|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 91 No. 6 (March 15), 1998:
pp. 2157-2168
Three Molecular Structures Cause Rhesus D Category VI Phenotypes
With Distinct Immunohematologic Features
By
Franz F. Wagner,
Christoph Gassner,
Thomas H. Müller,
Diether Schönitzer,
Friedrich Schunter, and
Willy A. Flegel
From Abteilung Transfusionsmedizin, Universität Ulm and
DRK-Blutspendezentrale Ulm, Ulm, Germany; Zentralinstitut für
Bluttransfusion und Immunologische Abteilung Innsbruck, Innsbruck,
Austria; and Institut Oldenburg, DRK-Blutspendedienst
Niedersachsen-Oldenburg, Oldenburg, Germany.
 |
ABSTRACT |
Rhesus D category VI (DVI) is the clinically most
important partial D. DVI red blood cells were
assumed to possess very low RhD antigen density and to be caused by two
RHD-CE-D hybrid alleles. Because there was no population-based
work-up, we screened three populations in central Europe for
DVI. Twenty-six DVI samples were detected and
examined by exon-specific RHD polymerase chain reaction with
sequence-specific primers (PCR-SSP). A new genotype,
hereby designated D category VI type III, was characterized as
a RHD-Ce(3-6)-D hybrid allele by sequencing of the cDNA, parts of intron 1, and by PCR-restriction fragment length polymorphism (PCR-RFLP) of intron 2. Rhesus introns 5 and 6 were sequenced and the 3 breakpoints of all known
DVI types shown to be distinct. We differentiated
the 5 breakpoints of DVI type I and
DVI type II by a newly devised RHD-PCR.
Thus, the DVI phenotype originated in at least three
independent molecular events. Each DVI type showed
distinct immunohematologic features in flow cytometry. The number of
RhD proteins accessible on the red blood cells' surface of
DVI type III was normal (about 12,000 antigens/cell; DVI type I, 500;
DVI type II, 2,400) based on the
determination of an RhD epitope density profile. DVI
type II and DVI type III occurred as CDe
haplotypes, and DVI type I as a cDE haplotype.
The distribution of the DVI types varied
significantly in three German-speaking populations. Genotyping
strategies should take account of allelic variations in partial
RhD. The reconsideration of previous serologic and clinical data for
partial D in view of the underlying molecular structures may be
worthwhile.
| |
INTRODUCTION |
THE RHESUS BLOOD GROUP system is of great
importance for transfusion medicine because of the high immunogenicity
of its antigens. Rhesus antigens are carried by two highly homologous
proteins, the RhD and RhCE proteins.1-6 The D antigen (ISBT
004.001; RH1) determined by the RhD protein is the most important
Rhesus antigen and the leading cause for hemolytic disease of the
newborn.7 About 17% of Caucasians lack the expression of
the D antigen.8 The transfusion of a single unit of D
positive red blood cells to a D negative patient is associated with an
immunization rate of greater than 80%.9
The D antigen comprises several different antigenic epitopes. Rare
individuals carry a partial D antigen10 and may produce alloantibodies directed against D epitopes that are lacking in their
RhD protein. Initially, these individuals have been classified into six
distinct categories (DII to DVII,
DI being obsolete) based on the mutual reactivity with
polyclonal anti-D sera from immunized partial D carriers.11
Today, characterization of partial D is performed by differential
reactivity with monoclonal anti-D antibodies.12,13 D
category VI (DVI) is the clinically most important partial
D. Severe cases of hemolytic disease of the newborn have occurred in
RhD positive babies born to DVI mothers with
anti-D.14 DVI is the most abundant
serologically defined partial D occurring among weak D samples.
DVI is reported to comprise about 6% to 10% of weak D
samples8,15 and has a phenotype frequency of 1:6,200 in
Germany (range, 0.02% to 0.05% in Caucasians).8,15,16 The
majority of RhD positive individuals with allo-anti-D were
DVI.17
DVI occurs in CDe, cDE, and cDe haplotypes.17
The CDVIe haplotype is due to an RHD-RHCE
hybrid molecule in which exons 4 to 6 of RHD were
substituted by the respective exons of RHCE.18 Samples with a cDVIE haplotype were initially assumed to
carry a deletion of exons 4 to 6,18 but in fact, are due to
an exon 4 to 5 hybrid.19,20 Most CDVIe
haplotypes carry the low frequency Rhesus antigen BARC (ISBT 004.052;
RH52).21 No other consistent serologic differences in
DVI have been described.21
We recently completed a serologic random survey for partial D in
southwestern Germany.8,22 Here we report the results of the
molecular and immunohematologic work-up of DVI samples. We
describe a novel molecular event that caused a DVI
phenotype carrying a normal number of RhD proteins accessible on the
red blood cells' surface. We show that the three DVI
types may be readily discriminated by flow cytometry based on distinct immunohematologic features. We demonstrate considerable differences in the distribution of DVI types within
German-speaking populations showing the importance of a full molecular
description for Rhesus genotyping purposes, eg, in prenatal
testing.
