|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 91 No. 6 (March 15), 1998:
pp. 2126-2132
The Role of Transcription Factor PU.I in the Activity of the Intronic
Enhancer of the Eosinophil-Derived Neurotoxin (RNS2) Gene
By
Thamar B. van Dijk,
Eric Caldenhoven,
Jan A.M. Raaijmakers,
Jan-Willem J. Lammers,
Leo Koenderman, and
Rolf P. de Groot
From the Department of Pulmonary Diseases, University Hospital
Utrecht, Utrecht, The Netherlands.
 |
ABSTRACT |
Eosinophil-derived neurotoxin (EDN) found in the granules of human
eosinophils is a cationic ribonuclease toxin. Expression of the EDN
gene (RNS2) in eosinophils is dependent on proximal promoter sequences
in combination with an enhancer located in the first intron. We further
define here the active region of the intron using transfections in
differentiated eosinophilic HL60 cells. We show that a region
containing a tandem PU.I binding site is important for intronic
enhancer activity. This region binds multiple forms of transcription
factor PU.I as judged by gel-shift analysis and DNA affinity
precipitation. Importantly, introducing point mutations in the PU.I
site drastically reduces the intronic enhancer activity, showing the
importance of PU.I for expression of EDN in cells of the eosinophilic
lineage.
 |
INTRODUCTION |
EOSINOPHILS PLAY an important role in
protection against parasitic diseases and are involved in the
pathogenesis of allergic diseases.1,2 Parasite killing and
tissue damage seen in allergic lesions are both linked to the release
of eosinophil granule proteins by degranulation or exocytosis and
production of toxic oxygen metabolites.1,3,4
Eosinophil-derived cytotoxic proteins include major basic protein
(MBP), eosinophil peroxidase (EPO), eosinophil cationic protein (ECP),
and eosinophil derived neurotoxin (EDN).2,5
EDN is localized in the granule matrix in the human eosinophil and
possesses neurotoxic, helminthotoxic, and ribonucleolytic activities.6 EDN is synthesized as a preprotein of 161 amino acids including a 27 amino acid signal peptide, which is
processed to form the mature protein.7-10
The EDN gene consists of two exons separated by a single intron, of
which the second exon contains the complete coding region and
3 -untranslated sequences.11 These structural
features are shared with other genes of the RNAse gene superfamily,
such as ECP.11 EDN mRNA can be detected in the RNA from
hypodense eosinophils9 and during the promyelocytic stage
of eosinophil development as judged by in vitro differentiation of cord
blood mononuclear cells.12 Similarly, EDN mRNA expression
can be detected in the promyelocytic HL60 cell line when it is induced
to differentiate with interleukin-5 (IL-5)9 or butyric acid
(BA).13
Previously, it was shown that optimal expression of EDN in HL60 cells
is dependent on the interaction of the proximal promoter sequences and
the intron.13 The EDN intron contains consensus binding
sites for transcription factors AP-1, NF-AT, and PU.I.13 Recently, it was shown that the NF-AT site plays an important role in
the activity of the intronic enhancer in undifferentiated HL60 cells,
whereas its contribution in the more eosinophil-differentiated HL60
clone 15 cell line was limited.14 By contrast,
the contributions of the AP-1 and PU.I sites to the activity of the
intron remain obscure. Because AP-1 was not previously shown to play a
specific role in myeloid cells, we focused our attention on the role of PU.I.
PU.I was originally identified as the product of the Spi-I oncogene in
Friend virus induced erythroleukemias (reviewed in Janknecht and
Nordheim15). Transcription factor PU.I was then characterized as a member of the ets multigene family, which bind to a
purine-rich sequence containing the GGAA core sequence
motif.15,16 Members of the ets-family of transcription
factors share a conserved 85 amino acid domain, the ets domain, which
is responsible for sequence-specific DNA binding and has some homology
with the winged helix-turn-helix family of proteins.15,17
PU.I is expressed in hematopoietic cells, predominantly in the B-cell
and myeloid lineages.18-21 The PU.I cis-acting DNA element
is found to be essential for the activity of numerous myeloid-specific
promoters, including the macrophage scavenger receptor
gene,22 CD11b,23 CD18,24 CD64,25 myeloperoxidase,26 neutrophil
elastase,27 Fc RIIIA,28 proteinase-3,29 the granulocyte colony-stimulating factor
(G-CSF) receptor,30 the macrophage colony-stimulating
factor (M-CSF) receptor,31 and the granulocyte-macrophage
colony-stimulating factor (GM-CSF) receptor.32 It was also
shown that PU.I can functionally interact with other classes of
transcription factors, such as NF-EM5/PIP.33,34 Gene
targeting experiments have shown that PU.I is required for the
development of lymphoid and myeloid lineages during fetal liver
hematopoiesis.35,36 Similarly, blocking PU.I function in
vitro in ES cells37 or CD34+
cells38 further demonstrates the essential role of PU.I
during myelopoiesis.
We show here that a PU.I site in the intron of the EDN gene is
important in optimal expression in eosinophilic HL60 cells. Multiple
forms of PU.I that are expressed in differentiating HL60 cells bind to
the intronic PU.I site. Mutation of the PU.I site strongly decreases
the activity of the EDN promoter/intron combination. This is the first
report showing the importance of PU.I for the expression of genes in
the eosinophil lineage.
 |
MATERIALS AND METHODS |
Cells, plasmids, oligonucleotides, and antibodies.
HL60 cells were cultured in RPMI medium (Life Technologies, Breda, The
Netherlands) containing 8% fetal calf serum (FCS). HL60 7.7 cells were
generated by culturing HL60 cells for 2 months at pH 7.7 in RPMI
containing 25 mmol/L
N-[2-Hydroxyethyl]piperazine-N -3-propane-sulfonic acid (EPPS;
Sigma, St Louis, MO). To further differentiate HL60 7.7 cells, butyric
acid (0.5 mmol/L; Sigma) was added for 2 to 5 days. HeLa cells were
grown in Dulbecco's modified Eagles medium (DMEM; Life
Technologies) containing 8% FCS.
