Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by van Dijk, T. B.
Right arrow Articles by de Groot, R. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by van Dijk, T. B.
Right arrow Articles by de Groot, R. P.
Related Collections
Right arrow Phagocytes
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, Vol. 91 No. 6 (March 15), 1998: pp. 2126-2132

The Role of Transcription Factor PU.I in the Activity of the Intronic Enhancer of the Eosinophil-Derived Neurotoxin (RNS2) Gene

By Thamar B. van Dijk, Eric Caldenhoven, Jan A.M. Raaijmakers, Jan-Willem J. Lammers, Leo Koenderman, and Rolf P. de Groot

From the Department of Pulmonary Diseases, University Hospital Utrecht, Utrecht, The Netherlands.


    ABSTRACT
Abstract
Introduction
Methods
Results
Discussion
References

Eosinophil-derived neurotoxin (EDN) found in the granules of human eosinophils is a cationic ribonuclease toxin. Expression of the EDN gene (RNS2) in eosinophils is dependent on proximal promoter sequences in combination with an enhancer located in the first intron. We further define here the active region of the intron using transfections in differentiated eosinophilic HL60 cells. We show that a region containing a tandem PU.I binding site is important for intronic enhancer activity. This region binds multiple forms of transcription factor PU.I as judged by gel-shift analysis and DNA affinity precipitation. Importantly, introducing point mutations in the PU.I site drastically reduces the intronic enhancer activity, showing the importance of PU.I for expression of EDN in cells of the eosinophilic lineage.

    INTRODUCTION
Abstract
Introduction
Methods
Results
Discussion
References

EOSINOPHILS PLAY an important role in protection against parasitic diseases and are involved in the pathogenesis of allergic diseases.1,2 Parasite killing and tissue damage seen in allergic lesions are both linked to the release of eosinophil granule proteins by degranulation or exocytosis and production of toxic oxygen metabolites.1,3,4 Eosinophil-derived cytotoxic proteins include major basic protein (MBP), eosinophil peroxidase (EPO), eosinophil cationic protein (ECP), and eosinophil derived neurotoxin (EDN).2,5

EDN is localized in the granule matrix in the human eosinophil and possesses neurotoxic, helminthotoxic, and ribonucleolytic activities.6 EDN is synthesized as a preprotein of 161 amino acids including a 27 amino acid signal peptide, which is processed to form the mature protein.7-10

The EDN gene consists of two exons separated by a single intron, of which the second exon contains the complete coding region and 3'-untranslated sequences.11 These structural features are shared with other genes of the RNAse gene superfamily, such as ECP.11 EDN mRNA can be detected in the RNA from hypodense eosinophils9 and during the promyelocytic stage of eosinophil development as judged by in vitro differentiation of cord blood mononuclear cells.12 Similarly, EDN mRNA expression can be detected in the promyelocytic HL60 cell line when it is induced to differentiate with interleukin-5 (IL-5)9 or butyric acid (BA).13

Previously, it was shown that optimal expression of EDN in HL60 cells is dependent on the interaction of the proximal promoter sequences and the intron.13 The EDN intron contains consensus binding sites for transcription factors AP-1, NF-AT, and PU.I.13 Recently, it was shown that the NF-AT site plays an important role in the activity of the intronic enhancer in undifferentiated HL60 cells, whereas its contribution in the more eosinophil-differentiated HL60 clone 15 cell line was limited.14 By contrast, the contributions of the AP-1 and PU.I sites to the activity of the intron remain obscure. Because AP-1 was not previously shown to play a specific role in myeloid cells, we focused our attention on the role of PU.I.

PU.I was originally identified as the product of the Spi-I oncogene in Friend virus induced erythroleukemias (reviewed in Janknecht and Nordheim15). Transcription factor PU.I was then characterized as a member of the ets multigene family, which bind to a purine-rich sequence containing the GGAA core sequence motif.15,16 Members of the ets-family of transcription factors share a conserved 85 amino acid domain, the ets domain, which is responsible for sequence-specific DNA binding and has some homology with the winged helix-turn-helix family of proteins.15,17 PU.I is expressed in hematopoietic cells, predominantly in the B-cell and myeloid lineages.18-21 The PU.I cis-acting DNA element is found to be essential for the activity of numerous myeloid-specific promoters, including the macrophage scavenger receptor gene,22 CD11b,23 CD18,24 CD64,25 myeloperoxidase,26 neutrophil elastase,27 Fcgamma RIIIA,28 proteinase-3,29 the granulocyte colony-stimulating factor (G-CSF) receptor,30 the macrophage colony-stimulating factor (M-CSF) receptor,31 and the granulocyte-macrophage colony-stimulating factor (GM-CSF) receptor.32 It was also shown that PU.I can functionally interact with other classes of transcription factors, such as NF-EM5/PIP.33,34 Gene targeting experiments have shown that PU.I is required for the development of lymphoid and myeloid lineages during fetal liver hematopoiesis.35,36 Similarly, blocking PU.I function in vitro in ES cells37 or CD34+ cells38 further demonstrates the essential role of PU.I during myelopoiesis.

We show here that a PU.I site in the intron of the EDN gene is important in optimal expression in eosinophilic HL60 cells. Multiple forms of PU.I that are expressed in differentiating HL60 cells bind to the intronic PU.I site. Mutation of the PU.I site strongly decreases the activity of the EDN promoter/intron combination. This is the first report showing the importance of PU.I for the expression of genes in the eosinophil lineage.

    MATERIALS AND METHODS
Abstract
Introduction
Methods
Results
Discussion
References

Cells, plasmids, oligonucleotides, and antibodies.   HL60 cells were cultured in RPMI medium (Life Technologies, Breda, The Netherlands) containing 8% fetal calf serum (FCS). HL60 7.7 cells were generated by culturing HL60 cells for 2 months at pH 7.7 in RPMI containing 25 mmol/L N-[2-Hydroxyethyl]piperazine-N'-3-propane-sulfonic acid (EPPS; Sigma, St Louis, MO). To further differentiate HL60 7.7 cells, butyric acid (0.5 mmol/L; Sigma) was added for 2 to 5 days. HeLa cells were grown in Dulbecco's modified Eagles medium (DMEM; Life Technologies) containing 8% FCS.