| |
MATERIALS AND METHODS |
Random Survey and Blood Samples
EDTA- or citrate-anticoagulated blood samples came from southwestern
Germany (DRK-Blutspendedienst Baden-Württemberg, Ulm, Germany),
northern Germany (DRK-Blutspendedienst Niedersachsen, Oldenburg) and
Tyrol, Austria (Zentralinstitut für Bluttransfusion und
Immunologische Abteilung Innsbruck, Innsbruck, Austria). As described
previously,8 blood samples in Ulm screened for differential reactivity with a monoclonal IgM anti-D (BS226; Biotest, Dreieich, Germany; not reactive with DVI) and with polyclonal anti-D
in antiglobulin technique were checked for the DVI
phenotype by a panel of monoclonal anti-D (D-Screen; Diagast, Lille,
France). The DVI phenotype was further confirmed by
reactivity with monoclonal anti-D BS221, H41 (Biotest), and BRAD-2
(International Blood Group Reference Laboratory, Bristol, UK), as well
as absence of reactivity with BS227, BS229, BS231, BS232 (Biotest) and
RUM-1 (Bio Products Laboratory, Elstree, UK). Similarly, blood donors
in Oldenburg and Innsbruck with weak D phenotype were screened by the
RHD exon-specific polymerase chain reaction with
sequence-specific primers (PCR-SSP; see below).
Molecular Biology
DNA was prepared using a modified salting out procedure23
or QIAAmp Blood DNA isolation kit (Qiagen, Hilden, Germany). RNA was
isolated using RNeasy kit (Qiagen). Reverse transcription was performed
with oligo-dT-priming and Moloney murine leukemia virus
(MMLV) reverse transcriptase (Sigma, Deisenhofen,
Germany). RHD exon-specific PCR-SSP was performed as previously
described.24 cDNA was amplified in a nested PCR-reaction
(High Fidelity PCR system, Boehringer Mannheim, Mannheim, Germany) with
external primers RR1 and RR3 and internal primers Rh5 and Rh7. The
5 part of intron 1 was amplified with primers RB13 and RB45.
Restriction fragment length polymorphism-PCR (RFLP-PCR) of intron 2 was
performed using the primers of Poulter et al.25 The
3 region of intron 3 was amplified with primers RB46 and RB5,
RB12 and RI4R2. The intron 3 length polymorphism data were based on
seven RhD-negative and 20 RhD-positive samples. Intron 5 was amplified
using primers RA9B and Rh2 and intron 6 using primers RB25, RB7, and
RB27.
Nucleotide sequencing was performed with a DNA sequencing unit (Prism
dye terminator cycle-sequencing kit with AmpliTaq FS DNA polymerase;
ABI 373A, Applied Biosystems, Weiterstadt, Germany). We subcloned the
PCR product into pMos-T-vectors (pMos-T-kit, United States
Biochemicals, Cleveland, OH). Three independent cDNA clones were
sequenced using T7 promoter primers, U19 reverse plasmid primers, and
internal Rhesus primers. Genomic sequences were established
from cloned PCR fragments using both primer walking and nested deletion
strategies (Nested deletion kit, Pharmacia, Freiburg, Germany) and
verified by sequencing of PCR products using internal Rhesus
primers. Intron 1 sequences were based on six RhD-negative (three ccee,
two ccEE, one CCee), eleven RhD-positive samples and one sample of each
DVI type, intron 3 sequences on six RHCE (two ce,
Ce, cE each) and four RHD alleles, intron 5 and 6 sequences on
at least two RHCE (ce) and RHD alleles. Intron DNA
sequences were analyzed for the presence of repetitive sequences by the
CENSOR program26 (censor{at}charon.lpi.org).
Primer Sequences
RB13, ctagagccaaacccacatctcctt (promoter,27 position -675 to -653 relative to the A of the start codon of the cDNA); RR1, tgttggagagaggggtgatg (5 untranslated, -60 to -41);
Rh5,28 gcacagagacggacacag (5 untranslated, -19 to
-2); Rh1,29 tatctagagacggacacaggATGAGC (5
untranslated to exon 1, -17 to 6); RB45, acactgttgrctgaatttcggtgc (intron 1, antisense); RA21,25 gtgccacttgacttgggact (intron 2, sense); RA22,25 gtggacccaatgcctctg (intron 2, antisense); RB46, tggcaagaacctggaccttgacttt (intron 3, sense); RA9B,
GGTGCCTGCCAAAGCCTCTACCC (exon 4, 554 to 576); RB5,
GGCAGACAAACTGGGTATCGTTGC (exon 4, 627 to 604); RB12,
tcctgaacctgctctgtgaagtgc (intron 4, antisense, RHD-specific);
RI4R2, ttggctcactgcaacctccaccac (intron 4, antisense, RHCE-specific); RB25, agcagggaggatgttacag (intron 4, sense);
Rh2,29 AGAAGGGATCAGGTGACACG (exon 5, 900 to 881); RB7,
ATCTCTCCAAGCAGACCCAGCAAGC (exon 7, 1022  998); RB27,
AGCCCAgtgacccacatg (exon7/intron 7); Rh7, acgtacaaatgcaggcaa (3
untranslated, 1330 1313); RR3, cagtctgttgtttaccagatg (3
untranslated, 1512 1431, RHD-specific).