The EDN promoter/intron ( 300 to +298) was cloned by polymerase
chain reaction (PCR) using human genomic DNA. The amplified fragment
was then sequenced and cloned into the promoterless CAT reporter
plasmid pBLCAT3. Intron deletion constructs (+193, +193 PU.I, +123,
and +67) were generated by PCR and cloned into pBLCAT3. Site-directed
mutagenesis was performed as described previously.39 The
actin reporter and the GAPDH probe are described
elsewhere.40
The following oligonucleotides were used in this study: for PCR cloning
of the EDN promoter/intron, EDN-F (CCTGTAAGAAAAGAAGAG) and EDN-R
(CACCGCTCCTGTCAGCCA); for the generation of intron deletions, EDN +193
(CGGGATCCATTTCCTTTACTTCCTGTC), EDN+193 d PU.I (CGGGATCC ATTGCCTTTACTGCCTGTC), EDN +123 (CGGGATCCAGTTGCTGCCCCATTGC), and EDN +67
(CGGGATCCAGTCTCCGCGCTGTAG); for site-directed mutagenesis of the PU.I
site, PU.I mut1 (CTTTGCAG ACAGGCCTTAAAGGAAATGGG), PU.I mut2
(CAGGAAGTAAAG GCCTTGGGACCCAGAGT), and PU.I mut3 (GCAGACAGGCAGTAA AGGCAATGGGACC); for band-shift analysis (only upper strand is shown),
EDN PU.I wt (AGCTTGACAGGAAGTAAAGGAAATG) and EDN-PU.I mut (AGCTTGACAGGCAGTAAAGGCAATG); and for the PCR cloning of an EDN probe
for Northern analysis, EDN-RNA-F (CTTCTGTTGGGGCTTCTG) and EDN-RNA-R
(TTGGAGTTGTGAGGTTAC).
The following antibodies were used in this study: anti-PU.I (rabbit
polyclonal IgG T-21, SC-352; Santa Cruz, Santa Cruz, CA) and anti-STAT3
(rabbit polyclonal IgG C-20, SC-482; Santa Cruz).
RNA isolation, reverse transcription, PCR, and Northern blotting.
Total cellular RNA was isolated by the guanidine isothiocyanate-acid
phenol method.41 For the isolation of an EDN-specific probe
for Northern blotting, RNA was reverse transcribed using murine Maloney
leukemia virus (M-MLV) reverse transcriptase according to
the manufacturer's protocols (Life Technologies). PCR was performed in
a total volume of 20 µL with 5 µL cDNA synthesis mixture for 36 cycles of 94°C denaturation (1 minute), 52°C annealing (1.5 minutes), and 72°C extension (2 minutes). For Northern blotting, RNA (20 µg) was electrophoretically separated on 0.8% agarose gels
and transferred to Hybond (Amersham, Arlington Heights, IL). Blots were
hybridized with randomly 32P-labeled EDN or GAPDH fragments
overnight at 42°C in hybridization buffer, washed. and exposed to
film as described previously.40
Transient transfections.
For transfection experiments, HeLa cells were subcultured in 6-well
dishes and transfected with 10 to 20 µg supercoiled plasmid DNA 16 hours later, as described previously.42,43 HL60 cells (10 × 106 cells per sample) were transfected with 20 µg
plasmid DNA by electroporation (280 V, 960 µF). The CMV-LacZ plasmid
(2 µg) was included to correct for differences in transfection
efficiency between different samples. Transfected cells were harvested
48 hours later for CAT assays. CAT assays were performed as follows. Cells were lyzed by repeated freeze-thawing in 250 mmol/L Tris, pH7.4,
25 mmol/L EDTA. Twenty-five micrograms of cellular extract was then
incubated in a total volume of 100 µL containing 250 mmol/L Tris, pH
7.4, 2% glycerol, 0.3 mmol/L Butyryl Coenzyme A (Sigma), and 0.05 µCi 14C Chloroamphenicol (Amersham) for 2 hours at
37°C. Reaction products were then extracted using 400 µL
xylene/pristane (1:2), and the percentage of acetylated products was
then determined using liquid scintillation counting. All experiments
were performed at least four times.
In vitro translation, gel retardation assay, and DNA affinity
precipitation.
PU.I cDNA was translated in vitro using the TnT-coupled reticulocyte
lysate system (Promega, Madison, WI) according to the manufacturer's protocol. Nuclear extracts were prepared as described previously.42 Oligonucleotides were labeled by filling in
the cohesive ends with [ -32P]dCTP using Klenow
fragment of DNA polymerase I. Gel retardation assays were performed
according to published procedures with slight modifications. Briefly,
nuclear extracts (10 µg) were incubated in a final volume of 20 µL
containing 20 mmol/L
N-[2-hydroxyethyl]piperazine-N -[2-ethanesulfonic acid]
(HEPES), pH 7.9, 50 mmol/L KCL, 0.1 mmol/L ethylenediaminetetraacetic acid (EDTA), 2 mmol/L MgCl2, 10% (vol/vol) glycerol, 1 mmol/L dithiothreitol, 1 µg poly(dI-dC) (Pharmacia, Uppsala, Sweden), and 1.0 ng of 32P-labeled EDN-PU.I oligonucleotide for 20 minutes at room temperature. Complexes were then separated though
nondenaturing 5% polyacrylamide gels and visualized by
autoradiography. For supershift analysis, nuclear extracts were
preincubated with 1 µg anti-PU.I antibody (SC352X; Santa Cruz) for 30 minutes on ice before the addition of the labeled probe.
