|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 91 No. 7 (April 1), 1998:
pp. 2347-2352
A Human Alloantibody Interferes With Binding of Factor IXa to the
Factor VIII Light Chain
By
Karin Fijnvandraat,
Patrick H.N. Celie,
Ellen A.M. Turenhout,
Jan
W. ten Cate,
Jan A. van Mourik,
Koen Mertens,
Marjolein Peters, and
Jan Voorberg
From the Departments of Blood Coagulation and Plasma Protein
Technology, Central Laboratory of the Netherlands Red Cross Blood
Transfusion Service; the Academic Medical Center, University of
Amsterdam, Emma Children's Hospital AMC, Department of Pediatrics; and
the Academic Medical Center, University of Amsterdam, Center for
Hemostasis, Thrombosis, Atherosclerosis and Inflammation Research,
Amsterdam, The Netherlands.
 |
ABSTRACT |
Inhibitory antibodies directed against factor VIII develop in a
substantial number of patients with hemophilia A as a consequence of
factor VIII replacement therapy. These antibodies usually recognize discrete epitopes within the A2 and/or the C2 domains of factor VIII. Here, we have characterized the antibodies present in the plasma
of a patient affected by severe hemophilia A. The antibodies reacted
readily with the metabolically labeled factor VIII light chain and
fragments thereof when analyzed by immunoprecipitation. The inhibitory
activity could be neutralized by the complete light chain, whereas only
slight neutralization occurred with a fragment comprising the isolated
C2 domain. Binding of the majority of antibodies to in vitro
synthesized factor VIII fragments was dependent on the presence of
amino acid residues Gln1778-Met1823, a region
known to contain a factor IXa binding site. Functional characterization
showed that purified IgG from the patient's serum inhibited binding of
factor IXa to immobilized factor VIII light chain in a dose-dependent
manner. These data indicate that human alloantibodies may inhibit
factor VIII activity by interfering with factor IXa-factor VIIIa
complex assembly.
| |
INTRODUCTION |
BLOOD COAGULATION factor VIII serves as a
cofactor of factor IXa in the intrinsic pathway of factor X activation.
Factor VIII circulates in plasma as a heterodimer, composed of a heavy
chain (A1-A2-B) and a light chain (A3-C1-C2).1,2 Before
activation, factor VIII is associated with von Willebrand factor (vWF).
Limited proteolysis by thrombin coincides with release of the active
cofactor from the factor VIII-vWF complex.3
Deficiency or disfunction of factor VIII is associated with the
hereditary bleeding disorder hemophilia A.4 Bleeding
episodes can be prevented or arrested by administration of factor VIII concentrate. In response to multiple treatments, inhibitory antibodies directed against factor VIII may develop. This serious complication occurs in approximately 25% of patients affected by the severe form of
hemophilia A.5-7 The regions to which most human
anti-factor VIII antibodies bind have been localized to the A2 and C2
domain of factor VIII by immunoblotting and immunoprecipitation
assays.8-11 Detailed analysis has established that amino
acid sequence Arg484-Ile508 in the A2 domain
and residues Val2248 to Ser2312 in the C2
domain constitute major epitopes of factor VIII inhibiting antibodies.12,13
Several mechanisms by which inhibitors interfere with factor VIII
procoagulant activity have been identified. Human anti-A2 antibodies
act as noncompetitive inhibitors of the factor X activating complex by
impeding its catalytic activity.14 Antibodies directed against the C2 domain interfere with binding of factor VIII to phospholipids and vWF.15-17 Disruption of factor VIII-vWF
interaction leads to factor VIII elimination in vivo because binding to
vWF is essential to stabilize factor VIII in the circulation. Recently, a novel inhibitory mechanism with a converse effect on the interaction between factor VIII and vWF was disclosed. A human antibody that requires the presence of vWF to display inhibitory characteristics has
been shown to retard the release of thrombin-cleaved factor VIII from
vWF. This antibody, directed towards amino acid sequence Val2248-Gly2285 of the C2 domain, does not
interfere with phospholipid binding of factor VIII.18
Studies using inhibitor neutralization assays have provided evidence
for the presence of additional inhibitor epitopes on the factor VIII
light chain located outside the C2 domain.10,13,19 The
inhibitory mechanism of those antibodies has remained unresolved so
far. Here, we have characterized human inhibitory antibodies directed
towards the light chain of factor VIII by performing neutralization
assays and immunoprecipitation analysis. Functional studies showed that
the antibodies inhibit factor VIII activity by interfering with the
interaction between factor IXa and the light chain of factor VIII.
| |
MATERIALS AND METHODS |
Materials.
DNA-modifying enzymes, restriction enzymes, Grace's insect medium,
fetal calf serum (FCS), and antibiotics were obtained from GIBCO
(Breda, The Netherlands). The serum-free medium EX-CELL 401 was
purchased from JRH Biosciences (Sera Lab Ltd, Crawley, UK).