Immunohematology
Monoclonal anti-D were provided by the Workshop on Monoclonal
Antibodies against Human Red Blood Cells and Related
Antigens.30 All monoclonal anti-D were tested for
agglutination in a gel matrix test (LISS-Coombs 37°C, DiaMed-ID
Micro Typing System, DiaMed, Cressier sur Morat, Switzerland). As
detailed in the Results, positive reactivities were obtained with
BIRMA-D6; BTSN6; BTSN10; HIRO-3; HIRO-4; HIRO-7; HIRO-8; H41; LHM76/55;
LHM76/59; LHM-77/64; LOR11-2D9; LOR17-6C7; LOR29-F7; MCAD-6; MS26;
NAU3-2E8; NAU6-4D5; P3G6; P3x21223B10; P3x290; 822; negative with
AUB-2F7/Fiss; BIRMA-D56; BRAD-3; BRAD-5; BS229; BS231; BS232; B9A4B2;
CAZ7-4C5; CLAS1-126; C205-29; D6D02; D10; D89/47; D90/12; D90/17; F5S;
HeM-92; HG/92; HIRO-1; HIRO-2; HIRO-6; HM10; HS114; H2D5D2F5; ID6-H8;
LHM50/2B; LHM50/3.5; LHM59/19; LHM59/20; LHM59/25; LHM70/45; LHM-76/58; LHM169/80; LHM 169/81; LHM174/102; LORA; LOR12-E2; LOR17-8D3; LOR28-7E6; LOR28-21D3; L87.1G7; MAR-1F8; MS201; NaTH28-3C11;
NaTH53-2A7; NaTH87-4A5; NAU6-1G6; NOI; NOU; P3AF6; P3F17; P3F20; P3x35;
P3x61; P3187; RAB.B15; RUM-1; SALSA-12; SAL17-4E8; SAL20-12D5; T3D2F7; VOL-3F6; ZIG-189; 17010C9; 175-2; 819; and weak positive or variable with BIRMA-DG3; BTSN4; D90/7; LORE. Furthermore, reactivity with two
polyclonal anti-D produced by carriers of the DVI phenotype
(CcDVIee and ccDVIEe), as well as with
anti-BARC (ISBT 004.052; RH52) serum and eluate (kindly provided by Drs
Geoff Daniels and Carole A. Green, Bristol, UK) was checked.
Determination of RhD antigen density was performed by indirect immune
fluorescence as described previously.31,32 All 22 IgG
monoclonal anti-D reactive to RhD epitopes present in DVI
30 were used (BIRMA-D6, BTSN6, BTSN10, HIRO-3, HIRO-4, HIRO-7,
HIRO-8, H41, H41.11B7, LHM76/55, LHM76/59, LHM 77/64, LOR11-2D9,
LOR17-6C7, LOR29-F7, MCAD-6, MS26, NAU3-2E8, NAU6-4D5, P3G6, P3x290,
and 822). The secondary antibody was goat antihuman immunoglobulins, fluorescein isothiocyanate (FITC)-conjugated (Sigma).
All blood samples were stored on fluid nitrogen. The fluorescence was
compared with that of a standard CDe/cde red blood cell (13,000 RhD
antigens per cell). Background fluorescence was determined with
RhD-negative samples. The number of RhD epitopes detected on the sample
cells was calculated as [median fluorescence of sample background
fluorescence] / [median fluorescence of standard cellbackground
fluorescence] × RhD antigen density of standard cell.
Markers were set to count all red blood cells, even if a fraction of
red blood cells appeared unstained. To account for a log-normal
distribution, we based the parametric statistical analysis on the
logarithms of the RhD antigen densities.
| |
RESULTS |
Detection of Three Independent Molecular Events Causing D Category
VI
Twenty-six DVI samples were examined using
RHD-specific PCR-SSP for exons 2, 3, 4, 5, 6, 7, 9, and 10 (3 untranslated).24 All DVI samples
differed in their PCR-SSP pattern from the wild-type RHD allele
and showed one of three PCR-SSP patterns
(Fig 1). Two PCR-SSP patterns were
compatible with the previously described genomic rearrangements
associated with DVI type I (lack of RHD
exons 4 and 5) and DVI type II (lack of RHD
exons 4 to 6).18,19,33 A third pattern could not be
explained by any known RHD/RHCE variation and is hereby called
DVI type III.
View larger version (76K):
[in this window]
[in a new window]
| Fig 1.
PCR-SSP of DVI samples. Agarose gels of
representative DVI samples are shown along with negative
and positive controls. The specificities of the 12 reactions for the RHD/RHCE exons are shown on the right side
(box). The nucleotide position(s) detected by the PCR-SSP are given
along with the expected sizes of the specific products. The control
band represents a 434-bp product of the growth hormone gene. For
DVI samples, three different reaction patterns are
observed: pattern I (B) lacks specific signals for RHD exons 4 and 5 and is compatible with DVI type
I.19 Pattern II (C) lacks those for RHD exons 4 to 6 being compatible with DVI type
II.18 Pattern III (D) lacking specific products for
RHD exons 3 to 6 is novel. c2 indicates the
c(cyt48) allele.
|
|
Molecular Characterization of DVI Type III
Coding sequence.
Because the PCR-SSP pattern of DVI type III
was novel, we determined the full-length coding sequence of its cDNA
(EMBL/GenBank/DDBJ nucleotide sequence database accession number
Z97026). The DVI type III cDNA comprising all 10 Rhesus gene exons represented a RHD-CE-D cDNA, in which
the complete exons 3, 4, 5, and 6 of the RHD gene were replaced
by the corresponding exons of the RHCE gene.