For DNA affinity precipitation, nuclear extract was prepared from
20 × 106 cells. The extract was diluted to
400 µL with dilution buffer (10 mmol/L HEPES, pH 7.9, 50 mmol/L KCl, 1 mmol/L EDTA, 5 mmol/L MgCl2, 10% glycerol)
and precleared with 25 µL streptavidin-agarose beads (Sigma) for 15 minutes at 4°C. The extract was then incubated with 25 µL of
biotinylated EDN oligonucleotide coupled to streptavidin-agarose beads
(Sigma) in the presence of 2 µg poly(dI-dC) and 20 µg bovine serum
albumin. After incubation for 1 hour at 4°C, protein-DNA complexes
were washed three times with dilution buffer. After boiling for 3 minutes in Laemmli sample buffer, samples were separated on 12% sodium
dodecyl sulphate-polyacrylamide gels and electro-transferred to
Immobilon-P membranes (Millipore, Bedford, MA). Membranes were blocked
in TBST-buffer (150 mmol/L NaCl, 10 mmol/L Tris, pH 8.0, 0.3% Tween
20) containing 5% nonfat milk for 30 minutes and probed with anti-PU.I
antibody (1 ng/mL; SC352X; Santa Cruz) for 1 hour. After three washes
with TBST, the membranes were incubated for 1 hour with
peroxidase-conjugated goat-antirabbit antibodies (DAKO, Glostrup,
Denmark), followed by five washes with TBST. Proteins were visualized
with enhanced chemiluminescence (Amersham).
Direct immunoprecipitation was performed as described
previously.44
 |
RESULTS |
It was previously shown that EDN mRNA expression is strongly enhanced
in BA-treated HL60 clone 15 cells.13 To investigate whether
in HL60 cells differentiated at pH 7.7 EDN expression is also
responsive to BA, RNA was isolated from HL60 7.7 cells treated for
various periods with BA. Figure 1 shows
that EDN mRNA is weakly expressed in parental HL60 and HL60 7.7 cells.
However, EDN expression is strongly upregulated by BA treatment within 1 to 2 days, whereas EDN mRNA is maximal 4 days after BA addition. Reprobing the blot with a GAPDH probe shows that equal amounts of RNA
were loaded in each lane. These results demonstrate that HL60 7.7 cells
are suitable for studying the regulation of the EDN promoter.

View larger version (51K):
[in this window]
[in a new window]
| Fig 1.
Upregulation of EDN expression during eosinophilic
differentiation of HL60 cells. HL60 7.7 cells were treated with BA (0.5 mmol/L) for 1, 2, 4, or 6 days, after which RNA was isolated and analyzed by Northern blotting. Hybridization of the blot with a probe
specific for EDN shows that EDN mRNA expression is strongly induced by
BA. Reprobing of the blot with a GAPDH probe shows that equal amounts
of RNA were loaded in each lane. Scanning of the autoradiograph shows
the following increase in EDN expression (relative to GAPDH) compared
with wild-type HL60 cells: 2-, 5-, 45-, 160-, and 130-fold increase for
7.7 cells treated for 0, 1, 2, 4, and 6 days, respectively.
|
|
Next, we cloned the EDN promoter/intron into the pBLCAT3 reporter
plasmid and tested its activity in HL60 cells.
Figure 2 shows that this reporter is active
in HL60 cells compared with a promoterless CAT construct. Moreover, its
activity is upregulated by BA during HL60 differentiation when compared
with a reporter containing the actin promoter ( actin-CAT).
Transfection of these constructs into HeLa cells shows that the EDN
promoter is not active in all cell types, but has some hematopoietic
specificity, as was also suggested by Tiffany et al.13

View larger version (27K):
[in this window]
[in a new window]
| Fig 2.
The EDN promoter/intron combination is active in HL60
cells and their differentiated derivatives. HL60, HL60 7.7, and HeLa cells (10 × 106 per transfection) were transfected with a
CAT reporter construct containing the EDN promoter and the first intron
(EDN-CAT; 20 µg), the empty vector without EDN sequences (pBLCAT3; 20 µg), or a positive control containing the promoter of the -actin
gene ( actin-CAT; 20 µg) by electroporation (HL60 cells, 280 V,
960 µF) or calcium phosphate precipitation (HeLa cells). Some cells received BA (0.5 mmol/L) 1 hour after transfection (HL60 7.7/BA). Two
days posttransfection, cells were harvested and assayed for CAT
activity. Bars indicate the mean percentage of acetylation of at least
four independent experiments. The standard deviation is indicated by
error bars. The EDN reporter construct is clearly active in HL60 cells
and their differentiated derivatives, but not in nonhematopoietic HeLa
cells.
|
|
It was previously shown that the intron of the EDN gene is of major
importance for the activity of the EDN promoter in HL60 c15
cells.13 To identify the sequences important for the
activity of the intron, we constructed a number of intron-deletion
constructs that are schematically shown in
Fig 3A. The activity of these constructs
was then tested in HL60 cells and HL60 7.7 cells treated with BA. As
shown in Fig 3B, deletion of 105 nucleotides from the intron including
the AP1 binding site (+193) reduces CAT activity by about 40%. Further
deletion to +123 including a tandem PU.I site and an NFAT site strongly
reduces CAT activity, whereas deletion of the complete intron (+67)
completely abolishes CAT activity. To investigate the role of the PU.I
site further, we constructed a +193 construct with a mutated PU.I site
(+193 PU.I). Surprisingly, this reduces CAT activity down to the
level of the +123 construct, suggesting that the PU.I site is of major
importance for the activity of the EDN intron.

View larger version (25K):
[in this window]
[in a new window]
| Fig 3.
The PU.I site in the intron is important for the enhancer
function of the EDN intron. (A) Schematic representation of the EDN
promoter and intron. Putative transcription factor binding sites (CAAT
box, AP1 sites, NFAT site, and PU.I site) are indicated as boxes. The
arrows indicate the 3 ends of the reporter constructs used in
(B). ex1, exon 1. (B) The EDN reporter constructs described in (A) and
the control vector pBLCAT3 were transfected into HL60 or HL60 7.7 cells
as described in Fig 2. Construct +193 d PU.I contains point mutations
in the PU.I site. The HL60 7.7 cells received BA 1 hour after
transfection. CAT activity was determined 48 hours posttransfection.