The EDN promoter/intron (-300 to +298) was cloned by polymerase chain reaction (PCR) using human genomic DNA. The amplified fragment was then sequenced and cloned into the promoterless CAT reporter plasmid pBLCAT3. Intron deletion constructs (+193, +193delta PU.I, +123, and +67) were generated by PCR and cloned into pBLCAT3. Site-directed mutagenesis was performed as described previously.39 The beta  actin reporter and the GAPDH probe are described elsewhere.40

The following oligonucleotides were used in this study: for PCR cloning of the EDN promoter/intron, EDN-F (CCTGTAAGAAAAGAAGAG) and EDN-R (CACCGCTCCTGTCAGCCA); for the generation of intron deletions, EDN +193 (CGGGATCCATTTCCTTTACTTCCTGTC), EDN+193 d PU.I (CGGGATCC ATTGCCTTTACTGCCTGTC), EDN +123 (CGGGATCCAGTTGCTGCCCCATTGC), and EDN +67 (CGGGATCCAGTCTCCGCGCTGTAG); for site-directed mutagenesis of the PU.I site, PU.I mut1 (CTTTGCAG ACAGGCCTTAAAGGAAATGGG), PU.I mut2 (CAGGAAGTAAAG GCCTTGGGACCCAGAGT), and PU.I mut3 (GCAGACAGGCAGTAA AGGCAATGGGACC); for band-shift analysis (only upper strand is shown), EDN PU.I wt (AGCTTGACAGGAAGTAAAGGAAATG) and EDN-PU.I mut (AGCTTGACAGGCAGTAAAGGCAATG); and for the PCR cloning of an EDN probe for Northern analysis, EDN-RNA-F (CTTCTGTTGGGGCTTCTG) and EDN-RNA-R (TTGGAGTTGTGAGGTTAC).

The following antibodies were used in this study: anti-PU.I (rabbit polyclonal IgG T-21, SC-352; Santa Cruz, Santa Cruz, CA) and anti-STAT3 (rabbit polyclonal IgG C-20, SC-482; Santa Cruz).

RNA isolation, reverse transcription, PCR, and Northern blotting.   Total cellular RNA was isolated by the guanidine isothiocyanate-acid phenol method.41 For the isolation of an EDN-specific probe for Northern blotting, RNA was reverse transcribed using murine Maloney leukemia virus (M-MLV) reverse transcriptase according to the manufacturer's protocols (Life Technologies). PCR was performed in a total volume of 20 µL with 5 µL cDNA synthesis mixture for 36 cycles of 94°C denaturation (1 minute), 52°C annealing (1.5 minutes), and 72°C extension (2 minutes). For Northern blotting, RNA (20 µg) was electrophoretically separated on 0.8% agarose gels and transferred to Hybond (Amersham, Arlington Heights, IL). Blots were hybridized with randomly 32P-labeled EDN or GAPDH fragments overnight at 42°C in hybridization buffer, washed. and exposed to film as described previously.40

Transient transfections.   For transfection experiments, HeLa cells were subcultured in 6-well dishes and transfected with 10 to 20 µg supercoiled plasmid DNA 16 hours later, as described previously.42,43 HL60 cells (10 × 106 cells per sample) were transfected with 20 µg plasmid DNA by electroporation (280 V, 960 µF). The CMV-LacZ plasmid (2 µg) was included to correct for differences in transfection efficiency between different samples. Transfected cells were harvested 48 hours later for CAT assays. CAT assays were performed as follows. Cells were lyzed by repeated freeze-thawing in 250 mmol/L Tris, pH7.4, 25 mmol/L EDTA. Twenty-five micrograms of cellular extract was then incubated in a total volume of 100 µL containing 250 mmol/L Tris, pH 7.4, 2% glycerol, 0.3 mmol/L Butyryl Coenzyme A (Sigma), and 0.05 µCi 14C Chloroamphenicol (Amersham) for 2 hours at 37°C. Reaction products were then extracted using 400 µL xylene/pristane (1:2), and the percentage of acetylated products was then determined using liquid scintillation counting. All experiments were performed at least four times.

In vitro translation, gel retardation assay, and DNA affinity precipitation.   PU.I cDNA was translated in vitro using the TnT-coupled reticulocyte lysate system (Promega, Madison, WI) according to the manufacturer's protocol. Nuclear extracts were prepared as described previously.42 Oligonucleotides were labeled by filling in the cohesive ends with [alpha -32P]dCTP using Klenow fragment of DNA polymerase I. Gel retardation assays were performed according to published procedures with slight modifications. Briefly, nuclear extracts (10 µg) were incubated in a final volume of 20 µL containing 20 mmol/L N-[2-hydroxyethyl]piperazine-N'-[2-ethanesulfonic acid] (HEPES), pH 7.9, 50 mmol/L KCL, 0.1 mmol/L ethylenediaminetetraacetic acid (EDTA), 2 mmol/L MgCl2, 10% (vol/vol) glycerol, 1 mmol/L dithiothreitol, 1 µg poly(dI-dC) (Pharmacia, Uppsala, Sweden), and 1.0 ng of 32P-labeled EDN-PU.I oligonucleotide for 20 minutes at room temperature. Complexes were then separated though nondenaturing 5% polyacrylamide gels and visualized by autoradiography. For supershift analysis, nuclear extracts were preincubated with 1 µg anti-PU.I antibody (SC352X; Santa Cruz) for 30 minutes on ice before the addition of the labeled probe.