The exons 3 to 6 are derived from the RHCe allele.
We applied a PCR-RFLP method for the characterization of the
Rhesus genes' intron 2.25 A length polymorphism
discriminates between the RHC and RHc/RHD alleles of
the two Rhesus genes (Fig 2A). An
RFLP allows the further separation of the RHC, RHc and RHD alleles (Fig 2B). We excluded the presence of
RHD-specific sequences in DVI type III at
the position of this polymorphism in intron 2 (Fig 2B). The
discrimination between an RHC- or RHc-origin of the
DVI type III intron 2 was achieved by the length
polymorphism. The DVI type III sample showed an
enhanced band of 1,177 bp size (RHC) compared with that of
1,068 bp size (RHc) (Fig 2A). This indicated that two copies of
RHC-like intron 2 sequences were present in the
CDVIe/ce genotype, one from the
DVI type III allele, the other from the Ce
allele of the CDVIe haplotype. We concluded that
the RHCE-derived genomic sequences of the DVI
type III allele originated from the RHCe allele and
extended 5 of this polymorphism, which is located in the middle
of intron 2.
View larger version (61K):
[in this window]
[in a new window]
| Fig 2.
PCR-RFLP of intron 2 of the Rhesus genes. An
intron 2 polymorphism was analyzed by PCR amplification and digestion
by PstI as previously described.25 Agarose gels are shown
with fragment lengths25 and fragment specificities
indicated. (A) The 1,177-bp product is specific for RHC
alleles, the 1,068-bp product is representative for RHD or
RHc or both. The CcDVIee type III sample shows a
strong band at the RHC position and a weaker band at the
RHD/RHc position. In contrast, the CcDVIee type II
and the CcDee samples show a weak band at RHC position and a
strong band at the RHD/RHc position. (B) The PCR products shown
in (A) were digested with PstI to separate RHD from
RHc-specific products. The DVI type III sample
lacks the RHD-specific fragment (640 bp), whereas all other RhD
positive samples show this fragment.
|
|
Exon 1 is of RHD origin.
The guanosine at nucleotide position 48 relative to the A of the
translation start codon in the DVI type III cDNA
was compatible with both an RHD or an RHc
origin.3,28 To prove the RHD derivation of exon 1, we characterized the 5 portion of intron 1 for both
Rhesus genes (EMBL/GenBank/DDBJ nucleotide sequence database
accession number Z97362 and Z97363). DVI type III
presented all three nucleotide substitutions and the insertion
characteristic for the RHD allele
(Fig 3). This observation indicated that
the genomic sequences of the DVI type III allele
5 of this part of intron 1 were derived from the RHD
gene. The molecular characteristics of DVI type
III were summarized and compared with other published alleles (Fig 4).
View larger version (17K):
[in this window]
[in a new window]
| Fig 3.
5 portion of the Rhesus genes' intron 1. One hundred thirty nucleotides of intron 1 adjacent to exon 1 are shown
for the DVI type III allele along with the common
RHCE and RHD genes. The RHCE and RHD
genes differ by three nucleotide substitutions and one insertion
(boxed). The DVI type III allele is identical to
RHD at these positions. As expected, DVI type
I and DVI type II alleles are also identical to
RHD (not shown). Nucleic acid sequence accession numbers were
Z97362 (RHCE) and Z97363 (RHD).
|
|
View larger version (19K):
[in this window]
[in a new window]
| Fig 4.
Schematic representation of the genomic structure of
DVI type III compared with other alleles of the
RHD and RHCE genes. The 10 exons of the Rhesus
genes are symbolized by squares and numbered 1 to 10, the introns are
represented by lines. The triangles denote the base substitutions and
insertion occurring in intron 1 distinguishing RHD and
RHCE. The circles denote the intron 2 polymorphism
distinguishing RHD, RHC and RHc. Black symbols
represent RHCE-specific sequences, open symbols
RHD-specific sequences. Sequences shared by at least one
RHCE and the wild-type RHD allele are indicated by gray
symbols, sequences specific for RHC or for RHE are
hatched. The nucleic acid and amino acid sequence accession number of
D category VI type III was Z97026.
|
|
Demonstration of Distinct Breakpoints in the Three DVI
Types
The 3 breakpoints of DVI type II and
DVI type III are different.
To define the 3 limits of the conversion regions of the three
DVI types, we established the complete nucleotide
sequence ranging from exon 5 to exon 7 including both introns 5 and 6. We found the breakpoint of DVI type I to be
located at the border of intron 5 and exon 6 in a nucleotide range of
215 bp between -100 bp and +115 bp relative to the first nucleotide of
exon 6 (Fig 5). The breakpoint of
DVI type III was located in intron 6 between +360
bp and +963 bp (range of 603 bp) relative to the first nucleotide of
intron 6. Finally, the breakpoint of DVI type
II34 was also located in intron 6 between +1,781 and
+1,821 bp (range of 40 bp) relative to the first nucleotide of intron
6.
View larger version (73K):
[in this window]
[in a new window]
| Fig 5.