Bars indicate the mean percentage of acetylation of at least four
independent experiments. The standard deviation is indicated by error
bars. It is clear that the intron is essential for the activity of the
EDN reporter construct, whereas the PU.I site seems to play a major
role in the activity of the intron.
|
|
To further study the importance of the PU.I site for the intronic
enhancer activity, we prepared different point mutations in the
background of the complete promoter/intron sequence. We mutated either
the first PU.I core element (PU.I mut1, Fig
4A) or the second (PU.I mut2) or both (PU.I mut1/2). The activity of
the different mutants was then tested in HL60, HL60 7.7, and HL60
7.7/BA cells (Fig 4B). Mutation of the first PU.I core sequence slightly reduces CAT activity, whereas mutation of the second site has
a somewhat stronger effect. Importantly, mutation of both sites leads
to a strong reduction in CAT activity, especially in HL60 7.7 and HL60
7.7/BA cells. Taken together, these results suggest that the PU.I site
in the EDN intron plays a major role in EDN expression in eosinophilic
cell lines.

View larger version (31K):
[in this window]
[in a new window]
| Fig 4.
The PU.I site is essential for the activity of the
intronic enhancer. (A) Schematic representation of the mutant reporter constructs. Only the sequence around the tandem PU.I site is shown. The
PU.I core binding sites are underlined. Mutations made are indicated in
bold type. (B) EDN-CAT constructs containing the full promoter and
intron with different mutations in the tandem PU.I site were
transfected into HL60 and HL60 7.7 cells and treated with BA as
described in Fig 2. Two days posttransfection, cells were harvested and
assayed for CAT activity. Bars indicate the mean percentage of
acetylation of at least four independent experiments. The standard
deviation is indicated by error bars. The double mutant in the tandem
PU.I site strongly reduces the activity of the EDN-CAT reporter
construct.
|
|
PU.I is a member of the multigene Ets transcription factor family (for
a review, see Janknecht and Nordheim15). To determine the
nature of the proteins binding to the PU.I site in the EDN intron, we
performed band shift analysis using the PU.I site as a probe. We
synthesized PU.I protein using a rabbit reticulocyte system and tested
the binding of this protein to the EDN PU.I site.
Figure 5A shows that unprogrammed lysate
forms two complexes with the PU.I probe, which cannot be competed with
either wild-type or mutant PU.I oligonucleotide (lanes 1 through 5). By
contrast, in vitro translated PU.I binds as four different complexes to the EDN PU.I site (lane 6). The four complexes can be competed with a
100-fold molar excess of unlabeled wild-type PU.I site (lanes 7 and 8),
but not with the mutant PU.I site (lanes 9 and 10). To determine
whether PU.I also binds this site in HL60 7.7/BA cells, nuclear
extracts were analyzed. Figure 5B shows that three different
protein/DNA complexes can be observed, which can be competed with a
100-fold molar excess of unlabeled wild-type PU.I site (lanes 2 and 3),
but not with the mutant PU.I site (lanes 4 and 5). Moreover,
preincubation of the nuclear extract with an anti-PU.I antibody results
in the formation of a supershift (lane 6), whereas an anti-STAT3
antibody did not alter binding. Similar results were obtained with HL60
and HL60 7.7 cells (not shown). These results indicate that the
intronic PU.I site is capable of binding PU.I in nuclear extracts of
HL60-derived cells.

View larger version (50K):
[in this window]
[in a new window]
| Fig 5.
PU.I binds to the PU.I site in the EDN intron. (A) PU.I
protein was generated in vitro using a rabbit reticulocyte lysate. PU.I
(lanes 6 through 10) or unprogrammed control reticulocyte lysate (lanes
1 through 5) was then tested in a bandshift assay for binding to the
PU.I site from the EDN intron. Arrows indicate four PU.I/DNA complexes
that are competed by excess PU.I oligo (lanes 7 and 8, 10- and
100-fold), but not by excess mutant PU.I oligo (lanes 9 and 10, 10- and
100-fold). Nonspecific complexes formed with control lysate are
indicated by open arrows. The free DNA probe is not shown. (B) Nuclear
extracts were prepared from HL60 7.7 cells treated for 4 days with BA.
These extracts were then tested for PU.I binding activity in a band
shift assay. Three protein/DNA complexes are observed (lane 1) that are
competed by excess PU.I oligo (lanes 2 and 3, 10- and 100-fold), but
not by excess mutant PU.I oligo (lanes 4 and 5, 10- and 100-fold). Preincubation with an anti-PU.I antibody (lane 6), but not with an
anti-STAT3 control antibody (lane 7) results in the appearance of two
supershifted complexes indicated by arrows. The free DNA probe is not
shown.
|
|
To more precisely determine the nature of the different protein/DNA
complexes observed with the EDN PU.I site, we performed DNA affinity
precipitation experiments. The PU.I site was labeled with biotinylated
dCTP, coupled to streptavidin agarose, and used as a probe to fish out
binding proteins from nuclear extracts. Interacting proteins were then
resolved on a polyacrylamide gel, blotted onto nylon filters, and
probed with an anti-PU.I antibody that is not cross-reactive with other
Ets family members. Figure 6A shows that
three different PU.I forms bind to the EDN PU.I site in HL60, HL60 7.7 and HL60 7.7/BA cells (lanes 1 through 3). Reprobing the blot with a
control antibody (anti STAT3) showed that all three bands indeed are
likely to represent different forms of PU.I (data not shown). When the
mutant PU.I site was used as a probe, binding of the two faster
migrating PU.I forms is strongly reduced, whereas the largest protein
binds significantly less (75% decrease) compared with the wild-type
probe (lanes 4 through 6). When we performed direct
immuno-precipitations of PU.I from the cells, the same three complexes
were observed, although in a slightly different ratio that might be
caused by different affinity of the PU.I antibody for the different
complexes in solution (Fig 6B) that are not evident when the antibody
is used on denatured protein (Fig 6A). Taken together, these results
strongly suggest that multiple forms of transcription factor PU.I are
expressed in HL60-derived cells and that all these forms are capable of interacting with the intronic PU.I binding site.

View larger version (21K):
[in this window]
[in a new window]
| Fig 6.