Oligonucleotide primers, protein G Sepharose-4FF, CNBr-activated Sepharose-4B, and protein A Sepharose CL-4B were obtained from Pharmacia-LKB (Woerden, The Netherlands). Pfu-polymerase was
purchased from Stratagene (Cambridge, UK). Radioactive chemicals were
obtained from Amersham (Bucks, UK). The "Taq track"
sequencing system, the plasmid pSP64 and the in vitro transcription and
translation system using the SP6-expression system were obtained from
Promega (Madison, WI). The plasmid pAcGP67B and the Baculogold
Baculovirus Autographa californica DNA were purchased from
Pharmingen (San Diego, CA). Spodoptera frugiperda (Sf-9) insect
cells and Trichoplusia ni High Five insect cells were obtained
from Invitrogen (Leek, The Netherlands).
Proteins.
Human factor VIII light chain and factor IXa were obtained from human
plasma as previously described.20 Monoclonal antibodies (MoAbs) CLB-CAg 9, CLB-CAg 69, CLB-CAg 117,21,22 and
CLB-FIX 1423 have been described previously. MoAb ESH4 was
obtained from American Diagnostics Inc (Greenwich, CT) and has been
characterized before.13 Murine MoAbs directed against human
IgG1, IgG2, IgG3, and IgG4 were obtained from the Central Laboratory of
the Netherlands Red Cross Blood Transfusion Service.
Coagulation assays.
Blood was collected by venepuncture in one-tenth final volume of 3.2%
(wt/vol) trisodium citrate. After centrifugation for 10 minutes at
12,000g, plasma was collected and immediately stored at
 70°C in 0.5 to 1.0 mL aliquots. Factor VIII procoagulant activity was assayed by a one-stage clotting assay.24 Inhibitor
titers were measured in plasma using the Bethesda assay essentially as described previously and expressed as Bethesda units per milliliter (BU/mL).25
Plasmid constructions.
The construction of plasmids encoding the factor VIII heavy chain, A2
domain, and factor VIII light chain has been described previously.26 The plasmid pCLB-GP67-C2, encoding the C2
domain (amino acid residues 2172 to 2332), was constructed by
polymerase chain reaction (PCR) using oligonucleotide primer C2-1 (5
GTGCCATGGGTAGTTGCAGCATGCCATTG 3; nucleotide position 6574-6591 of
factor VIII, sense) and primer C2-2 (5CCATAGGTTGGAATCTAA 3;
nucleotide position 1222-1239 of pBPV, antisense), using plasmid
pCLB-BPVdB695 as a template.27 Reaction conditions for PCR
were: 5 minutes, 95°C; 2 minutes, 50°C; 3 minutes, 72°C; 37 cycles of 45 seconds, 95°C; 90 seconds, 50°C; 3 minutes, 72°C; 5 minutes, 65°C in the presence of 1 mmol/L dNTPs,
Pfu-polymerase reaction buffer, 50 pmol of each oligonucleotide primer, and 2.5 U Pfu-polymerase. After amplification the
fragment was digested with NcoI and NotI and cloned into plasmid
pAcGP67B. Truncated fragments corresponding to parts of the A3 domain
of factor VIII were constructed with the use of plasmid pSP/F8-80K1 as
a template, as described previously.21,23
Expression and metabolic labeling of selective domains of factor
VIII in insect cells.
Recombinant baculovirus expressing the recombinant factor VIII heavy
chain, A2 domain, light chain, and C2 domain were obtained after
transfection of Sf-9 cells according to the instructions of the
supplier. The production of [35S] methionine-labeled
factor VIII fragments has been described previously.26 In
short, High Five cells were infected with recombinant baculovirus and
pulse-labeled with [35S] methionine. Medium of
metabolically labeled cells was then collected in immunoprecipitation
buffer. In vitro translation of the truncated fragments of the A3
domain of factor VIII was performed with the use of the SP6-expression
system, in the presence of [35S]methionine, as described
previously.23
Immunoprecipitation.
Immunoprecipitation was performed essentially as described
previously.26 Briefly, conditioned media were incubated
overnight at 4°C with preformed complexes of Protein G Sepharose-4FF
and 30 µL patient plasma. The expression of the factor VIII fragments was monitored using MoAbs CLB-CAg 9 (1 µg/mL) directed against the A2
domain of the heavy chain of factor VIII, CLB-CAg 117 (1 µg/mL)
directed against the C2 domain of the light chain of factor VIII, and
MoAb CLB-CAg 69 (1 µg/mL) directed against amino acid sequence
Lys1673-Arg1689 of the factor VIII light
chain.22 The specificity of the adsorption was addressed
using plasma of several healthy donors. Antibody subclass typing was
performed using subclass specific MoAbs ( IgG1, IgG2, IgG3, and
IgG4) covalently linked to CNBr-activated Sepharose-4B. Bound
proteins were eluted by boiling in sodium dodecyl sulfate (SDS) sample
buffer and analyzed under reducing conditions on a 10% (wt/vol)
SDS-polyacrylamide gel and visualized by autoradiography.