For DNA affinity precipitation, nuclear extract was prepared from 20 × 106 cells. The extract was diluted to 400 µL with dilution buffer (10 mmol/L HEPES, pH 7.9, 50 mmol/L KCl, 1 mmol/L EDTA, 5 mmol/L MgCl2, 10% glycerol) and precleared with 25 µL streptavidin-agarose beads (Sigma) for 15 minutes at 4°C. The extract was then incubated with 25 µL of biotinylated EDN oligonucleotide coupled to streptavidin-agarose beads (Sigma) in the presence of 2 µg poly(dI-dC) and 20 µg bovine serum albumin. After incubation for 1 hour at 4°C, protein-DNA complexes were washed three times with dilution buffer. After boiling for 3 minutes in Laemmli sample buffer, samples were separated on 12% sodium dodecyl sulphate-polyacrylamide gels and electro-transferred to Immobilon-P membranes (Millipore, Bedford, MA). Membranes were blocked in TBST-buffer (150 mmol/L NaCl, 10 mmol/L Tris, pH 8.0, 0.3% Tween 20) containing 5% nonfat milk for 30 minutes and probed with anti-PU.I antibody (1 ng/mL; SC352X; Santa Cruz) for 1 hour. After three washes with TBST, the membranes were incubated for 1 hour with peroxidase-conjugated goat-antirabbit antibodies (DAKO, Glostrup, Denmark), followed by five washes with TBST. Proteins were visualized with enhanced chemiluminescence (Amersham).

Direct immunoprecipitation was performed as described previously.44

    RESULTS
Abstract
Introduction
Methods
Results
Discussion
References

It was previously shown that EDN mRNA expression is strongly enhanced in BA-treated HL60 clone 15 cells.13 To investigate whether in HL60 cells differentiated at pH 7.7 EDN expression is also responsive to BA, RNA was isolated from HL60 7.7 cells treated for various periods with BA. Figure 1 shows that EDN mRNA is weakly expressed in parental HL60 and HL60 7.7 cells. However, EDN expression is strongly upregulated by BA treatment within 1 to 2 days, whereas EDN mRNA is maximal 4 days after BA addition. Reprobing the blot with a GAPDH probe shows that equal amounts of RNA were loaded in each lane. These results demonstrate that HL60 7.7 cells are suitable for studying the regulation of the EDN promoter.


View larger version (51K):
[in this window]
[in a new window]
 
Fig 1. Upregulation of EDN expression during eosinophilic differentiation of HL60 cells. HL60 7.7 cells were treated with BA (0.5 mmol/L) for 1, 2, 4, or 6 days, after which RNA was isolated and analyzed by Northern blotting. Hybridization of the blot with a probe specific for EDN shows that EDN mRNA expression is strongly induced by BA. Reprobing of the blot with a GAPDH probe shows that equal amounts of RNA were loaded in each lane. Scanning of the autoradiograph shows the following increase in EDN expression (relative to GAPDH) compared with wild-type HL60 cells: 2-, 5-, 45-, 160-, and 130-fold increase for 7.7 cells treated for 0, 1, 2, 4, and 6 days, respectively.

Next, we cloned the EDN promoter/intron into the pBLCAT3 reporter plasmid and tested its activity in HL60 cells. Figure 2 shows that this reporter is active in HL60 cells compared with a promoterless CAT construct. Moreover, its activity is upregulated by BA during HL60 differentiation when compared with a reporter containing the beta  actin promoter (beta  actin-CAT). Transfection of these constructs into HeLa cells shows that the EDN promoter is not active in all cell types, but has some hematopoietic specificity, as was also suggested by Tiffany et al.13


View larger version (27K):
[in this window]
[in a new window]
 
Fig 2. The EDN promoter/intron combination is active in HL60 cells and their differentiated derivatives. HL60, HL60 7.7, and HeLa cells (10 × 106 per transfection) were transfected with a CAT reporter construct containing the EDN promoter and the first intron (EDN-CAT; 20 µg), the empty vector without EDN sequences (pBLCAT3; 20 µg), or a positive control containing the promoter of the beta -actin gene (beta  actin-CAT; 20 µg) by electroporation (HL60 cells, 280 V, 960 µF) or calcium phosphate precipitation (HeLa cells). Some cells received BA (0.5 mmol/L) 1 hour after transfection (HL60 7.7/BA). Two days posttransfection, cells were harvested and assayed for CAT activity. Bars indicate the mean percentage of acetylation of at least four independent experiments. The standard deviation is indicated by error bars. The EDN reporter construct is clearly active in HL60 cells and their differentiated derivatives, but not in nonhematopoietic HeLa cells.

It was previously shown that the intron of the EDN gene is of major importance for the activity of the EDN promoter in HL60 c15 cells.13 To identify the sequences important for the activity of the intron, we constructed a number of intron-deletion constructs that are schematically shown in Fig 3A. The activity of these constructs was then tested in HL60 cells and HL60 7.7 cells treated with BA. As shown in Fig 3B, deletion of 105 nucleotides from the intron including the AP1 binding site (+193) reduces CAT activity by about 40%. Further deletion to +123 including a tandem PU.I site and an NFAT site strongly reduces CAT activity, whereas deletion of the complete intron (+67) completely abolishes CAT activity. To investigate the role of the PU.I site further, we constructed a +193 construct with a mutated PU.I site (+193 delta  PU.I). Surprisingly, this reduces CAT activity down to the level of the +123 construct, suggesting that the PU.I site is of major importance for the activity of the EDN intron.


View larger version (25K):
[in this window]
[in a new window]
 
Fig 3. The PU.I site in the intron is important for the enhancer function of the EDN intron. (A) Schematic representation of the EDN promoter and intron. Putative transcription factor binding sites (CAAT box, AP1 sites, NFAT site, and PU.I site) are indicated as boxes. The arrows indicate the 3' ends of the reporter constructs used in (B). ex1, exon 1. (B) The EDN reporter constructs described in (A) and the control vector pBLCAT3 were transfected into HL60 or HL60 7.7 cells as described in Fig 2. Construct +193 d PU.I contains point mutations in the PU.I site. The HL60 7.7 cells received BA 1 hour after transfection. CAT activity was determined 48 hours posttransfection. Bars indicate the mean percentage of acetylation of at least four independent experiments. The standard deviation is indicated by error bars. It is clear that the intron is essential for the activity of the EDN reporter construct, whereas the PU.I site seems to play a major role in the activity of the intron.