Multiple forms of PU.I bind to the intron of the EDN
gene. (A) DNA affinity precipitation of nuclear extracts from HL60 (H), HL60 7.7 (7), or BA-treated HL60 7.7 cells (B). Either wild-type (lanes
1 through 3) or mutant PU.I oligonucleotide (lanes 4 through 6) was
used as a probe. Proteins bound to these probes were precipitated, separated through a 12% polyacrylamide gel, and blotted onto nylon membranes. The filter was then probed with an anti-PU.I antibody. Three
different forms of PU.I bind to the wild-type PU.I probe, of which only
the largest form binds (with lower affinity) to the mutant probe. (B)
Immunoprecipitation of PU.I from HL60 (H), HL60 7.7 (7), or BA-treated
HL60 7.7 cells (B) using an anti-PU.I antibody. The precipitates were
visualized as in (A). The same three PU.I forms are detected as in
(A).
|
|
 |
DISCUSSION |
Expression of EDN mRNA is observed in cells of the eosinophilic lineage
as well as in human neutrophils9 and in human tissue containing phagocytes.45 In this report, we show that
transcription factor PU.I plays an important role in the activity of
the EDN promoter/intron, suggesting that PU.I is involved in expression of EDN in eosinophilic cells.
It was previously shown that PU.I is essential for the development of
lymphoid and myeloid lineages during fetal liver
hematopoiesis.35,36 Moreover, using PU.I / ES
cells, it was shown that PU.I is essential for terminal differentiation
of myeloid precursors to neutrophils and macrophages.37 In
these cells, expression of early myeloid markers, such as GM-CSF-R,
G-CSF-R, and myeloperoxidase was unaltered. By contrast, genes
associated with terminal myeloid differentiation, such as CD11b, CD64,
and M-CSFR, were not expressed in PU.I / ES
cells.37 However, the role of PU.I for eosinophilopoiesis was not determined. Our results might suggest that PU.I might well play
a role in gene regulation during terminal differentiation of
eosinophils comparable to its role in neutrophils.
Tiffany et al13 have shown that the EDN intron is essential
for optimal activity of the EDN promoter. The activity of the intron is
only obvious in hematopoietic cells, such as U937, K562, Jurkat,
HL60,13 and HL60 7.7 +/-BA (this study), but not in other
cell lines such as 29313 or HeLa (this study). It is
therefore likely that a transcription factor expressed mainly in
hematopoietic cells is involved in the activity of the intron. Of the
transcription factor binding sites present in the intron, both PU.I and
NFAT, but not AP-1, fit this criterion. Using our intron deletion
constructs, we have mapped the major determinant of the intron activity
to the tandem PU.I site (Figs 3 and 4). However, the first 60 bp of the
intron, containing the NFAT site, also contains some activity compared with an intronless promoter (Fig 3B). Very recently, Handen and Rosenberg14 have shown that mutation of the NFAT site
strongly represses the activity of the EDN intron in wild-type
undifferentiated HL60 cells. However, this effect is much weaker in the
more differentiated eosinophilic subclone HL60 c15, which was subcloned
from HL60 cells grown at pH 7.7,46 and is therefore likely
to be comparable with our HL60 7.7 cells.14 By contrast,
the effect of the PU.I mutation is stronger in the more differentiated
HL60 7.7 and HL60 7.7/BA cells as compared with the undifferentiated
parental HL60 cells (Fig 4B). These results suggest that the NFAT site
might play a role in EDN regulation early during myelopoiesis, whereas PU.I is more important later during terminal eosinophilic
differentiation. Interestingly, a similar role for PU.I was recently
demonstrated by Olson et al,37 who have shown that PU.I is
not essential for early myeloid gene expression but is required for
terminal myeloid differentiation.
We have shown that multiple forms of PU.I interact with the EDN PU.I
site (Figs 5 and 6). However, we cannot rule out the possibility that
only one form of PU.I interacts directly with the PU.I site, whereas
the other complexes represent PU.I forms interacting with the DNA bound
PU.I form. These different forms might represent different serine or
threonine phosphorylations of PU.I. Although the difference in size
between the different forms of PU.I is rather large, it is not
unprecedented, because different phosphorylated forms differing 9 kD
were previously shown during monocytic differentiation of U937 cells
with 12-O-tetradecanoylphorbol-13-acetate.47 Similarly,
stimulation of macrophages with lipopolysaccharide also
results in serine phosphorylation of PU.I.48 It was also suggested that these different forms might have distinct
trans-activation potentials.48 Further experiments are
necessary to study the role of the different PU.I forms in the
regulation of the activity of the EDN intron.
EDN mRNA is strongly upregulated during eosinophilic differentiation of
HL60 cells with BA (Tiffany et al13 and Fig 1). However,
the activity of the EDN intron/promoter combination is only modestly
increased during this process. This might indicate that other enhancers
located more upstream or downstream from the sequences that we have
studied are involved in EDN upregulation by BA. Alternatively, this
facet of EDN regulation might involve mechanisms that cannot be studied
in transient transfections, such as chromosome accessibility involving
nucleosome displacement. On the other hand, the observed induction of
EDN mRNA might well be caused by posttranscriptional mechanisms, such
as changes in mRNA stability or RNA processing. Further study is
necessary to shed light on the mechanism by which BA induces EDN mRNA
expression in HL60 7.7 cells.
Taken together, we have shown that PU.I is likely to play an important
role in the regulation of EDN expression in eosinophils. Importantly,
in the highly homologous ECP gene, the tandem PU.I site is 100%
conserved.14 Moreover, other genes that are expressed in
eosinophils, such as CLC49 and the chain of the IL-5R
(van Dijk et al, manuscript in preparation), also contain
PU.I sites in their regulatory regions. These data suggest that,
besides its role in neutrophils and macrophages, PU.I is likely to play
an important role in gene regulation during terminal differentiation of
eosinophils.
 |
FOOTNOTES |
Submitted June 6, 1997;
accepted October 31, 1997.
Supported by a research grant from Glaxo-Wellcome bv.