Inhibitor neutralization assay.
Fragments corresponding to the factor VIII light chain and the C2
domain were derived from High Five cells infected with recombinant baculovirus encoding the factor VIII light chain and the C2 domain. Recombinant factor VIII fragments present in 75% (vol/vol) serum free
medium and 25% (vol/vol) Grace's insect medium containing 2.5%
(vol/vol) FCS were dialyzed against 50 mmol/L Tris-HCl, pH 7.4; and 150 mmol/L NaCl. The amount of factor VIII fragments in the conditioned
medium was determined by an enzyme-linked immunosorbent assay method
using MoAbs ESH413 and CLB-CAg 117 (Fig
1), both directed against the C2 domain of
factor VIII. Samples were incubated with immobilized ESH4 (0.5 µg/well) in 50 mmol/L Tris-HCl, pH 7.4; 1 mol/L NaCl; and 2% human
serum albumin (HSA). Bound factor VIII fragments were detected using
peroxidase-labeled CLB-CAg 117 in 50 mmol/L Tris-HCl, pH 7.4; 1 mol/L
NaCl; and 0.1% (vol/vol) Tween-20. Pooled normal human
plasma served as a standard. Inhibitor neutralization was performed
essentially as described previously.19 After measurement of
the inhibitor titer, the inhibitor plasma was diluted to 2 BU/mL in a
buffer consisting of 50 mmol/L Tris-HCl, pH 7.3; and 0.2% HSA. Diluted
inhibitor plasma was incubated for 2 hours at 37°C with an equal
volume of pooled normal plasma and an equal volume of conditioned
medium. The conditioned medium contained increasing concentrations of
either factor VIII light chain or C2 domain, diluted in the same buffer
as the inhibitor plasma. Residual factor VIII activity in the
incubation mixture was determined relative to a control sample that was
incubated in the absence of inhibitor plasma. Functional integrity of
the fragment corresponding to the C2 domain was determined by
neutralization experiments with the factor VIII inhibiting,
conformation-dependent MoAb CLB-CAg 117. On a molar basis, factor VIII
fragments corresponding to the light chain and the C2 domain could
alleviate the inhibitory activity of CLB-CAg 117 to the same extent
(data not shown). This observation indicates that the conformation of
the recombinant C2 domain fragment is very similar to that of the C2
domain within the factor VIII light chain.
View larger version (52K):
[in this window]
[in a new window]
View larger version (54K):
[in this window]
[in a new window]
View larger version (68K):
[in this window]
[in a new window]
| Fig 1.
Immunoprecipitation of recombinant factor VIII fragments
with antibodies present in the inhibitor plasma. Recombinant factor VIII fragments corresponding to the factor VIII light chain (80K), the
C2 domain (C2), the factor VIII heavy chain (90K), and the A2 domain
(A2) were expressed in High Five cells and metabolically labeled as
described.26 Binding of antibodies to the metabolically labeled factor VIII fragments was assessed by immunoprecipitation. Bound proteins were eluted and analyzed under reducing conditions on a
10% (wt/vol) SDS-polyacrylamide gel. (A) Reactivity of anti-factor VIII antibodies with factor VIII light chain fragments. Lane 1, CLB-CAg
117; lane 2, control plasma; lane 3, antibodies present in patient's
plasma. (B) Reactivity of antibodies with factor VIII heavy chain
fragments. Lane 1, CLB-CAg 9; lane 2, control plasma; lane 3, antibodies present in patient's plasma. (C) Subclass determination of
anti-factor VIII antibodies. Binding of anti-factor VIII antibodies to
metabolically labeled factor VIII light chain was performed using
subclass specific antibodies. Lane 1, total IgG; lane 2, IgG1; lane 3, IgG2; lane 4, IgG3; lane 5, IgG4. Molecular weight markers are given at
the right of the figure.
|
|
Binding assays.
IgG was purified from the patient's serum using protein A Sepharose
CL-4B. The final preparations of total IgG had an inhibitor titer of 4 BU/mg IgG. IgG derived from a healthy donor was used as a control.
Binding of factor IXa to immobilized factor VIII light chain was
assessed by using a modification of a previously described
method.20 Briefly, MoAb CLB-CAg 12 (10 µg/mL) was immobilized to microtiter wells and incubated with 62.5 nmol/L of
plasma-derived factor VIII light chain. Subsequently, varying concentrations of purified IgG (0 to 1.7 mg/mL, corresponding to
approximately 0 to 10.7 µmol/L) were incubated for 2 hours at 37°C
in a buffer containing 20 mmol/L Histidine, pH 6.2; 100 mmol/L NaCl; 5 mmol/L CaCl2; and 0.1% Tween-20. Wells were washed three
times with the same buffer before 40 nmol/L factor IXa was added and
incubated for 4 hours at 37°C. Bound factor IXa was detected by
incubating for 15 minutes at room temperature with peroxidase-labeled
MoAb CLB-FIX 14.23 Residual factor IXa bound was calculated
relative to a control experiment in which no IgG was added.