To further study the importance of the PU.I site for the intronic enhancer activity, we prepared different point mutations in the background of the complete promoter/intron sequence. We mutated either the first PU.I core element (PU.I mut1, Fig 4A) or the second (PU.I mut2) or both (PU.I mut1/2). The activity of the different mutants was then tested in HL60, HL60 7.7, and HL60 7.7/BA cells (Fig 4B). Mutation of the first PU.I core sequence slightly reduces CAT activity, whereas mutation of the second site has a somewhat stronger effect. Importantly, mutation of both sites leads to a strong reduction in CAT activity, especially in HL60 7.7 and HL60 7.7/BA cells. Taken together, these results suggest that the PU.I site in the EDN intron plays a major role in EDN expression in eosinophilic cell lines.


View larger version (31K):
[in this window]
[in a new window]
 
Fig 4. The PU.I site is essential for the activity of the intronic enhancer. (A) Schematic representation of the mutant reporter constructs. Only the sequence around the tandem PU.I site is shown. The PU.I core binding sites are underlined. Mutations made are indicated in bold type. (B) EDN-CAT constructs containing the full promoter and intron with different mutations in the tandem PU.I site were transfected into HL60 and HL60 7.7 cells and treated with BA as described in Fig 2. Two days posttransfection, cells were harvested and assayed for CAT activity. Bars indicate the mean percentage of acetylation of at least four independent experiments. The standard deviation is indicated by error bars. The double mutant in the tandem PU.I site strongly reduces the activity of the EDN-CAT reporter construct.

PU.I is a member of the multigene Ets transcription factor family (for a review, see Janknecht and Nordheim15). To determine the nature of the proteins binding to the PU.I site in the EDN intron, we performed band shift analysis using the PU.I site as a probe. We synthesized PU.I protein using a rabbit reticulocyte system and tested the binding of this protein to the EDN PU.I site. Figure 5A shows that unprogrammed lysate forms two complexes with the PU.I probe, which cannot be competed with either wild-type or mutant PU.I oligonucleotide (lanes 1 through 5). By contrast, in vitro translated PU.I binds as four different complexes to the EDN PU.I site (lane 6). The four complexes can be competed with a 100-fold molar excess of unlabeled wild-type PU.I site (lanes 7 and 8), but not with the mutant PU.I site (lanes 9 and 10). To determine whether PU.I also binds this site in HL60 7.7/BA cells, nuclear extracts were analyzed. Figure 5B shows that three different protein/DNA complexes can be observed, which can be competed with a 100-fold molar excess of unlabeled wild-type PU.I site (lanes 2 and 3), but not with the mutant PU.I site (lanes 4 and 5). Moreover, preincubation of the nuclear extract with an anti-PU.I antibody results in the formation of a supershift (lane 6), whereas an anti-STAT3 antibody did not alter binding. Similar results were obtained with HL60 and HL60 7.7 cells (not shown). These results indicate that the intronic PU.I site is capable of binding PU.I in nuclear extracts of HL60-derived cells.


View larger version (50K):
[in this window]
[in a new window]
 
Fig 5. PU.I binds to the PU.I site in the EDN intron. (A) PU.I protein was generated in vitro using a rabbit reticulocyte lysate. PU.I (lanes 6 through 10) or unprogrammed control reticulocyte lysate (lanes 1 through 5) was then tested in a bandshift assay for binding to the PU.I site from the EDN intron. Arrows indicate four PU.I/DNA complexes that are competed by excess PU.I oligo (lanes 7 and 8, 10- and 100-fold), but not by excess mutant PU.I oligo (lanes 9 and 10, 10- and 100-fold). Nonspecific complexes formed with control lysate are indicated by open arrows. The free DNA probe is not shown. (B) Nuclear extracts were prepared from HL60 7.7 cells treated for 4 days with BA. These extracts were then tested for PU.I binding activity in a band shift assay. Three protein/DNA complexes are observed (lane 1) that are competed by excess PU.I oligo (lanes 2 and 3, 10- and 100-fold), but not by excess mutant PU.I oligo (lanes 4 and 5, 10- and 100-fold). Preincubation with an anti-PU.I antibody (lane 6), but not with an anti-STAT3 control antibody (lane 7) results in the appearance of two supershifted complexes indicated by arrows. The free DNA probe is not shown.

To more precisely determine the nature of the different protein/DNA complexes observed with the EDN PU.I site, we performed DNA affinity precipitation experiments. The PU.I site was labeled with biotinylated dCTP, coupled to streptavidin agarose, and used as a probe to fish out binding proteins from nuclear extracts. Interacting proteins were then resolved on a polyacrylamide gel, blotted onto nylon filters, and probed with an anti-PU.I antibody that is not cross-reactive with other Ets family members. Figure 6A shows that three different PU.I forms bind to the EDN PU.I site in HL60, HL60 7.7 and HL60 7.7/BA cells (lanes 1 through 3). Reprobing the blot with a control antibody (anti STAT3) showed that all three bands indeed are likely to represent different forms of PU.I (data not shown). When the mutant PU.I site was used as a probe, binding of the two faster migrating PU.I forms is strongly reduced, whereas the largest protein binds significantly less (75% decrease) compared with the wild-type probe (lanes 4 through 6). When we performed direct immuno-precipitations of PU.I from the cells, the same three complexes were observed, although in a slightly different ratio that might be caused by different affinity of the PU.I antibody for the different complexes in solution (Fig 6B) that are not evident when the antibody is used on denatured protein (Fig 6A). Taken together, these results strongly suggest that multiple forms of transcription factor PU.I are expressed in HL60-derived cells and that all these forms are capable of interacting with the intronic PU.I binding site.