Address reprint requests to Rolf P. de Groot, PhD, Department of
Pulmonary Diseases, G03.550, University Hospital Utrecht, Heidelberglaan 100, 3584 CX Utrecht, The Netherlands.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
 |
ACKNOWLEDGMENT |
The authors thank Dr Marc van Dijk for providing reagents.
 |
REFERENCES |
1.
Kroegel C,
Warner JA,
Virchow JC Jr,
Matthys H:
Pulmonary immune cells in health and disease: the eosinophil leucocyte (part II).
Eur Respir J
7:743,
1994[Abstract]
2.
Gleich GJ,
Adolphson CR:
The eosinophilic leukocyte: Structure and function.
Adv Immunol
39:177,
1986[Medline]
[Order article via Infotrieve]
3.
Gundel RH,
Letts LG,
Gleich GJ:
Human eosinophil major basic protein induces airway constriction and airwayhyperresponsiveness in primates.
J Clin Invest
87:1470,
1991
4.
Yazdanbakhsh M,
Tai PC,
Spry CJ,
Gleich GJ,
Roos D:
Synergism between eosinophil cationic protein and oxygen metabolites in killing of schistosomula of Schistosoma mansoni.
J Immunol
138:3443,
1987[Abstract]
5.
Kroegel C,
Virchow JC Jr,
Luttmann W,
Walker C,
Warner JA:
Pulmonary immune cells in health and disease: The eosinophil leucocyte (part I).
Eur Respir J
7:519,
1994[Abstract]
6.
Hamann KJ,
Barker RL,
Ten RM,
Gleich GJ:
The molecular biology of eosinophil granule proteins.
Int Arch Appl Immunol
94:202,
1991
7.
Hamann KJ,
Barker RL,
Loegering DA,
Pease LR,
Gleich GJ:
Sequence of human eosinophil-derived neurotoxin cDNA: Identity of deducedamino acid sequence with human nonsecretory ribonucleases.
Gene
83:161,
1989[Medline]
[Order article via Infotrieve]
8.
Barker RL,
Loegering DA,
Ten RM,
Hamann KJ,
Pease LR,
Gleich GJ:
Eosinophil cationic protein cDNA. Comparison with other toxic cationicproteins and ribonucleases.
J Immunol
143:952,
1989[Abstract]
9.
Rosenberg HF,
Tenen DG,
Ackerman SJ:
Molecular cloning of the human eosinophil-derived neurotoxin: A member ofthe ribonuclease gene family.
Proc Natl Acad Sci USA
86:4460,
1989[Abstract/Free Full Text]
10.
Rosenberg HF,
Ackerman SJ,
Tenen DG:
Human eosinophil cationic protein. Molecular cloning of a cytotoxin and helminthotoxin with ribonuclease activity.
J Exp Med
170:163,
1989[Abstract/Free Full Text]
11.
Hamann KJ,
Ten RM,
Loegering DA,
Jenkins RB,
Heise MT,
Schad CR,
Pease LR,
Gleich-GJ,
Barker RL:
Structure and chromosome localization of the human eosinophil-derived neurotoxin and eosinophil cationic protein genes: Evidence for intronless coding sequences in the ribonuclease gene superfamily.
Genomics
7:535,
1990[Medline]
[Order article via Infotrieve]
12.
Gruart V,
Truong MJ,
Plumas J,
Zandecki M,
Kusnierz JP,
Prin L,
Vinatier D,
Capron A,
Capron M:
Decreased expression of eosinophil peroxidase and major basic protein messenger RNAs during eosinophil maturation.
Blood
79:2592,
1992[Abstract/Free Full Text]
13.
Tiffany HL,
Handen JS,
Rosenberg HF:
Enhanced expression of the eosinophil-derived neurotoxin ribonuclease (RNS2) gene requires interaction between the promoter and intron.
J Biol Chem
271:12387,
1996[Abstract/Free Full Text]
14.
Handen JS,
Rosenberg HF:
Intronic enhancer activity of the eosinophil-derived neurotoxin (RNS2) and eosinophil cationic protein (RNS3) genes is mediated by an NFAT-1 consensus binding sequence.
J Biol Chem
272:1665,
1997[Abstract/Free Full Text]
15.
Janknecht R,
Nordheim A:
Gene regulation by Ets proteins.
Biochim Biophys Acta
1155:346,
1993[Medline]
[Order article via Infotrieve]
16.
Karim FD,
Urness LD,
Thummel CS,
Klemsz MJ,
McKercher SR,
Celada A,
Van-Beveren C,
Maki RA,
Gunther CV,
Nye JA,
:
The ETS-domain: A new DNA-binding motif that recognizes a purine-rich core.
Genes Dev
4:1451,
1990[Free Full Text]
17.
Kodandapani R,
Pio F,
Ni CZ,
Piccialli G,
Klemsz M,
McKercher S,
Maki RA,
Ely KR:
A new pattern for helix-turn-helix recognition revealed by the PU.1 ETS-domain-DNA complex.
Nature
380:456,
1996[Medline]
[Order article via Infotrieve]
18.
Klemsz MJ,
McKercher SR,
Celada A,
van Beveren C,
Maki RA:
The macrophage and B cell-specific transcription factor PU.1 is related to the ets oncogene.
Cell
61:113,
1990[Medline]
[Order article via Infotrieve]
19.
Galson DL,
Hensold JO,
Bishop TR,
Schalling M,
D'Andrea AD,
Jones C,
Auron PE,
Housman DE:
Mouse beta-globin DNA-binding protein B1 is identical to a proto-oncogene, the transcription factor Spi-1/PU.1, and is restricted in expression to hematopoietic cells and the testis.
Mol Cell Biol
13:2929,
1993[Abstract/Free Full Text]
20.
Hromas R,
Orazi A,
Neiman RS,
Maki R,
Van Beveran C,
Moore J,
Klemsz M:
Hematopoietic lineage- and stage-restricted expression of the ETS oncogene family member PU.1.
Blood
82:2998,
1993[Abstract/Free Full Text]
21.
Chen HM,
Zhang P,
Voso MT,
Hohaus S,
Gonzalez DA,
Glass CK,
Zhang DE,
Tenen DG:
Neutrophils and monocytes express high levels of PU.1 (Spi-1) but not Spi-B.