Patient.
The patient, born in Turkey in 1952, was a sporadic case of severe
hemophilia A. He was treated with whole blood and plasma transfusions
for various bleeding episodes before he came to the Netherlands in
1974. In 1977 a lack of recovery was noted after administration of
cryoprecipitate (2,000 IU factor VIII) for gastric bleeding and
hemarthros. It was concluded that he had developed antibodies directed
towards factor VIII. No data on the inhibitor titer from the period
1977 to 1982 are available. Between 1982 and 1995 the inhibitor titer
varied between 40 to 80 BU/mL. He was successfully treated with
FEIBA (Baxter IMMUNO, Vienna, Austria) for hemarthros and
muscle bleedings. The patient did not undergo an immune tolerance
regimen. The experiments in this study were all performed on a plasma
sample from 1995 in which the inhibitor titer was 40 BU/mL.
| |
RESULTS |
Epitope mapping of anti-factor VIII antibodies.
We characterized the anti-factor VIII antibodies present in the plasma
of a patient severely affected by hemophilia A. Immunoprecipitation analysis, using metabolically labeled factor VIII fragments expressed in insect cells, clearly showed binding to the light chain of factor
VIII (Fig 1A, left). Immunoprecipitation using IgG subclass specific
antibodies showed that predominantly IgG4 and IgG2 antibodies accounted
for binding to the radio-labeled factor VIII light chain, whereas some
IgG1 antibodies could be detected as well (Fig 1C). A faint signal was
observed for binding of the antibodies to a radio-labeled fragment
corresponding to the C2 domain (Fig 1A, right). No binding to either
the heavy chain of factor VIII or the A2 domain could be detected (Fig
1B). These findings suggest that the patient's plasma contains
antibodies against at least one epitope on the factor VIII light chain
located outside the C2 domain. To address this issue from a functional
perspective, an inhibitor neutralization assay using recombinant factor
VIII light chain and C2 domain was performed. By virtue of their
distinctive neutralization of the inhibitory activity, these factor
VIII fragments provide an estimate of the relative contributions of the
epitope in the C2 domain and the unknown light chain epitope to the
entire inhibitory activity present in the patient's plasma. Complete neutralization occurred by addition of the light chain fragment, whereas only 5% neutralization was obtained when the same
concentration of a fragment corresponding to the C2 domain was added
(Fig 2). This indicates that the factor
VIII inhibitory activity present in the patient's plasma is
predominantly accounted for by antibodies that bind to a light chain
epitope located outside the C2 domain.
View larger version (17K):
[in this window]
[in a new window]
| Fig 2.
Neutralization of inhibitor activity by recombinant
factor VIII fragments. Neutralization of the inhibitory activity by
factor VIII light chain ( ) and factor VIII C2 domain ( ). The
patient's plasma was diluted to 2 BU/mL and incubated for 2 hours at
37°C with the indicated concentrations of recombinant factor VIII
light chain or C2 domain. The residual factor VIII activity in the
incubation mixture was determined relative to a control sample that was
incubated in the absence of inhibitor plasma. Each datapoint represents the mean (±SD) of three experiments.
|
|
An important functional region located outside the C2 domain on the
factor VIII light chain, consisting of amino acid residues Glu1811-Lys1818, has previously been identified
as a binding site for factor IXa.23 To address the question
of whether the antibodies recognize an epitope in the vicinity of the
factor IXa binding site on the factor VIII light chain, we performed
immunoprecipitation experiments using in vitro synthesized factor VIII
fragments. These recombinant factor VIII fragments, comprising
carboxyterminal truncations of the factor VIII light chain were in
vitro transcribed and then translated in the presence of
[35S]-methionine21 (Fig
3A). Binding of the in vitro synthesized factor VIII fragments using CLB-CAg 69, directed against amino acid
sequence Lys1673-Arg1689, showed that all
fragments had the expected size (Fig 3B, left). The antibodies present
in the patient's plasma bound to the larger two fragments. Binding to
the fragment comprising amino acid sequence Asp1563-Gln1778 was strongly reduced (Fig 3B,
right). With reference to Fig 3A these data show that amino acid
sequence Gln1778-Met1823 comprises a major
epitope for the antibodies present in the patient's plasma.
View larger version (10K):
[in this window]
[in a new window]
View larger version (58K):
[in this window]
[in a new window]
| Fig 3.