View larger version (21K):
[in this window]
[in a new window]
 
Fig 6. Multiple forms of PU.I bind to the intron of the EDN gene. (A) DNA affinity precipitation of nuclear extracts from HL60 (H), HL60 7.7 (7), or BA-treated HL60 7.7 cells (B). Either wild-type (lanes 1 through 3) or mutant PU.I oligonucleotide (lanes 4 through 6) was used as a probe. Proteins bound to these probes were precipitated, separated through a 12% polyacrylamide gel, and blotted onto nylon membranes. The filter was then probed with an anti-PU.I antibody. Three different forms of PU.I bind to the wild-type PU.I probe, of which only the largest form binds (with lower affinity) to the mutant probe. (B) Immunoprecipitation of PU.I from HL60 (H), HL60 7.7 (7), or BA-treated HL60 7.7 cells (B) using an anti-PU.I antibody. The precipitates were visualized as in (A). The same three PU.I forms are detected as in (A).

    DISCUSSION
Abstract
Introduction
Methods
Results
Discussion
References

Expression of EDN mRNA is observed in cells of the eosinophilic lineage as well as in human neutrophils9 and in human tissue containing phagocytes.45 In this report, we show that transcription factor PU.I plays an important role in the activity of the EDN promoter/intron, suggesting that PU.I is involved in expression of EDN in eosinophilic cells.

It was previously shown that PU.I is essential for the development of lymphoid and myeloid lineages during fetal liver hematopoiesis.35,36 Moreover, using PU.I -/- ES cells, it was shown that PU.I is essential for terminal differentiation of myeloid precursors to neutrophils and macrophages.37 In these cells, expression of early myeloid markers, such as GM-CSF-R, G-CSF-R, and myeloperoxidase was unaltered. By contrast, genes associated with terminal myeloid differentiation, such as CD11b, CD64, and M-CSFR, were not expressed in PU.I -/- ES cells.37 However, the role of PU.I for eosinophilopoiesis was not determined. Our results might suggest that PU.I might well play a role in gene regulation during terminal differentiation of eosinophils comparable to its role in neutrophils.

Tiffany et al13 have shown that the EDN intron is essential for optimal activity of the EDN promoter. The activity of the intron is only obvious in hematopoietic cells, such as U937, K562, Jurkat, HL60,13 and HL60 7.7 +/-BA (this study), but not in other cell lines such as 29313 or HeLa (this study). It is therefore likely that a transcription factor expressed mainly in hematopoietic cells is involved in the activity of the intron. Of the transcription factor binding sites present in the intron, both PU.I and NFAT, but not AP-1, fit this criterion. Using our intron deletion constructs, we have mapped the major determinant of the intron activity to the tandem PU.I site (Figs 3 and 4). However, the first 60 bp of the intron, containing the NFAT site, also contains some activity compared with an intronless promoter (Fig 3B). Very recently, Handen and Rosenberg14 have shown that mutation of the NFAT site strongly represses the activity of the EDN intron in wild-type undifferentiated HL60 cells. However, this effect is much weaker in the more differentiated eosinophilic subclone HL60 c15, which was subcloned from HL60 cells grown at pH 7.7,46 and is therefore likely to be comparable with our HL60 7.7 cells.14 By contrast, the effect of the PU.I mutation is stronger in the more differentiated HL60 7.7 and HL60 7.7/BA cells as compared with the undifferentiated parental HL60 cells (Fig 4B). These results suggest that the NFAT site might play a role in EDN regulation early during myelopoiesis, whereas PU.I is more important later during terminal eosinophilic differentiation. Interestingly, a similar role for PU.I was recently demonstrated by Olson et al,37 who have shown that PU.I is not essential for early myeloid gene expression but is required for terminal myeloid differentiation.

We have shown that multiple forms of PU.I interact with the EDN PU.I site (Figs 5 and 6). However, we cannot rule out the possibility that only one form of PU.I interacts directly with the PU.I site, whereas the other complexes represent PU.I forms interacting with the DNA bound PU.I form. These different forms might represent different serine or threonine phosphorylations of PU.I. Although the difference in size between the different forms of PU.I is rather large, it is not unprecedented, because different phosphorylated forms differing 9 kD were previously shown during monocytic differentiation of U937 cells with 12-O-tetradecanoylphorbol-13-acetate.47 Similarly, stimulation of macrophages with lipopolysaccharide also results in serine phosphorylation of PU.I.48 It was also suggested that these different forms might have distinct trans-activation potentials.48 Further experiments are necessary to study the role of the different PU.I forms in the regulation of the activity of the EDN intron.

EDN mRNA is strongly upregulated during eosinophilic differentiation of HL60 cells with BA (Tiffany et al13 and Fig 1). However, the activity of the EDN intron/promoter combination is only modestly increased during this process. This might indicate that other enhancers located more upstream or downstream from the sequences that we have studied are involved in EDN upregulation by BA. Alternatively, this facet of EDN regulation might involve mechanisms that cannot be studied in transient transfections, such as chromosome accessibility involving nucleosome displacement. On the other hand, the observed induction of EDN mRNA might well be caused by posttranscriptional mechanisms, such as changes in mRNA stability or RNA processing. Further study is necessary to shed light on the mechanism by which BA induces EDN mRNA expression in HL60 7.7 cells.

Taken together, we have shown that PU.I is likely to play an important role in the regulation of EDN expression in eosinophils. Importantly, in the highly homologous ECP gene, the tandem PU.I site is 100% conserved.14 Moreover, other genes that are expressed in eosinophils, such as CLC49 and the beta  chain of the IL-5R (van Dijk et al, manuscript in preparation), also contain PU.I sites in their regulatory regions. These data suggest that, besides its role in neutrophils and macrophages, PU.I is likely to play an important role in gene regulation during terminal differentiation of eosinophils.

