|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 91 No. 7 (April 1), 1998:
pp. 2397-2405
c-kit Is Expressed in Soft Tissue Sarcoma of Neuroectodermic
Origin and Its Ligand Prevents Apoptosis of Neoplastic Cells
By
Emanuela Ricotti,
Franca Fagioli,
Emanuela Garelli,
Claudia Linari,
Nicoletta Crescenzio,
Alberto L. Horenstein,
Paola Pistamiglio,
Sergio Vai,
Massimo Berger,
Luca Cordero diMontezemolo,
Enrico Madon, and
Giuseppe Basso
From the Department of Pediatrics and the Laboratory of Cell Biology,
Department of Genetics, Biology and Biochemistry, the University of
Turin, Torino, Italy.
 |
ABSTRACT |
During development, mice with mutations of stem cell factor (SCF) or
its receptor c-kit exhibit defects in melanogenesis, as well as
hematopoiesis and gonadogenesis. Consequently, accumulating evidence
suggests that the c-kit/SCF system plays a crucial role in all
of these processes and in tumors which derive from them. Especially in
neuroblastoma (infant tumors of neuroectoderm crest derivation such as
melanocytes) it would appear that an autocrine loop exists between
c-kit and SCF, and that the functional block of the
c-kit receptors with monoclonal antibodies (MoAbs) results in a
significant decrease in cellular proliferation. We studied the
expression and role of c-kit and SCF in cell lines of soft tissue sarcoma of neuroectodermic origin, such as Ewing's sarcoma (ES)
and peripheral neuro-ectodermal tumors (PNET). Using flow cytometry
with MoAb CD117 PE, c-kit expression was highlighted in all six
of the cell lines examined. This receptor was specifically and
functionally activated by SCF, as shown by the binding experiments and
the intracellular phosphotyrosine and immunoprecipitation studies that
were performed. Using reverse transcriptase polymerase chain reaction
analysis, five of the six cellular lines expressed the mRNA of SCF. In
the medium measured by using an enzyme- linked immunosorbent assay, low
concentrations of SCF were found: only the TC32 cellular line produced
significantly higher levels (32 pg) than control. In serum-free culture
the addition of SCF reduced the percentage of apoptotic cells from 25%
to 90% in five out of the six cellular lines. This observation was
confirmed by (1) the functional block of c-kit with MoAb: after
7 days of culture more than 30% of the cells were apoptotic (range
31.5% to 100%) in five out of six cell lines and there was also a
decrease in the percentage of cells in phase S, and (2) c-kit
antisense oligonucleotides: in the cellular lines treated with
oligonucleotides (in relation to the untreated lines) there was a
notable reduction (P < .001) both in the absolute number of
cells and the 3H-thymidine uptake. These results indicate
that ES and PNET express c-kit and its ligand SCF and that SCF
is capable of protecting the tumor cells against apoptosis.
Furthermore, the reverse transcriptase-polymerase chain reaction
performed on the biopsies revealed the presence of mRNA both of SCF and
c-kit in practically all of the samples studied. Our in vitro
data lead us to assume that SCF may also inhibit tumor cell apoptosis
in vivo.
| |
INTRODUCTION |
THE c-kit PROTO-ONCOGENE,
encoding a 145- to 165-kD membrane-bound glycoprotein of
the transmembrane tyrosine kinase family, has been identified as a
homologue of the sarcoma retrovirus HZ4-FeSV transforming
gene.1 The ligand for c-kit is alternatively known as the stem cell factor (SCF), mast cell growth factor, steel factor,
or kit ligand.2,3
During development, mice with the c-kit or SCF mutations
exhibit defects in melanogenesis, as well as hematopoiesis and
gonadogenesis.4 Consequently, accumulating evidence
suggests that the c-kit/SCF system plays a crucial role in all
of these processes.5-9
This system is also present on the neoplastic counterpart of these
cells.10,11 In particular, the mRNA coexpression of the SCF
and c-kit has been reported in certain cases of acute myeloid
leukemia,12 round cell pulmonary tumors,13 and
breast carcinoma.14 This has led to the hypothesis of the
existence of an autocrine loop between SCF/c-kit.