Exon 6 of the Rhesus genes and parts of the
adjacent introns. The sequence of the RHCE gene extending 202 bp 5 of exon 6 to 1860 bp 3 of exon 6 is shown. Numbers
indicate the position relative to the first base of exon 5 in the
RHCE gene. Exon 6 (bases 1902 to 2040) is demarcated by
uppercase letters. Dashes denote nucleotides in the RHD gene
that are identical, dots denote deletions. The breakpoint regions for
DVI type I, DVI type II and
DVI type III are indicated by asterisks. Repetitive
DNA elements are marked by carets. The full intron 5 and intron 6 sequences of RHCE and RHD were deposited in
EMBL/GenBank/DDBJ under accession numbers Z97333 (RHCE; 5,134 bp) and Z97364 (RHD; 5,146 bp).
|
|
An intron 3 length polymorphism differentiates the 5
breakpoints of DVI type I and DVI type II.
We found a 288-bp deletion in intron 3 of the RHD gene, when
compared with the RHCE gene. Based on this deletion, a PCR
typing method for RHD was devised. In this intron 3 PCR,
DVI type I and DVI type III
samples reacted like RHD negative controls, while
DVI type II samples displayed the shorter,
RHD-specific band (Fig 6A). This
indicated that the conversion point of DVI type I
had to be 5 of the intron 3 deletion. We confirmed the conversion point of DVI type II adjacent to an Alu
repeat34 (data not shown, see Z97030 and Z97031) and
5 of the conversion point were two additional Alu repeats with
inverse orientation, one of which was partly deleted in RHD
(Fig 6B).
View larger version (49K):
[in this window]
[in a new window]
| Fig 6.
Intron 3 length polymorphism of the Rhesus genes.
The 3 region of intron 3 was amplified by PCR using primers RB46
and RB5. (A) The agarose gel shows a 1,722-bp product for the
RHCE gene. The 1,420-bp product is representative of the
RHD gene. In the DVI type II sample, a
RHD-specific product is found. DVI type I
and DVI type III samples show no
RHD-specific product. (B) The nucleotide sequence of the
3 part of intron 3 of the RHCE gene starting 1,556 nucleotides 5 from exon 4 and of the corresponding parts of the
RHD gene comprising the diagnostic 288 bp deletion are shown.
Dashes denote nucleotides in the RHD gene that are identical, dots
denote deletions. Nucleic acid sequence accession numbers were Z97030
(RHCE; 1,580 bp) and Z97031 (RHD; 1,278 bp).
|
|
Linkage of the DVI types to different Rhesus
haplotypes.
We observed the three DVI types associated with
specific Rhesus haplotypes: all DVI type I
samples (n = 14) were found in the cDVIE haplotype,
all DVI type II (n = 9), and DVI
type III (n = 3) in the CDVIe haplotype.
Because the genomic structure of DVI type III is
D-Ce(3-6)-D, a conversion event among the two Rhesus genes in cis-position may be the cause of this hybrid allele.
Regional frequency variation of the DVI types.
The distribution of the different DVI types varied
depending on the regional origin of the samples
(Table 1). In Tyrol (Austria), all samples
were DVI type I, while in southwestern Germany,
DVI type I and DVI type II were
observed about equally frequently. In northern Germany, the only
DVI samples that we found so far were DVI
type II.
Serology of DVI Samples
Polyclonal antibodies.
One sample of each DVI type was tested with two
polyclonal anti-D and anti-BARC (Table 2).
DVI type III qualified as a D category VI, because
it was nonreactive with anti-D produced by probands of
DVI type I and DVI type II.
Further, DVI type III carried the BARC antigen
(ISBT 004.052; RH52). Anti-BARC did not differentiate
DVI type II and DVI type III.
Monoclonal anti-D.
One sample of each DVI type was tested with the
full panel of monoclonal anti-D provided in the recent Workshop on
Monoclonal Antibodies against Human Red Blood Cells and Related
Antigens.35 The three DVI types did not
differ in their reaction pattern (Table 3,
upper panel). All positive and most negative reactivities reported by the Workshop coordinator30 were confirmed. Four anti-D
(BIRMA-DG3; BTSN4; D90/7; LORE), reported to be
nonreactive,30 showed discrepant results and were tested
with additional DVI samples (Table 3, lower panel). We
found variable, ie, negative or weak positive, reactivity. This
reactivity would have been considered negative by the Workshop
criteria30 and thus our observations were in full agreement
with the Workshop results.
Flow Cytometric Analysis of the DVI Types
Epitope density profiles.
Fifteen DVI samples and three control samples were tested
with the 22 IgG monoclonal anti-D of the Workshop30 that
bind the RhD epitopes of D category VI. In contrast to the control
samples, the number of RhD epitopes per cell detected on the
DVI samples varied considerably depending on the
monoclonal antibody used (Fig 7). This
variation in the number of epitopes detected did not correlate with the
epitope specificity30 of the anti-D (data not shown,
P = .23 in the analysis of variance). DVI
type I and DVI type II presented
consistently low numbers of RhD epitopes per cell with all anti-D.
Interestingly, many monoclonal anti-D detected normal, if not enhanced,
numbers of RhD epitopes per cell in DVI type III.
View larger version (26K):
[in this window]
[in a new window]
| Fig 7.
Epitope density profiles of samples with the three
DVI types and with normal RhD. On the abscissa, ranges of
epitope densities (sites/cell) as detected by various anti-D are given.
On the ordinate, the number of anti-D representing the particular
ranges of sites/cell are shown. One representative sample is shown for
each DVI type. Epitope density profiles obtained with four
additional DVI type I, six additional DVI type
II, and two additional DVI type III samples were
similar.
|
|
RhD antigen density (antigens/cell).
