection: a distinct clinicopathologic syndrome
Blood,
July 15, 2000;
96(2):
443 - 451.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. H. Dreyfus, M. Nagasawa, C. A. Kelleher, and E. W. Gelfand
Stable expression of Epstein-Barr virus BZLF-1-encoded ZEBRA protein activates p53-dependent transcription in human Jurkat T-lymphoblastoid cells
Blood,
July 15, 2000;
96(2):
625 - 634.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Abstract
Introduction
Abstract