Cohen et al15 suggested the presence of this loop in
neuroblastoma, neuroectoderm derived infant tumors, and also showed that the c-kit block with the use of a monoclonal antibody
(MoAb) is capable of inducing a reduction of the growth of colonies in agar and of the percentage of cells in S phase.15
Comparable experiments, conducted on human neuroblastoma lines, with
the anti-c-kit blocking antibody, have shown that the SCF
could inhibit the apoptosis rather than directly stimulate
proliferation.16
No data is available in relation to the c-kit/SCF role in soft
tissue sarcoma of neuroectodermic origin, such as Ewing's sarcoma (ES)
and peripheral neuroectodermal tumor (PNET).17
In this report we investigated whether c-kit and SCF are
expressed in ES and PNET and whether c-kit and SCF play a role
in growth regulation of these malignancies.
| |
MATERIALS AND METHODS |
Cell lines and tissue samples.
Six cellular lines were studied: three deriving from ES 6647, TC106,
and PDE02; and three from PNETTC32, PDN12, and PDN13. The 6647, TC106, and TC32 was kindly provided by Dr Pagani (Department of
Biomedical Science and Human Oncology, University of
Turin).18 The PDE-02, PDN12, and PDN13 were obtained in our
laboratory from biopsies at diagnosis.19
The human megakaryoblastic leukemia cell line M-07e20 and
an Epstein-Barr virus (EBV)-transformed lymphoblastoid cell line were used as controls. All cell lines were maintained in RPMI 1640 media
supplemented with 10% fetal calf serum (FCS) and 0.2 mg/mL of
penicillin/streptomycin. Thirteen surgical biopsies collected from five
ES and eight PNET were obtained from our pathology laboratory after
rigorous histological evaluation. In three cases cytogenetic results
were not available. The classical cytogenetic translocation t(11;22)(q24;q21) was identified in 9 out of the 10 remaining cases,
and in the last case, a PNET, the i(1q), t(2;21)(p21;q22) was shown.
Cytofluorimetric detection of surface c-kit receptor.
With the anti-CD117 phycoerythrin (PE)-conjugated MoAb (Ancell Corp,
Bayport, MN), 5 × 105 cells were incubated at 4°C for
30 minutes, then washed twice in phosphate-buffered saline (PBS) and
analyzed by flow cytometry (Epics-XL; Coulter, Miami, FL).
PE-conjugated isotypic antibody was used as control and M-07e was used
as a positive control.
To quantify the average number of c-kit receptors per cell, the
Quantum (TM) 27 R-Phycoerythrin-conjugated kit (Flow Cytometry Standard
Corporation, San Juan, Puerto Rico) was used. This
contains a set of calibrated standards, with four populations of
microbeads displaying increasing and predetermined fluorescence
intensity (expressed in terms of the number of molecules of equivalent
soluble fluorochromes [MESF]) and one reference blank population.
Using this method, the relative channel number obtained by flow
cytometry analysis of a cell population is directly transformed into
the number of MESF. The linear regression equation, correlating the channel number with the specific MESF value, was calculated using specific software (Quickcal V2.0; Flow Cytometry Standard Corporation).
SCF binding.
To block process receptor internalization, 1 × 105 cells
were collected by culture and treated with PBS at 4°C with 0.01%
NaN3. Cells were then incubated for 60 minutes at 4°C
with 10 µL of biotinylated SCF (rh Stem Cell Factor Biotin Conjugate;
R&D Systems, Minneapolis, MN) at a concentration of 0.6 µg/mL or with
a biotinylated negative control. Ten microliters of avidin-fluorescein
isothiocyanate (FITC) were added and incubated for a further 30 minutes
at 4°C in the dark. The cells were then washed to remove unreacted
avidin fluorescein and resuspended in 0.2 mL of PBS for final flow
cytometric analysis. An anti-SCF neutralizing antibody (R&D Systems)
was used as a control to show binding specificity.
Staining of intracellular phosphotyrosine.
One hundred microliters of cells suspended at 1 × 106/mL
in PBS containing 1% FCS were mixed with an equal volume of PBS
containing 2% paraformaldehyde (PFA), 1 mmol/L EDTA, 2 mmol/L
NaVO4, and 0.1% saponin. After 10 minutes of incubation at
room temperature, the cells were washed twice in PBS and stained with
antiphosphotyrosine-PE MoAb (Py-PE kindly provided by F. Lund-Johansen,
DNAX Research Institute, Palo Alto, CA).21 Immunostained
cells were washed in PBS and resuspended in 0.5% PFA and kept at 4°C
until cytofluorimetric analysis.
Immunoprecipitation studies.