Using the results of all 22 anti-D, we calculated the RhD antigen
densities as correlates of the number of RhD proteins accessible on the
red blood cells' surface (Table 4). The
RhD antigen density of DVI type III was similar to
the CcDee control and several fold higher than that of
DVI type I and DVI type
II. Still, the RhD antigen densities of DVI
type I and DVI type II differed
significantly.
Distinct immunohematologic features of the DVI types.
Two of four monoclonal anti-D that are binding to epD3730
detected fair numbers of RhD epitopes per cell for DVI
type I, but rather low numbers for DVI type II
and DVI type III. This deviation from the
actual RhD antigen densities (Table 4) was neither observed with the
two other monoclonal anti-D binding to epD37 nor any other anti-D
binding to the remaining RhD epitopes present in DVI
samples. This heterogeneity of anti-D's binding to epD37 may represent
a flow cytometric split: epD37a (BTSN10 and HIRO-3) was detected
equally well in all DVI types, epD37b (MCAD-6 and 822) was
reduced in DVI type II and DVI type III. The
binding characteristic of MCAD-6 was used to discriminate the three
DVI types by immunohematologic methods, which also
allowed separation from normal controls
(Fig 8).
View larger version (10K):
[in this window]
[in a new window]
| Fig 8.
Distinct immunohematologic features of the three
DVI types. The RhD antigen density is plotted on the
ordinate. On the abscissa, the relative epitope detection by MCAD-6 is
shown. This parameter was calculated as follows: [epitopes per cell
detected by MCAD-6]  [RhD antigen density] × 100%. Data of 15 DVI samples and three
controls are shown.  , DVI type I, n = 5;  ,
DVI type II, n = 7;  , DVI type III, n = 3;  , controls, n = 3.
|
|
| |
DISCUSSION |
The population-based study showed that the variability of the
DVI phenotype is greater than previously reported for the
underlying molecular structures18-20 and the RhD antigen
densities.15,36-39 We characterized a D-Ce(3-6)-D
hybrid allele of the RHD gene. In accordance with the previous
nomenclature,18 this new allele was dubbed
DVI type III. Its DVI type III
phenotype is associated with an almost normal number of RhD proteins
accessible on the red blood cells' surface. All three DVI
types and RhD controls showed distinct immunohematologic features in
flow cytometry. The distribution of the DVI types
varied significantly even within German-speaking populations.
The observation of a D-Ce(3-6)-D hybrid allele, which
represented a DVI phenotype, contributed considerably to
the understanding of the immunoreactivity in partial D. The
DVI phenotype is caused by several different genotypes that
are strictly associated with specific Rhesus haplotypes. As a
common feature, all known DVI genotypes shared
RHCE exons 4 and 5 and RHD exon 7. Substitutions of
RHD exon 4 or exon 5 alone by the corresponding exon of
RHCE result in different partial D (exon 4: DFR, exon 5:
DVa),40 the additional substitution of exon 7 results in the loss of most41 or all42 RhD
immunoreactivity. Our report of a D-Ce(3-6)-D allele proved
that in contrast to exon 7, RHD exon 3 is not necessary for a
DVI phenotype. This observation supported the current RhD
loop model.43,44 All polymorphic sites of exon 3 and exon 6 are believed to occur in the transmembrane and intracellular portions,
and hence, may not be expected to influence RhD immunoreactivity very
much. In contrast, the polymorphic amino acids of the extracellular
loops 3, 4, and 6 are determined by exons 4, 5, and 7, respectively. In
concordance with several recent reports,19,20,45 we were unable to find the "deletion type"18 that has been
proposed for the cDE haplotype of DVI. However, the
ccDVIee phenotype observed in one individual37
likely represented a fourth D category VI genotype (proband
lost to follow-up; J.W. Jones, personal communication,
1996). Interestingly, the D-Ce(3-6)-D hybrid protein
(DVI type III) is complementary to the Ce-D(2-6)-Ce
hybrid protein. The latter hybrid protein causes some Evans (D··)
phenotypes,46,47 encodes several RhD epitopes, and lacks
all CcEe antigens.
An unexpected feature of DVI type III was its almost normal
number of RhD proteins per cell. The determination of epitope density profiles in DVI samples gave unequivocal evidence that the
lack of certain RhD epitopes need not correlate with the loss of RhD
proteins per cell. The observation of the DVI type III
phenotype provided a formal proof that the limited RhD immunoreactivity
detected with polyclonal anti-Ds in DVI type I and
DVI type II37 cannot be explained by the lack
of these RhD epitopes only, but must be due to a reduced number of RhD
proteins accessible on the red blood cells' surface. The Rhesus
protein conformation is likely to influence its red blood cell membrane
integration. However, there is currently no conclusive model to predict
the effect of any substitution on RhD protein expression. This is exemplified by the different DVI types showing a
paradoxical, inverse correlation between the size of the substituted
protein segments and the RhD antigen density. Substitution of exon
348 increases RhD antigen density37 in
DIIIc, also. Furthermore, single residue substitutions as
occurring in DVII49,50 and DNU51 may have
considerable effects on RhD antigen density.32,37
It is intriguing to note that all three DVI types
may be explained by gene conversion events occurring among both
Rhesus genes in cis position. The molecular structures of most
Rhesus hybrids (DIIIb,52
DVa,40 hybrid-VS,42
DBT53) are also compatible with this proposed mechanism.