Epitope mapping of antibodies present in the inhibitor
plasma by immunoprecipitation. (A) Structure of the factor VIII light chain and the carboxyterminal truncated polypeptides synthesized in
vitro and used for immunoprecipitation. The bar at the top of the
figure represents the domain structure of the factor VIII light chain
with the neighboring B domain. The amino acid residue numbers below the
bar indicate the boundaries between the domains. The epitope for MoAb
CLB-CAg 69, consisting of the amino acid residues
Lys1673-Arg1689 within the amino-terminal
region of the A3 domain (22), is indicated by a black bar. The three
lines at the bottom of the figure represent three carboxyterminal
truncated polypeptides. 1, Asp1563-Asp1840; 2, Asp1563-Gln1778; 3, Asp1563-Met1823. (B) Reactivity of MoAb CLB-CAg
69 (left) and patient's plasma (right) with truncated recombinant
fragments of the A3 domain of factor VIII. Binding of anti-factor VIII
antibodies to the metabolically labeled factor VIII fragments was
assessed by immunoprecipitation and analyzed under reducing conditions
on a 10% (wt/vol) SDS-polyacrylamide gel. Lane 1, Asp1563-Asp1840; lane 2, Asp1563-Gln1778; lane 3, Asp1563-Met1823.
|
|
Effect of human anti-factor VIII antibodies on the interaction of
factor IXa with the factor VIII light chain.
Binding to the factor VIII light chain epitope
Gln1778-Met1823 suggests that the antibodies
inhibit factor VIII activity by interfering with complex assembly of
factor VIII and factor IXa.23 To test this, we evaluated
the effect of patient's IgG in a binding assay of factor IXa and
immobilized factor VIII light chain. Increasing concentrations of
patient's IgG inhibited the binding of factor IXa to the factor VIII
light chain in a dose-dependent manner (Fig
4). The concentration of IgG required to
achieve 50% inhibition was 0.5 mg/mL, corresponding to 2 BU/mL. In
contrast, IgG from a healthy individual did not compete for binding of
factor IXa. These data provide evidence that the antibodies present in
the plasma of a patient with hemophilia A inhibit factor VIII activity by interfering with assembly of the factor VIIIa-factor IXa complex.
View larger version (15K):
[in this window]
[in a new window]
| Fig 4.
Effect of IgG on the interaction between factor IXa and
factor VIII light chain. Various concentrations of purified IgG from the inhibitor patient () and a healthy control () were incubated with factor VIII light chain immobilized by MoAb CLB-CAg 12 on a
microtiter plate. After 2 hours incubation at 37°C the IgG was removed and 40 nmol/L factor IXa was added. Residual factor IXa bound
was determined after 4 hours of incubation at 37°C and calculated relative to a control experiment in which no IgG was added. Each datapoint represents the mean (±SD) of at least three experiments.
|
|
| |
DISCUSSION |
Inhibitory antibodies that arise after factor VIII replacement therapy
constitute a serious complication of hemophilia treatment. Insight into
the epitope specificity and mechanism of action of these inhibitory
antibodies has evolved over the past few years.12-17 At
present two major inhibitor epitopes have been localized at amino acid
sequence Arg484-Ile508 and
Val2248-Ser2312 of factor
VIII.12,13 Here, we describe an additional inhibitor epitope for human anti-factor VIII antibodies, consisting of amino acid
residues Gln1778-Met1823, located within the A3
domain of factor VIII. Previous studies from our laboratory have
provided evidence for the presence of a factor IXa interactive site at
amino acid position Glu1811-Lys1818 of the
factor VIII light chain.20,23 In agreement with the observed epitope specificity, purified IgG derived from patient's plasma interferes with binding of factor IXa to the factor VIII light
chain. It should be noted that a large amount of purified IgG is needed
to inhibit binding of factor IXa to the factor VIII light chain. This
is most likely caused by the low amount of factor VIII-specific
antibodies present in the purified IgG fraction that was used in this
study.
Attempts to further narrow the epitope of the human alloantibody
described above using synthetic peptides corresponding to Tyr1786-Ala1801,
Gly1799-Lys1813, and
Thr1815-Ala1834 have been unsuccessful.
Purified patient's IgG did not bind to the three synthetic peptides
when immobilized on microtiter wells. Furthermore, none of the three
peptides could alleviate the inhibitory activity of the antibody in
inhibitor neutralization assays when added in concentrations up to 1 mmol/L (data not shown). The above findings suggest that binding of the
human antibody described in this study may depend on the conformation
of this part of the factor VIII light chain.
Several inhibitors both in congenital and acquired hemophilia have been
described which can be almost completely neutralized by the factor VIII
light chain, whereas only partial neutralization occurs in the presence
of the C2-domain.13,19 Recently, an inhibitor patient was
identified whose antibodies bound to a fragment comprising the A3 and
C1 domain of factor VIII.28 Binding of the antibody to this
fragment could be completely abolished by the addition of the synthetic
peptide Lys1804-Val1819 which overlaps the
inhibitor epitope described in this study.28 Together with
our data these findings suggest that a subset of human inhibitors
interacts with the factor IXa binding site on the light chain of factor
VIII.