Cells were resuspended in serum-free RPMI medium, incubated for 24 hours at 37°C 5% CO2, then untreated and SCF treated
cells (10 minutes with 0.5 µg/106 cells) were rapidly
pelleted and resuspended in lysis buffer (10 mmol/L TrisHCl, pH 8.6;
1.5 mmol/L MgCl2; 0.14 mol/L NaCl; 1% NP40; 2 mmol/L
phenylmethylsulfonylfluoride; 2 µg/mL leupeptin; 2 µg/mL aprotinin;
1 mg/mL pepsin A). Lysates were incubated for a minimum of 30 minutes
on ice, frozen, thawed, and centrifuged at 13,000 rpm at 4°C for 20 minutes. Immunoprecipitation of c-kit was performed on the
clarified supernatant with a mouse monoclonal anti-human c-kit
neutralizing antibody (anti rh SCFR; Boehringer, Mannheim, Germany)
coupled to sepharose-proteinA (SIGMA Chemical Co, St Louis, MO).
After rotating for 16 hours at 4°C, immunoprecipitates were washed
twice with lysis buffer, once with lysis buffer without NP-40, and once
with Tris HCl 50 mmol/L, pH 6.5. Samples then underwent elution from
proteinA with sodium dodecyl sulfate (SDS) sample buffer. The resulting
protein was subjected to 7% SDS-polyacrylamide gel electrophoresis
(PAGE). Protein was transferred electrophoretically to
polyvinylidenedifluoride (PDVF). The filter was incubated with a 3%
albumin bovine (SIGMA) blocking solution in TBS-Tween (20 mmol/L Tris
HCl, pH 7.6; 137 mmol/L NaCl; 0.1% Tween 20) overnight at 4°C.
Antiserum anti-phosphotyrosine PY20 (Transduction Laboratories, Lexington, KY) was added to the same solution and
incubation was carried out for 2 hours at room temperature. The filters
were then washed three times (10 minutes each) with TBS-Tween and
reacted for 1 hour at room temperature with rabbit anti-mouse
horseradish peroxidase-conjugated (Transduction Laboratories). The
filter was washed as above and visualized using ECL western blotting analysis system (Amersham, Buckinghamshire, UK).22
The PDVF filter was stripped of antibody by 200 mmol/L glycine, pH 2.2;
SDS 0.1%; and Tween-20 1%, for 2 hours, then reprobed with MoAb anti
c-kit (Boehringer).
Reverse transcriptase-polymerase chain reaction (RT-PCR).
The RT-PCR was performed according to the previously reported
method.16 The total RNA was extracted by means of the
guanidine salts and phenol-chloroform method using Ultraspec RNA
(Biotecx Laboratories Inc, Houston, TX). The cDNA products
of all samples and a lymphoblastoid cell line, used as a negative
control, were obtained by using 2 µg of total RNA and a poliT primer
(Reverse Transcription System, PCR-related; Promega, Madison, WI). To
verify the quality of the RNA of each sample, RT-PCR amplification of  -actin was performed with appropriate primers (Clontech Lab, Palo
Alto, CA) and a single band of the expected size was obtained (data not
shown). The same cDNA is used for RT-PCR amplification for SCF and
c-kit. The PCR primers for SCF amplification were upstream
primer 5'ATTCAAGAGCCCAGAACCCA3' and downstream primer 5'CTGTTACCAGCCAATGTACG3'. For c-kit amplification the primers were upstream primer 5'GAGTTGGCCCTAGAGTTAGA3' and downstream primer 5'CCTGGAGTTGGATGCAAGTT3'. The specific primers for the PCR reaction were synthesized with an Oligonucleotide Synthesizer 381A (Applied Biosystems, Foster City, CA). The cycling condition for
amplification was as follows: denaturation at 96°C for 3 minutes,
then 35 cycles of 94°C for 1 minute, 64°C for 45 seconds, and
72°C for 1 minute; a thermal cycler (Perkin Elmer-Cetus, Norwalk, CT)
was used. The PCR products were separated on 2% agarose gel containing
1 µg/mL ethidium bromide.
Detection of soluble SCF by tumor cell lines.
Chemically defined media of cell lines were collected after 72 hours of
culture and the SCF protein concentration in the cell supernatants was
quantified by using an enzyme-linked immunosorbent assay (R&D Systems)
with a sensibility of 4 pg/mL. The medium was used as the control.
Exogenous SCF.
To evaluate the potential role of the SCF, experiments were performed
in serum-free conditions. Cells were cultured in RPMI 1640 supplemented
with monotioglycerol (SIGMA), 7.5 10 5; Albumine Bovine
(SIGMA), 2%; and 0.2 mg/mL of penicillin/streptomycin and Insulin
Transferrine Sodium Selenite media supplement (SIGMA) diluted to 1:100,
following the manufacturer's instructions.