Only one RHD hybrid characterized so far (Rh D-E variant
ISBT4954) seemed to be caused by a gene conversion in trans
position. The impression that conversions in trans position were
predominant in RHCE hybrids (RN,55
R0Har,56 and rG57) is
likely due to an observation bias because RHCE hybrids will almost exclusively be detected in RhD negative samples.
We referred to DVI type III as a
D-Ce(3-6)-D hybrid, but a D-Ce(2-6)-D hybrid could not
formally be excluded. The approximately 4,500-bp region encompassing
exon 2 was reported to be identical between the RHD and
RHCe alleles and to contain many repetitive elements.58 The 5 conversion point of
DVI type III resided in the region between the
polymorphisms in intron 1 and intron 2 (Figs 2 and 3). A further
characterization did not seem worthwhile because of the long stretch of
identical sequences and repetitive elements in that region. The
5 conversion points of several independent gene conversion
events with substitutions in the RHCe allele by RHD
sequences in D probands were shown by Kemp et al58 to
occur also in this stretch of identical sequences. It is tempting to
speculate that the sequence identity over more than 4,000 bp including
many repetitive elements facilitated conversion events. A similar
accumulation of repetitive Alu and LINE elements (Fig 3) occurred
adjacent to the breakpoint region of DVI type II in
intron 3, which hosted the conversion points of four RHD/RHCE hybrids.34
Characterization of the 3 breakpoint regions of the three
DVI types (Fig 5) showed that their breakpoints
were not clustered. The breakpoint of DVI type
I occurred in a stretch of 195 bp covering parts of intron 5 and exon 6, that of DVI type III in a stretch of
identity between RHD and RHCE over 605 bp including an
Alu repeat. The extent of the whole gene conversion sequence thus
varied between about 4,800 bp (DVI type II) and > 19,500 bp (DVI type III). The breakpoint region of
DVI type II in intron 6 was identical to that
recently described by Matassi et al.34 These findings are
compatible with a common origin (identity by descent) of all
DVI type II samples described so far in France, the
Netherlands, and Germany.
Our quantitative RhD epitope analysis of molecularly characterized
samples clarified several previously controversial issues of
DVI immunohematology. First, the use of epitope density
profiles addressed the problem of variable antibody affinities in
partial D. Studies based on single or few monoclonal
antibodies15,36 were likely to underestimate the true
number of RhD proteins accessible on the red blood cells' surface, in
particular, if the anti-D used36 happened to lack affinity
for DVI.12 Even with conditions believed to be
saturating, variable epitope densities were obtained with different
anti-D.37 We established epitope density profiles using a
panel of monoclonal IgG directed to different RhD epitopes present in
the partial D tested.32 Such epitope density profiles in
DVI showed the variability of anti-D affinities. In
difference to other partial D like DVII and
DNU,32 there was no narrow antigen density peak (Fig 7), and therefore, the median of the results of all antibodies was used.
This robust approach may slightly underestimate the RhD antigen density
as correlate of the true number of RhD proteins accessible on the red
blood cells' surface because antibodies of marginal affinities to
DVI were not excluded. However, our results for
DVI type I and DVI type
II were in good agreement with previous reports.37
Second, the immunohematologic features were correlated with molecular
structures instead of serologic haplotypes. Previously, the influence
of the molecular structures were not checked. Controversial results
indicating low36-38 or variable15,39 RhD
antigen densities may simply reflect the absence or presence of
DVI type III samples in the CcDVIee
group tested. The close linkage of Rhesus haplotype and
molecular structure also explains the observation37 that
the presence of C suppresses RhD antigen density in normal RhD
samples,59,60 but not in DVI
samples.37 In DVI, the slight suppressive
effect of antigen C was overwhelmed by the effects of the molecular
structures as the principal determinants of RhD protein expression.
Third, the quantitative analysis by flow cytometry separated overall
RhD antigen density caused by variations in the number of RhD proteins
accessible on the red blood cells' surface from variable expression of
certain RhD epitopes. Flow cytometry allowed differentiation of the
DVI types from one another and from normal RhD.
Furthermore, we could demonstrate a flow cytometric split of RhD
epitope epD37. However, the only qualitative serologic difference that
we could correlate with the molecular structures was a paucity, but not
lack, of epD37b on DVI type II and
DVI type III. We suspect that some previously
reported serologic splits8,16,18,21,61,62 that were mainly
observed with weak overall antibody reactivity8,16,18,62
may be due to quantitative differences in RhD epitope expression rather
than lack of certain RhD epitopes. We propose that a meaningful report of a serologic split in partial D should exclude the confounding effect
of low antigen densities. This exclusion may be achieved by inverse
reaction patterns of different monoclonal antibodies,12 by
quantitative methods like flow cytometry,31,32 and
enzyme-linked immunosorbent assay (ELISA)37 or by the
demonstration of different underlying molecular structures.