It should be noted that the heterogeneity of the antibody preparation
used in this study may complicate interpretation of the results
obtained. For instance, we are unable to exclude that an additional
antibody binding site is present between amino acid residues
Lys1818 and Cys2174 on the factor VIII light
chain. Furthermore, our analysis may be affected by the small amounts
of anti-C2 antibodies present in the patient's plasma. The above
considerations warrant careful interpretation of the results obtained
but do not seem to limit our conclusion with regard to the biological
activity of the inhibitory antibodies described in this study.
The interaction between factor IXa and the factor VIII light chain is
modulated by vWF.20 Thus, amino acid sequence
Gln1778-Met1823 which contains the factor IXa
binding site may not be exposed when factor VIII is bound to vWF.
Shielding of antigenic sites by vWF has been observed for the
extensively studied epitope in the C2 domain of factor
VIII.29 In the latter study the presence of additional
epitopes on the factor VIII light chain located outside the C2 domain
was not taken into account. Reduced binding of inhibitors to
Gln1778-Met1823 may in part explain the
modulating effect of vWF on the inhibitory activity described in that
study.29 Whether shielding of antigenic sites on the factor
VIII light chain by vWF constitutes an etiologic factor in inhibitor
formation remains to be established.
| |
FOOTNOTES |
Submitted April 13, 1997;
accepted November 19, 1997.
Address reprint requests to Jan Voorberg, PhD, Dept of Blood
Coagulation, Central Laboratory of the Netherlands Red Cross Blood
Transfusion Service, Plesmanlaan 125, 1066 CX Amsterdam, The
Netherlands.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.
| |
ACKNOWLEDGMENT |
We thank Dr P.J. Lenting for his advice concerning the factor IXa
binding assay and competition experiments and H. ter Maat for providing
the purified factor IXa. We gratefully acknowledge Dr O.D. Christophe
and Dr E.N. van den Brink for critical reading of the manuscript.
| |
REFERENCES |
1.
Toole JJ,
Knopf JL,
Wozney JM,
Sultzman LA,
Buecker JL,
Pittman DD,
Kaufman RJ,
Brown E,
Shoemaker C,
Orr EC,
Amphlett GW,
Foster WB,
Coe ML,
Knutson GJ,
Fass DN,
Hewick RM:
Molecular cloning of a cDNA encoding human antihaemophilic factor.
Nature
312:342,
1984[Medline]
[Order article via Infotrieve]
2.
Vehar GA,
Keyt B,
Eaton D,
Rodriguez H,
O'Brien DPO,
Rotblat F,
Oppermann H,
Keck R,
Wood WI,
Harkins RW,
Tuddenham EGD,
Lawn RM,
Capon DJ:
Structure of human factor VIII.
Nature
312:337,
1984[Medline]
[Order article via Infotrieve]
3.
Lollar P,
Hill-Eubanks DC,
Parker CG:
Association of the factor VIII light chain with von Willebrand factor.
J Biol Chem
263:10451,
1988[Abstract/Free Full Text]
4.
Hoyer L:
Hemophilia A.
N Engl J Med
330:38,
1994[Free Full Text]
5.
de Biasi R,
Rocino A,
Papa ML,
Salerno E,
Mastrullo L,
De Blasi D:
Incidence of factor VIII inhibitor development in hemophilia A patients treated with less pure plasma derived concentrates.
Thromb Haemost
71:544,
1994[Medline]
[Order article via Infotrieve]
6.
Bray GL,
Gomperts ED,
Courter S,
Gruppo R,
Gordon EM,
Manco-Johnson M,
Shapiro A,
Scheibel E,
White III G,
Lee M,
the Recombinate Study Group:
A multicenter study of recombinant factor VIII (Recombinate): Safety, efficacy, and inhibitor risk in previously untreated patients with hemophilia A.
Blood
83:2428,
1994[Abstract/Free Full Text]
7.
Lusher JM,
Arkin S,
Abildgaard CF,
Schwartz RS(null):
Recombinant factor VIII for the treatment of previously untreated patients with hemophilia A.
N Engl J Med
328:453,
1993[Abstract/Free Full Text]
8.
Fulcher CA,
de Graaf Mahoney S,
Roberts JR,
Kasper CK,
Zimmerman TS:
Localization of human factor VIII inhibitor epitopes to two polypeptide fragments.
Proc Natl Acad Sci USA
82:7728,
1985[Abstract/Free Full Text]
9.
Scandella D,
de Graaf Mahoney S,
Mattingly M,
Roeder D,
Timmons L,
Fulcher CA:
Epitope mapping of human factor VIII inhibitor antibodies by deletion analysis of factor VIII fragments expressed in Escherichia coli.
Proc Natl Acad Sci USA
85:6152,
1988[Abstract/Free Full Text]
10.
Scandella D,
Mattingly M,
de Graaf S,
Fulcher CA:
Localization of epitopes for human factor VIII inhibitor antibodies by immunoblotting and antibody neutralization.