    FOOTNOTES

   Submitted June 6, 1997; accepted October 31, 1997.
   Supported by a research grant from Glaxo-Wellcome bv.
   Address reprint requests to Rolf P. de Groot, PhD, Department of Pulmonary Diseases, G03.550, University Hospital Utrecht, Heidelberglaan 100, 3584 CX Utrecht, The Netherlands.
   The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. section 1734 solely to indicate this fact.

    ACKNOWLEDGMENT

The authors thank Dr Marc van Dijk for providing reagents.

    REFERENCES
Abstract
Introduction
Methods
Results
Discussion
References

1. Kroegel C, Warner JA, Virchow JC Jr, Matthys H: Pulmonary immune cells in health and disease: the eosinophil leucocyte (part II). Eur Respir J 7:743, 1994[Abstract]

2. Gleich GJ, Adolphson CR: The eosinophilic leukocyte: Structure and function. Adv Immunol 39:177, 1986[Medline] [Order article via Infotrieve]

3. Gundel RH, Letts LG, Gleich GJ: Human eosinophil major basic protein induces airway constriction and airwayhyperresponsiveness in primates. J Clin Invest 87:1470, 1991

4. Yazdanbakhsh M, Tai PC, Spry CJ, Gleich GJ, Roos D: Synergism between eosinophil cationic protein and oxygen metabolites in killing of schistosomula of Schistosoma mansoni. J Immunol 138:3443, 1987[Abstract]

5. Kroegel C, Virchow JC Jr, Luttmann W, Walker C, Warner JA: Pulmonary immune cells in health and disease: The eosinophil leucocyte (part I). Eur Respir J 7:519, 1994[Abstract]

6. Hamann KJ, Barker RL, Ten RM, Gleich GJ: The molecular biology of eosinophil granule proteins. Int Arch Appl Immunol 94:202, 1991

7. Hamann KJ, Barker RL, Loegering DA, Pease LR, Gleich GJ: Sequence of human eosinophil-derived neurotoxin cDNA: Identity of deducedamino acid sequence with human nonsecretory ribonucleases. Gene 83:161, 1989[Medline] [Order article via Infotrieve]

8. Barker RL, Loegering DA, Ten RM, Hamann KJ, Pease LR, Gleich GJ: Eosinophil cationic protein cDNA. Comparison with other toxic cationicproteins and ribonucleases. J Immunol 143:952, 1989[Abstract]

9. Rosenberg HF, Tenen DG, Ackerman SJ: Molecular cloning of the human eosinophil-derived neurotoxin: A member ofthe ribonuclease gene family. Proc Natl Acad Sci USA 86:4460, 1989[Abstract/Free Full Text]

10. Rosenberg HF, Ackerman SJ, Tenen DG: Human eosinophil cationic protein. Molecular cloning of a cytotoxin and helminthotoxin with ribonuclease activity. J Exp Med 170:163, 1989[Abstract/Free Full Text]

11. Hamann KJ, Ten RM, Loegering DA, Jenkins RB, Heise MT, Schad CR, Pease LR, Gleich-GJ, Barker RL: Structure and chromosome localization of the human eosinophil-derived neurotoxin and eosinophil cationic protein genes: Evidence for intronless coding sequences in the ribonuclease gene superfamily. Genomics 7:535, 1990[Medline] [Order article via Infotrieve]

12. Gruart V, Truong MJ, Plumas J, Zandecki M, Kusnierz JP, Prin L, Vinatier D, Capron A, Capron M: Decreased expression of eosinophil peroxidase and major basic protein messenger RNAs during eosinophil maturation. Blood 79:2592, 1992[Abstract/Free Full Text]

13. Tiffany HL, Handen JS, Rosenberg HF: Enhanced expression of the eosinophil-derived neurotoxin ribonuclease (RNS2) gene requires interaction between the promoter and intron. J Biol Chem 271:12387, 1996[Abstract/Free Full Text]

14. Handen JS, Rosenberg HF: Intronic enhancer activity of the eosinophil-derived neurotoxin (RNS2) and eosinophil cationic protein (RNS3) genes is mediated by an NFAT-1 consensus binding sequence. J Biol Chem 272:1665, 1997[Abstract/Free Full Text]

15. Janknecht R, Nordheim A: Gene regulation by Ets proteins. Biochim Biophys Acta 1155:346, 1993[Medline] [Order article via Infotrieve]

16. Karim FD, Urness LD, Thummel CS, Klemsz MJ, McKercher SR, Celada A, Van-Beveren C, Maki RA, Gunther CV, Nye JA, : The ETS-domain: A new DNA-binding motif that recognizes a purine-rich core. Genes Dev 4:1451, 1990[Free Full Text]

17. Kodandapani R, Pio F, Ni CZ, Piccialli G, Klemsz M, McKercher S, Maki RA, Ely KR: A new pattern for helix-turn-helix recognition revealed by the PU.1 ETS-domain-DNA complex. Nature 380:456, 1996[Medline] [Order article via Infotrieve]

18. Klemsz MJ, McKercher SR, Celada A, van Beveren C, Maki RA: The macrophage and B cell-specific transcription factor PU.1 is related to the ets oncogene. Cell 61:113, 1990[Medline] [Order article via Infotrieve]

19. Galson DL, Hensold JO, Bishop TR, Schalling M, D'Andrea AD, Jones C, Auron PE, Housman DE: Mouse beta-globin DNA-binding protein B1 is identical to a proto-oncogene, the transcription factor Spi-1/PU.1, and is restricted in expression to hematopoietic cells and the testis. Mol Cell Biol 13:2929, 1993[Abstract/Free Full Text]

20. Hromas R, Orazi A, Neiman RS, Maki R, Van Beveran C, Moore J, Klemsz M: Hematopoietic lineage- and stage-restricted expression of the ETS oncogene family member PU.1. Blood 82:2998, 1993[Abstract/Free Full Text]

21. Chen HM, Zhang P, Voso MT, Hohaus S, Gonzalez DA, Glass CK, Zhang DE, Tenen DG: Neutrophils and monocytes express high levels of PU.1 (Spi-1) but not Spi-B. Blood 85:2918, 1995[Abstract/Free Full Text]