Blood
85:2918,
1995[Abstract/Free Full Text]
22.
Moulton KS,
Semple K,
Wu H,
Glass CK:
Cell-specific expression of the macrophage scavenger receptor gene is dependent on PU.1 and a composite AP-1/ets motif.
Mol Cell Biol
14:4408,
1994[Abstract/Free Full Text]
23.
Pahl HL,
Scheibe RJ,
Zhang DE,
Chen HM,
Galson DL,
Maki RA,
Tenen DG:
The proto-oncogene PU.1 regulates expression of the myeloid-specific CD11b promoter.
J Biol Chem
268:5014,
1993[Abstract/Free Full Text]
24.
Rosmarin AG,
Caprio D,
Levy R,
Simkevich C:
CD18 (beta 2 leukocyte integrin) promoter requires PU.1 transcription factor for myeloid activity.
Proc Natl Acad Sci USA
92:801,
1995[Abstract/Free Full Text]
25.
Perez C,
Coeffier E,
Moreau Gachelin F,
Wietzerbin J,
Benech PD:
Involvement of the transcription factor PU.1/Spi-1 in myeloid cell-restricted expression of an interferon-inducible gene encoding the human high-affinity Fc gamma receptor.
Mol Cell Biol
14:5023,
1994[Abstract/Free Full Text]
26.
Ford AM,
Bennett CA,
Healy LE,
Towatari M,
Greaves MF,
Enver T:
Regulation of the myeloperoxidase enhancer binding proteins Pu1, C-EBP alpha, -beta, and -delta during granulocyte-lineage specification.
Proc Natl Acad Sci USA
93:10838,
1996[Abstract/Free Full Text]
27.
Oelgeschlager M,
Nuchprayoon I,
Luscher B,
Friedman AD:
C/EBP, c-Myb, and PU.1 cooperate to regulate the neutrophil elastase promoter.
Mol Cell Biol
16:4717,
1996[Abstract]
28.
Feinman R,
Qiu WQ,
Pearse RN,
Nikolajczyk BS,
Sen R,
Sheffery M,
Ravetch JV:
PU.1 and an HLH family member contribute to the myeloid-specific transcription of the Fc gamma RIIIA promoter.
EMBO J
13:3852,
1994[Medline]
[Order article via Infotrieve]
29.
Sturrock A,
Franklin KF,
Hoidal JR:
Human proteinase-3 expression is regulated by PU.1 in conjunction with a cytidine-rich element.
J Biol Chem
271:32392,
1996[Abstract/Free Full Text]
30.
Smith LT,
Hohaus S,
Gonzalez DA,
Dziennis SE,
Tenen DG:
PU.1 (Spi-1) and C/EBP alpha regulate the granulocyte colony-stimulating factor receptor promoter in myeloid cells.
Blood
88:1234,
1996[Abstract/Free Full Text]
31.
Zhang DE,
Hetherington CJ,
Chen HM,
Tenen DG:
The macrophage transcription factor PU.1 directs tissue-specific expression of the macrophage colony-stimulating factor receptor.
Mol Cell Biol
14:373,
1994[Abstract/Free Full Text]
32.
Hohaus S,
Petrovick MS,
Voso MT,
Sun Z,
Zhang DE,
Tenen DG:
PU.1 (Spi-1) and C/EBP alpha regulate expression of the granulocyte-macrophage colony-stimulating factor receptor alpha gene.
Mol Cell Biol
15:5830,
1995[Abstract]
33.
Brass AL,
Kehrli E,
Eisenbeis CF,
Storb U,
Singh H:
Pip, a lymphoid-restricted IRF, contains a regulatory domain that is important for autoinhibition and ternary complex formation with the Ets factor PU.1.
Genes Dev
10:2335,
1996[Abstract/Free Full Text]
34.
Eisenbeis CF,
Singh H,
Storb U:
Pip, a novel IRF family member, is a lymphoid-specific, PU.1-dependent transcriptional activator.
Genes Dev
9:1377,
1995[Abstract/Free Full Text]
35.
Scott EW,
Simon MC,
Anastasi J,
Singh H:
Requirement of transcription factor PU.1 in the development of multiple hematopoietic lineages.
Science
265:1573,
1994[Abstract/Free Full Text]
36.
McKercher SR,
Torbett BE,
Anderson KL,
Henkel GW,
Vestal DJ,
Baribault H,
Klemsz M,
Feeney AJ,
Wu GE,
Paige CJ,
Maki RA:
Targeted disruption of the PU.1 gene results in multiple hematopoietic abnormalities.
EMBO J
15:5647,
1996[Medline]
[Order article via Infotrieve]
37.
Olson MC,
Scott EW,
Hack AA,
Su GH,
Tenen DG,
Singh H,
Simon MC:
PU. 1 is not essential for early myeloid gene expression but is required for terminal myeloid differentiation.
Immunity
3:703,
1995[Medline]
[Order article via Infotrieve]
38.
Voso MT,
Burn TC,
Wulf G,
Lim B,
Leone G,
Tenen DG:
Inhibition of hematopoiesis by competitive binding of transcription factor PU.1.
Proc Natl Acad Sci USA
91:7932,
1994[Abstract/Free Full Text]
39.
de Groot RP,
Karperien M,
Pals C,
Kruijer W:
Characterization of the mouse junD promoter High basal level activity due to an octamer motif.
EMBO J
10:2523,
1991[Medline]
[Order article via Infotrieve]
40.
de Groot RP,
Pals C,
Kruijer W:
Transcriptional control of c-jun by retinoic acid.
Nucleic Acids Res
19:1585,
1991[Abstract/Free Full Text]
41.
Chomczynski P,
Sacchi N:
Single step method of RNA isolation by guanidinium thiocyanate-phenol-chloroform extraction.
Anal Biochem
162:156,
1987[Medline]
[Order article via Infotrieve]
42.