Blood
74:1618,
1989[Abstract/Free Full Text]
11.
Scandella D,
Timmons L,
Mattingly M,
Trabold N,
Hoyer LW:
A soluble recombinant factor VIII fragment containing the A2 domain binds to some human anti-factor VIII antibodies that are not detected by immunoblotting.
Thromb Haemost
67:665,
1992[Medline]
[Order article via Infotrieve]
12.
Healey JF,
Lubin IM,
Nakai H,
Saenko EL,
Hoyer LW,
Scandella D,
Lollar P:
Residues 484-508 contain a major determinant of the inhibitory epitope in the A2 domain of human factor VIII.
J Biol Chem
270:14505,
1995[Abstract/Free Full Text]
13.
Scandella D,
Gilbert GE,
Shima M,
Nakai H,
Eagleson C,
Felch M,
Prescott R,
Rajalakshmi KJ,
Hoyer LW,
Saenko E:
Some factor VIII inhibitor antibodies recognize a common epitope corresponding to C2 domain amino acids 2248 through 2312, which overlap a phospholipid-binding site.
Blood
86:1811,
1995[Abstract/Free Full Text]
14.
Lollar P,
Parker ET,
Curtis JE,
Helgerson SL,
Hoyer LW,
Scott ME,
Scandella D:
Inhibition of human factor VIIIa by anti-A2 antibodies.
J Clin Invest
93:2497,
1994
15.
Arai M,
Scandella D,
Hoyer LW:
Molecular basis of factor VIII inhibition by human antibodies.
J Clin Invest
83:1978,
1989
16.
Shima M,
Scandella D,
Yoshioka A,
Nakai H,
Tanaka I,
Kamisue S,
Terada S,
Fukui H:
A factor VIII neutralizing monoclonal antibody and a human inhibitor alloantibody recognizing epitopes in the C2 domain inhibit factor VIII binding to von Willebrand factor and to phosphatidylserine.
Thromb Haemost
69:240,
1993[Medline]
[Order article via Infotrieve]
17.
Saenko EL,
Shima M,
Rajalakshmi KJ,
Scandella D:
A role for the C2 domain of factor VIII in binding to von Willebrand factor.
J Biol Chem
269:11601,
1994[Abstract/Free Full Text]
18.
Saenko EL,
Shima M,
Gilbert GE,
Scandella D:
Slowed release of thrombin-cleaved factor VIII from von Willebrand factor by a monoclonal and a human antibody is a novel mechanism for factor VIII inhibition.
J Biol Chem
271:27424,
1996[Abstract/Free Full Text]
19.
Scandella D,
Mattingly M,
Prescott R:
A recombinant factor VIII A2 domain polypeptide quantitatively neutralizes human inhibitor antibodies that bind to A2.
Blood
82:1767,
1993[Abstract/Free Full Text]
20.
Lenting PJ,
Donath MSH,
van Mourik JA,
Mertens K:
Identification of a binding site for blood coagulation factor IXa on the light chain of human factor VIII.
J Biol Chem
269:7150,
1994[Abstract/Free Full Text]
21.
Leyte A,
Mertens K,
Distel B,
Evers RF,
de Keyzer-Nellen MJM,
Groenen-van Dooren MMCL,
de Bruin J,
Pannekoek H,
van Mourik JA,
Verbeet M:
Inhibition of human coagulation factor VIII by monoclonal antibodies; mapping of functional epitopes with the use of recombinant factor VIII fragments.
Biochem J
263:187,
1989[Medline]
[Order article via Infotrieve]
22.
Leyte A,
Verbeet MPh,
Brodniewicz-Proba T,
Van Mourik JA,
Mertens K:
The interaction between human blood coagulation factor VIII and von Willebrand factor; characterization of a high-affinity binding site on factor VIII.
Biochem J
257:679,
1989[Medline]
[Order article via Infotrieve]
23.
Lenting PJ,
van de Loo JHP,
Donath MSH,
van Mourik JA,
Mertens K:
The sequence Glu1811-Lys1818 of human blood coagulation factor VIII comprises a binding site for activated factor IX.
J Biol Chem
271:1935,
1996[Abstract/Free Full Text]
24.
Veltkamp JJ,
Drion EF,
Loeliger EA:
Detection of the carrier state in hereditary coagulation disorders I.
Thromb Diath Haemorrh
19:279,
1968[Medline]
[Order article via Infotrieve]
25.
Kasper CK,
Aledort LM,
Counts RB,
Edson JR,
Frantantoni J,
Green D,
Hampton JW,
Hilgartner MW,
Lazerson J,
Levine PH,
McMillan CW,
Pool JG,
Shapiro SS,
Shulman NR,
van Eijs J:
A more uniform measurement of factor VIII inhibitors.
Thromb Diath Haemorrh
34:869,
1975[Medline]
[Order article via Infotrieve]
26.