22. Moulton KS, Semple K, Wu H, Glass CK: Cell-specific expression of the macrophage scavenger receptor gene is dependent on PU.1 and a composite AP-1/ets motif. Mol Cell Biol 14:4408, 1994[Abstract/Free Full Text]

23. Pahl HL, Scheibe RJ, Zhang DE, Chen HM, Galson DL, Maki RA, Tenen DG: The proto-oncogene PU.1 regulates expression of the myeloid-specific CD11b promoter. J Biol Chem 268:5014, 1993[Abstract/Free Full Text]

24. Rosmarin AG, Caprio D, Levy R, Simkevich C: CD18 (beta 2 leukocyte integrin) promoter requires PU.1 transcription factor for myeloid activity. Proc Natl Acad Sci USA 92:801, 1995[Abstract/Free Full Text]

25. Perez C, Coeffier E, Moreau Gachelin F, Wietzerbin J, Benech PD: Involvement of the transcription factor PU.1/Spi-1 in myeloid cell-restricted expression of an interferon-inducible gene encoding the human high-affinity Fc gamma receptor. Mol Cell Biol 14:5023, 1994[Abstract/Free Full Text]

26. Ford AM, Bennett CA, Healy LE, Towatari M, Greaves MF, Enver T: Regulation of the myeloperoxidase enhancer binding proteins Pu1, C-EBP alpha, -beta, and -delta during granulocyte-lineage specification. Proc Natl Acad Sci USA 93:10838, 1996[Abstract/Free Full Text]

27. Oelgeschlager M, Nuchprayoon I, Luscher B, Friedman AD: C/EBP, c-Myb, and PU.1 cooperate to regulate the neutrophil elastase promoter. Mol Cell Biol 16:4717, 1996[Abstract]

28. Feinman R, Qiu WQ, Pearse RN, Nikolajczyk BS, Sen R, Sheffery M, Ravetch JV: PU.1 and an HLH family member contribute to the myeloid-specific transcription of the Fc gamma RIIIA promoter. EMBO J 13:3852, 1994[Medline] [Order article via Infotrieve]

29. Sturrock A, Franklin KF, Hoidal JR: Human proteinase-3 expression is regulated by PU.1 in conjunction with a cytidine-rich element. J Biol Chem 271:32392, 1996[Abstract/Free Full Text]

30. Smith LT, Hohaus S, Gonzalez DA, Dziennis SE, Tenen DG: PU.1 (Spi-1) and C/EBP alpha regulate the granulocyte colony-stimulating factor receptor promoter in myeloid cells. Blood 88:1234, 1996[Abstract/Free Full Text]

31. Zhang DE, Hetherington CJ, Chen HM, Tenen DG: The macrophage transcription factor PU.1 directs tissue-specific expression of the macrophage colony-stimulating factor receptor. Mol Cell Biol 14:373, 1994[Abstract/Free Full Text]

32. Hohaus S, Petrovick MS, Voso MT, Sun Z, Zhang DE, Tenen DG: PU.1 (Spi-1) and C/EBP alpha regulate expression of the granulocyte-macrophage colony-stimulating factor receptor alpha gene. Mol Cell Biol 15:5830, 1995[Abstract]

33. Brass AL, Kehrli E, Eisenbeis CF, Storb U, Singh H: Pip, a lymphoid-restricted IRF, contains a regulatory domain that is important for autoinhibition and ternary complex formation with the Ets factor PU.1. Genes Dev 10:2335, 1996[Abstract/Free Full Text]

34. Eisenbeis CF, Singh H, Storb U: Pip, a novel IRF family member, is a lymphoid-specific, PU.1-dependent transcriptional activator. Genes Dev 9:1377, 1995[Abstract/Free Full Text]

35. Scott EW, Simon MC, Anastasi J, Singh H: Requirement of transcription factor PU.1 in the development of multiple hematopoietic lineages. Science 265:1573, 1994[Abstract/Free Full Text]

36. McKercher SR, Torbett BE, Anderson KL, Henkel GW, Vestal DJ, Baribault H, Klemsz M, Feeney AJ, Wu GE, Paige CJ, Maki RA: Targeted disruption of the PU.1 gene results in multiple hematopoietic abnormalities. EMBO J 15:5647, 1996[Medline] [Order article via Infotrieve]

37. Olson MC, Scott EW, Hack AA, Su GH, Tenen DG, Singh H, Simon MC: PU. 1 is not essential for early myeloid gene expression but is required for terminal myeloid differentiation. Immunity 3:703, 1995[Medline] [Order article via Infotrieve]

38. Voso MT, Burn TC, Wulf G, Lim B, Leone G, Tenen DG: Inhibition of hematopoiesis by competitive binding of transcription factor PU.1. Proc Natl Acad Sci USA 91:7932, 1994[Abstract/Free Full Text]

39. de Groot RP, Karperien M, Pals C, Kruijer W: Characterization of the mouse junD promoter---High basal level activity due to an octamer motif. EMBO J 10:2523, 1991[Medline] [Order article via Infotrieve]

40. de Groot RP, Pals C, Kruijer W: Transcriptional control of c-jun by retinoic acid. Nucleic Acids Res 19:1585, 1991[Abstract/Free Full Text]

41. Chomczynski P, Sacchi N: Single step method of RNA isolation by guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156, 1987[Medline] [Order article via Infotrieve]

42. Caldenhoven E, Vandijk TB, Solari R, Armstrong J, Raaijmakers JAM, Lammers JWJ, Koenderman L, Degroot RP: STAT3 beta, a splice variant of transcription factor STAT3, is a dominant negative regulator of transcription. J Biol Chem 271:13221, 1996[Abstract/Free Full Text]