Caldenhoven E,
Vandijk TB,
Solari R,
Armstrong J,
Raaijmakers JAM,
Lammers JWJ,
Koenderman L,
Degroot RP:
STAT3 beta, a splice variant of transcription factor STAT3, is a dominant negative regulator of transcription.
J Biol Chem
271:13221,
1996[Abstract/Free Full Text]
43.
de Groot RP,
van Dijk TB,
Caldenhoven E,
Coffer PJ,
Raaijmakers JAM,
Lammers JJ,
Koenderman L:
Activation of 12-o-tetradecanoylphorbol-13-acetate response element- and dyad symmetry element-dependent transcription by interleukin-5 is mediated by Jun N-terminal kinase/stress-activated protein kinase kinases.
J Biol Chem
272:2319,
1997[Abstract/Free Full Text]
44.
van Dijk TB,
Bracke M,
Caldenhoven E,
Raaijmakers JA,
Lammers JW,
Koenderman L,
de Groot RP:
Cloning and characterization of Fc alpha Rb, a novel Fc alpha receptor (CD89) isoform expressed in eosinophils and neutrophils.
Blood
88:4229,
1996[Abstract/Free Full Text]
45.
Futami J,
Tsushima Y,
Murato Y,
Tada H,
Sasaki J,
Seno M,
Yamada H:
Tissue-specific expression of five human pancreatic-type RNases and RNase inhibitor in humans.
DNA Cell Biol
16:413,
1997[Medline]
[Order article via Infotrieve]
46.
Fischkoff SA:
Graded increase in probability of eosinophilic differentiation of HL-60 promyelocytic leukemia cells induced by culture under alkaline conditions.
Leuk Res
12:679,
1988[Medline]
[Order article via Infotrieve]
47.
Carey JO,
Posekany KJ,
deVente JE,
Pettit GR,
Ways DK:
Phorbol ester-stimulated phosphorylation of PU.1: Association with leukemic cell growth inhibition.
Blood
87:4316,
1996[Abstract/Free Full Text]
48.
Lodie TA,
Savedra R,
Golenbock DT,
van Beveren C,
Maki RA,
Fenton MJ:
Stimulation of macrophages by lipopolysaccharide alters the phosphorylation state, conformation, and function of PU.I via activation of casein kinase II.
J Immunol
158:1848,
1997[Abstract]
49.
Gomolin HI,
Yamaguchi Y,
Paulpillai AV,
Dvorak LA,
Ackerman SJ,
Tenen DG:
Human eosinophil Charcot-Leyden crystal protein: Cloning and characterization of a lysophospholipase gene promoter.
Blood
82:1868,
1993[Abstract/Free Full Text]

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
J. M. Beekman, L. P. Verhagen, N. Geijsen, and P. J. Coffer
Regulation of myelopoiesis through syntenin-mediated modulation of IL-5 receptor output
Blood,
October 29, 2009;
114(18):
3917 - 3927.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Qiu, K. D. Dyer, Z. Xie, M. Radinger, and H. F. Rosenberg
GATA Transcription Factors Regulate the Expression of the Human Eosinophil-derived Neurotoxin (RNase 2) Gene
J. Biol. Chem.,
May 8, 2009;
284(19):
13099 - 13109.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Verbrugge, T. de Ruiter, C. Geest, P. J. Coffer, and L. Meyaard
Differential expression of leukocyte-associated Ig-like receptor-1 during neutrophil differentiation and activation
J. Leukoc. Biol.,
April 1, 2006;
79(4):
828 - 836.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. D. Dyer and H. F. Rosenberg
The mouse RNase 4 and RNase 5/ang 1 locus utilizes dual promoters for tissue-specific expression
Nucleic Acids Res.,
February 18, 2005;
33(3):
1077 - 1086.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. F. Gombart, S. H. Kwok, K. L. Anderson, Y. Yamaguchi, B. E. Torbett, and H. P. Koeffler
Regulation of neutrophil and eosinophil secondary granule gene expression by transcription factors C/EBPepsilon and PU.1
Blood,
April 15, 2003;
101(8):
3265 - 3273.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Du, M. J. Stankiewicz, Y. Liu, Q. Xi, J. E. Schmitz, J. A. Lekstrom-Himes, and S. J. Ackerman
Novel Combinatorial Interactions of GATA-1, PU.1, and C/EBPepsilon Isoforms Regulate Transcription of the Gene Encoding Eosinophil Granule Major Basic Protein
J. Biol. Chem.,
November 1, 2002;
277(45):
43481 - 43494.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Zhang and H. F. Rosenberg
Sequence Variation at Two Eosinophil-Associated Ribonuclease Loci in Humans
Genetics,
December 1, 2000;
156(4):
1949 - 1958.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
T. B. van Dijk, B. Baltus, J. A. M. Raaijmakers, J.-W. J. Lammers, L. Koenderman, and R. P. de Groot
A Composite C/EBP Binding Site Is Essential for the Activity of the Promoter of the IL-3/IL-5/Granulocyte-Macrophage Colony-Stimulating Factor Receptor {beta}c Gene
J. Immunol.,
September 1, 1999;
163(5):
2674 - 2680.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Iwama, J. Pan, P. Zhang, W. Reith, B. Mach, D. G. Tenen, and Z. Sun
Dimeric RFX Proteins Contribute to the Activity and Lineage Specificity of the Interleukin-5 Receptor alpha Promoter through Activation and Repression Domains
Mol. Cell. Biol.,
June 1, 1999;
19(6):
3940 - 3950.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. Giembycz and M. A. Lindsay
Pharmacology of the Eosinophil
Pharmacol. Rev.,
June 1, 1999;
51(2):
213 - 340.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. B. van Dijk, B. Baltus, E. Caldenhoven, H. Handa, J. A.M. Raaijmakers, J.-W. J. Lammers, L. Koenderman, and R. P. de Groot
Cloning and Characterization of the Human Interleukin-3 (IL-3)/IL-5/ Granulocyte-Macrophage Colony-Stimulating Factor Receptor beta c Gene: Regulation by Ets Family Members
Blood,
November 15, 1998;
92(10):
3636 - 3646.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|