Fijnvandraat K,
Turenhout EAM,
van den Brink EN,
ten Cate JW,
van Mourik JA,
Peters M,
Voorberg J:
The missense mutation Arg593 Cys is related to antibody formation in a patient with mild hemophilia A.
Blood
89:4371,
1997[Abstract/Free Full Text]
27.
Mertens K,
Donath MJSH,
van Leen RW,
de Keijzer-Nellen MJM,
Verbeet MPh,
Klaasse Bos JM,
Leyte A,
van Mourik JA:
Biological activity of recombinant factor VIII variants lacking the central B-domain and the heavy chain sequence Lys713-Arg740: Discordant in vitro and in vivo activity.
Br J Haematol
85:133,
1993[Medline]
[Order article via Infotrieve]
28. (abstr)
Zhong D,
Scandella D:
Epitope of a hemophilia A inhibitor antibody overlaps the factor VIII binding site for factor IX.
Blood
88:324a,
1996
29.
Suzuki T,
Arai M,
Amano K,
Kagawa K,
Fukutake K:
Factor VIII inhibitor antibodies with C2 domain specificity are less inhibitory to factor VIII complexed with von Willebrand factor.
Thromb Haemost
76:749,
1996[Medline]
[Order article via Infotrieve]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
N. Bovenschen, R. C. Boertjes, G. van Stempvoort, J. Voorberg, P. J. Lenting, A. B. Meijer, and K. Mertens
Low Density Lipoprotein Receptor-related Protein and Factor IXa Share Structural Requirements for Binding to the A3 Domain of Coagulation Factor VIII
J. Biol. Chem.,
March 7, 2003;
278(11):
9370 - 9377.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Villard, D. Piquer, S. Raut, J.-P. Leonetti, J.-M. Saint-Remy, and C. Granier
Low Molecular Weight Peptides Restore the Procoagulant Activity of Factor VIII in the Presence of the Potent Inhibitor Antibody ESH8
J. Biol. Chem.,
July 19, 2002;
277(30):
27232 - 27239.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. N. van den Brink, W. S. Bril, E. A. M. Turenhout, M. Zuurveld, N. Bovenschen, M. Peters, T. T. Yee, K. Mertens, D. A. Lewis, T. L. Ortel, et al.
Two classes of germline genes both derived from the VH1 family direct the formation of human antibodies that recognize distinct antigenic sites in the C2 domain of factor VIII
Blood,
April 15, 2002;
99(8):
2828 - 2834.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H.-J. M. Brinkman, K. Mertens, and J. A. van Mourik
Phospholipid-Binding Domain of Factor VIII Is Involved in Endothelial Cell-Mediated Activation of Factor X by Factor IXa
Arterioscler Thromb Vasc Biol,
March 1, 2002;
22(3):
511 - 516.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. N. van den Brink, E. A. M. Turenhout, N. Bovenschen, B. G. A. D. H. Heijnen, K. Mertens, M. Peters, and J. Voorberg
Multiple VH genes are used to assemble human antibodies directed toward the A3-C1 domains of factor VIII
Blood,
February 15, 2001;
97(4):
966 - 972.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M.-L. Liu, B. W. Shen, S. Nakaya, K. P. Pratt, K. Fujikawa, E. W. Davie, B. L. Stoddard, and A. R. Thompson
Hemophilic factor VIII C1- and C2-domain missense mutations and their modeling to the 1.5-angstrom human C2-domain crystal structure
Blood,
August 1, 2000;
96(3):
979 - 987.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. N. van den Brink, E. A. M. Turenhout, C. M. C. Bank, K. Fijnvandraat, M. Peters, and J. Voorberg
Molecular analysis of human anti-factor VIII antibodies by V gene phage display identifies a new epitope in the acidic region following the A2 domain
Blood,
July 15, 2000;
96(2):
540 - 545.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. N. van den Brink, E. A. M. Turenhout, J. Davies, N. Bovenschen, K. Fijnvandraat, W. H. Ouwehand, M. Peters, and J. Voorberg
Human antibodies with specificity for the C2 domain of factor VIII are derived from VH1 germline genes
Blood,
January 15, 2000;
95(2):
558 - 563.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. T. Barrow, J. F. Healey, D. Gailani, D. Scandella, and P. Lollar
Reduction of the antigenicity of factor VIII toward complex inhibitory antibody plasmas using multiply-substituted hybrid human/porcine factor VIII molecules
Blood,
January 15, 2000;
95(2):
564 - 568.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. J. Lenting, J. G. Neels, B. M. M. van den Berg, P. P. F. M. Clijsters, D. W. E. Meijerman, H. Pannekoek, J. A. van Mourik, K. Mertens, and A.-J. van Zonneveld
The Light Chain of Factor VIII Comprises a Binding Site for Low Density Lipoprotein Receptor-related Protein
J. Biol. Chem.,
August 20, 1999;
274(34):
23734 - 23739.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Abstract
Introduction
Abstract