Our findings have several practical implications for RhD phenotyping
and RHD genotyping. Comprehensive RHD genotyping is a complex task24 because of many Rhesus hybrid
genes18,19,33,40,42,52,53,55-57,63 and of RhD-negative
phenotypes still harboring RHD-specific
sequences.6,42,64,65 DVI type III adds
to this complexity. It would type RHD negative in a standard
intron 2-based PCR method25 previously believed to type
DVI samples reliably as RHD positive. The
population study (Table 1) provided further evidence for the allelic
variation between closely related populations, which influences the
specificity and sensitivity of Rhesus genotyping. An absolute
match of phenotype and genotype is unlikely to be achieved by current
technology because sporadic nonfunctional alleles occur rather
frequently in genes66 including
Rhesus.67 Hence, the expense of a genotyping system
must be weighed against its residual failure rate in phenotype prediction. DVI is the clinically most important
RHD variant and it might be advantageous to dissociate this
variant both from RHD positive and RHD negative. To
this end, a simple system testing intron 4 and exon 7 may suffice
because any D category VI genotype is likely to lack both
RHD exon 4 and 5 and to retain RHD exon 7.
DVI recipients should be transfused with RhD negative blood
to limit anti-D immunization,17 a rationale that prompted
RhD negative transfusion in patients carrying weak D. This essentially RhD antigen density-based transfusion strategy is today considered wasteful, as it became apparent that most weak D patients may be safely
transfused RhD positive. The wastage might be reduced by lowering of
the weak D threshold for RhD negative transfusion. However, this
measure would trigger RhD positive transfusion in partial D like
DVI type III, while still many RhD negative units
would be transfused to weak D patients not requiring RhD negative
transfusion. In this context, a strategy based on two monoclonal anti-D
that do not react with DVI is advantageous.8,17
This RhD epitope-based transfusion strategy abandons RhD antigen
density as the trigger for RhD negative transfusions and became
mandatory in Germany in 1996.68 It should be advocated in
all regions where DVI is the single clinically important
partial D. For donor typing, weak D is considered Rhesus
positive.69 DVI type III proved that
DVI erythrocytes may carry rather high RhD antigen
densities. The threshold of RhD antigen density and the RhD epitopes
that most likely cause anti-D immunization are not fully established.
We think the transfusion of DVI red blood cells should be
restricted to RhD positive individuals, until further evidence for lack
of immunogenicity is established.
| |
FOOTNOTES |
Submitted July 24, 1997;
accepted November 3, 1997.
Supported by the University of Ulm (Forschungsförderungsprojekt
P. 239) and the DRK-Blutspendedienst Baden-Württemberg, Stuttgart, Germany.
The nucleic acid and amino acid sequence data were deposited in
EMBL/GenBank/DDBJ under the accession numbers Z97026; Z97030; Z97031;
Z97333; Z97334; Z97362 and Z97363.
Address reprint requests to Willy A. Flegel, MD, Abteilung
Transfusionsmedizin, Universität Ulm, and DRK-Blutspendezentrale Ulm, Helmholtzstrasse 10, D-89081 Ulm, Germany.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
| |
ACKNOWLEDGMENT |
We thank Drs Hans-Hermann Sonneborn and Manfred Ernst, Dreieich,
Germany, for generously supplying us with their monoclonal anti-Ds; Drs
Geoff Daniels and Carole A. Green, Bristol, England, for providing
anti-BARC serum and eluate; Dr Jeff W. Jones, Liverpool, England, for
the determination of absolute RhD antigen density on red blood cell
samples that were used as standards; Elisabeth Hörner, Olga
Zarupski, and Esther Rainer for expert technical assistance; and Bryan
Hillesheim for preparing red blood cell and DNA samples.
| |
REFERENCES |
1.
Cherif-Zahar B,
Bloy C,
Le Van Kim C,
Blanchard D,
Bailly P,
Hermand P,
Salmon C,
Cartron JP,
Colin Y:
Molecular cloning and protein structure of a human blood group Rh polypepetide.
Proc Natl Acad Sci USA
87:6243,
1990[Abstract/Free Full Text]
2.
Colin Y,
Cherif-Zahar B,
Le Van Kim C,
Raynal V,
van Huffel V,
Cartron JP:
Genetic basis of the RhD-positive and RhD-negative blood group polymorphism as determined by southern analysis.
Blood
78:2747,
1991[Abstract/Free Full Text]
3.
Le Van Kim C,
Mouro I,
Cherif-Zahar B,
Raynal V,
Cherrier C,
Cartron JP,
Colin Y:
Molecular cloning and primary structure of the human blood group RhD polypeptide.
Proc Natl Acad Sci USA
89:10925,
1992[Abstract/Free Full Text]
4.
Avent ND,
Ridgwell K,
Tanner MJA,
Anstee DJ:
cDNA cloning of a 30 kDa erythrocyte membrane protein associated with Rh (Rhesus)-blood-group-antigen expression.
Biochem J
271:821,
1990[Medline]
[Order article via Infotrieve]
5.
Arce MA,
Thompson ES,
Wagner S,
Coyne KE,
Ferdman BA,
Lublin DM:
Molecular cloning of RhD cDNA derived from a gene present in RhD-positive, but not RhD-negative individuals.
Blood
82:651,
1993[Abstract/Free Full Text]
6.
Huang C-H:
Molecular insights into the Rh protein family and associated antigens.
Curr Opin Hematol
4:94,
1997 [Medline]
[Order article via Infotrieve]
7. Mollison PL, Eng |
Abstract
Introduction
Abstract