43. de Groot RP, van Dijk TB, Caldenhoven E, Coffer PJ, Raaijmakers JAM, Lammers JJ, Koenderman L: Activation of 12-o-tetradecanoylphorbol-13-acetate response element- and dyad symmetry element-dependent transcription by interleukin-5 is mediated by Jun N-terminal kinase/stress-activated protein kinase kinases. J Biol Chem 272:2319, 1997[Abstract/Free Full Text]

44. van Dijk TB, Bracke M, Caldenhoven E, Raaijmakers JA, Lammers JW, Koenderman L, de Groot RP: Cloning and characterization of Fc alpha Rb, a novel Fc alpha receptor (CD89) isoform expressed in eosinophils and neutrophils. Blood 88:4229, 1996[Abstract/Free Full Text]

45. Futami J, Tsushima Y, Murato Y, Tada H, Sasaki J, Seno M, Yamada H: Tissue-specific expression of five human pancreatic-type RNases and RNase inhibitor in humans. DNA Cell Biol 16:413, 1997[Medline] [Order article via Infotrieve]

46. Fischkoff SA: Graded increase in probability of eosinophilic differentiation of HL-60 promyelocytic leukemia cells induced by culture under alkaline conditions. Leuk Res 12:679, 1988[Medline] [Order article via Infotrieve]

47. Carey JO, Posekany KJ, deVente JE, Pettit GR, Ways DK: Phorbol ester-stimulated phosphorylation of PU.1: Association with leukemic cell growth inhibition. Blood 87:4316, 1996[Abstract/Free Full Text]

48. Lodie TA, Savedra R, Golenbock DT, van Beveren C, Maki RA, Fenton MJ: Stimulation of macrophages by lipopolysaccharide alters the phosphorylation state, conformation, and function of PU.I via activation of casein kinase II. J Immunol 158:1848, 1997[Abstract]

49. Gomolin HI, Yamaguchi Y, Paulpillai AV, Dvorak LA, Ackerman SJ, Tenen DG: Human eosinophil Charcot-Leyden crystal protein: Cloning and characterization of a lysophospholipase gene promoter. Blood 82:1868, 1993[Abstract/Free Full Text]


© 1998 by The American Society of Hematology.
 
0006-4971/98/91-0021$3.00/0

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
BloodHome page
J. M. Beekman, L. P. Verhagen, N. Geijsen, and P. J. Coffer
Regulation of myelopoiesis through syntenin-mediated modulation of IL-5 receptor output
Blood, October 29, 2009; 114(18): 3917 - 3927.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Z. Qiu, K. D. Dyer, Z. Xie, M. Radinger, and H. F. Rosenberg
GATA Transcription Factors Regulate the Expression of the Human Eosinophil-derived Neurotoxin (RNase 2) Gene
J. Biol. Chem., May 8, 2009; 284(19): 13099 - 13109.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
A. Verbrugge, T. de Ruiter, C. Geest, P. J. Coffer, and L. Meyaard
Differential expression of leukocyte-associated Ig-like receptor-1 during neutrophil differentiation and activation
J. Leukoc. Biol., April 1, 2006; 79(4): 828 - 836.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
K. D. Dyer and H. F. Rosenberg
The mouse RNase 4 and RNase 5/ang 1 locus utilizes dual promoters for tissue-specific expression
Nucleic Acids Res., February 18, 2005; 33(3): 1077 - 1086.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. F. Gombart, S. H. Kwok, K. L. Anderson, Y. Yamaguchi, B. E. Torbett, and H. P. Koeffler
Regulation of neutrophil and eosinophil secondary granule gene expression by transcription factors C/EBPepsilon and PU.1
Blood, April 15, 2003; 101(8): 3265 - 3273.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Du, M. J. Stankiewicz, Y. Liu, Q. Xi, J. E. Schmitz, J. A. Lekstrom-Himes, and S. J. Ackerman
Novel Combinatorial Interactions of GATA-1, PU.1, and C/EBPepsilon Isoforms Regulate Transcription of the Gene Encoding Eosinophil Granule Major Basic Protein
J. Biol. Chem., November 1, 2002; 277(45): 43481 - 43494.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
J. Zhang and H. F. Rosenberg
Sequence Variation at Two Eosinophil-Associated Ribonuclease Loci in Humans
Genetics, December 1, 2000; 156(4): 1949 - 1958.
[Abstract] [Full Text]


Home page
J. Immunol.Home page
T. B. van Dijk, B. Baltus, J. A. M. Raaijmakers, J.-W. J. Lammers, L. Koenderman, and R. P. de Groot
A Composite C/EBP Binding Site Is Essential for the Activity of the Promoter of the IL-3/IL-5/Granulocyte-Macrophage Colony-Stimulating Factor Receptor {beta}c Gene
J. Immunol., September 1, 1999; 163(5): 2674 - 2680.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
A. Iwama, J. Pan, P. Zhang, W. Reith, B. Mach, D. G. Tenen, and Z. Sun
Dimeric RFX Proteins Contribute to the Activity and Lineage Specificity of the Interleukin-5 Receptor alpha  Promoter through Activation and Repression Domains
Mol. Cell. Biol., June 1, 1999; 19(6): 3940 - 3950.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
M. A. Giembycz and M. A. Lindsay
Pharmacology of the Eosinophil
Pharmacol. Rev., June 1, 1999; 51(2): 213 - 340.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. B. van Dijk, B. Baltus, E. Caldenhoven, H. Handa, J. A.M. Raaijmakers, J.-W. J. Lammers, L. Koenderman, and R. P. de Groot
Cloning and Characterization of the Human Interleukin-3 (IL-3)/IL-5/ Granulocyte-Macrophage Colony-Stimulating Factor Receptor beta c Gene: Regulation by Ets Family Members
Blood, November 15, 1998; 92(10): 3636 - 3646.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by van Dijk, T. B.
Right arrow Articles by de Groot, R. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by van Dijk, T. B.
Right arrow Articles by de Groot, R. P.
Related Collections
Right arrow Phagocytes
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 1998 by American Society of Hematology         Online ISSN: 1528-0020