Cells were incubated with 0.5 µg/106 cells of human
recombinant SCF (Stem Cell Technologies, Vancouver) and evaluated at 24 hours for apoptosis. Selection of the appropriate working concentration of the SCF was based on a dose-response curve in which the cells were
incubated with 0, 0.01, 0.05, 0.1, 0.5, and 1.0 µg/106
cells of exogenous SCF and evaluated at 24 hours for apoptosis (Fig
1).
View larger version (10K):
[in this window]
[in a new window]
| Fig 1.
Dose-response curve in apoptosis inhibition
obtained by using exogenous SCF (0, 0.01, 0.05, 0.1, 0.5, and 1.0 µg/106 cells). The dose of 0.5 µg/106 cells
has been considered appropriate.
|
|
Evaluation of apoptosis.
The cells, cultured in serum-free conditions, were fixed by adding
formaldehyde (1% in PBS) for 15 minutes on ice. After resuspension in
PBS, cells were stored at 4°C in ethanol (70% in PBS). To perform apoptosis analysis, cells were rehydrated in PBS and cytocentrifuged. The slides were fixed by immersion for 5 minutes in a solution of
ethanol:acetic acid (2:1) and then washed twice in PBS and incubated
with a cacodylate buffer (0.2 mol/L potassium cacodylate; 2.5 mmol/L
Tris HCl; 2.5 mmol/L/cobalt chloride; and 0.25 mg/mL bovine serum
albumin, pH 6.6) containing 5 U of TdT (Boehringer) and 0.5 µmol/L of
Bio-dUTP (Boehringer) for 1 hour at 37°C. Slides were rinsed in PBS
and incubated with 5 µg/mL of fluoresceinated streptavidin
(Boehringer) at room temperature for 30 minutes in the dark. Slides
were rinsed in PBS, 0.4 µg/mL of propidium iodide was added for 1 minute, and slides were mounted with glycerol for microscopic
analysis.23 More than 300 cells were double tested.
Effect of anti-c-kit neutralizing antibody on sarcoma
cell growth.
The MoAb anti-human c-kit neutralizing antibody (anti-rhSCFR;
Boehringer) at a final concentration of 0.4 µg/104 cells
was added to the cells growing in the complete medium. The antibody was
added every 72 hours and the cells were assayed at 24 to 72 hours and 7 days for S phase and apoptosis. The experiments were repeated using an
isotypic MoAb (mouse anti-human V-8, kindly provided by F. Malavasi,
Department of Genetics Biology and Biochemistry, University of Turin)
as a negative control. Selection of the appropriate working
concentration was based on dilution experiments on the M-07e cell line
(data not shown).
Propidium iodide staining.
Cultured in serum-free conditions, 5 × 105 cells were
centrifuged and the pellets treated with automated DNA staining kit
(DNA-prep; Coulter). Tubes were placed at 4°C in the dark overnight.
The PI fluorescence of individual nuclei was measured by flow cytometry and the results obtained analyzed by Multicycle specific software (Phoenix Flow Systems, San Diego, CA).
Treatment of cells with antisense oligonucleotide.
Two cell lines, the ES (6647) and the PNET (TC32) were selected for
antisense experiments. The experiments were performed by adopting the
specific SCF receptor antisense oligonucleotide kit (Biognostik
Antisense kit; Biognostik GmbH, Göttingen, Germany) according to the manufacturer's instructions. The cells were washed four times and resuspended at 2.5 × 104 cells/mL in cell
culture media. Aliquots of 100 µL/well were placed in 96-well plates
and allowed to adhere for at least 1 hour. Specific c-kit oligo
antisense and a control were added directly in the respective wells, in
order to make a 2 µmol/L solution. The cells were maintained at
37°C in 5% CO2 and checked daily to examine the
different morphology between antisense treated and control cells. The
oligos were added daily (2 µL/well). After 7 days, 3 wells were
counted in a Neubauer's chamber, the others received 4 µCi/mL of
3H-thymidine (Amersham), incubation was continued for 6 hours, and cells were then harvested on glass fiber filter paper.
Filter strips were dried and the incorporated radioactivity was
measured in a scintillation counter (Canberra Packard International
S.A., Zurich, Switzerland). All assays were performed in triplicate.
| |
RESULTS |
Direct immunofluorescence analyses.
In all of the six cell lines the surface expression of c-kit
was tested in base line culture conditions. All cell lines were positive for c-kit expression, though with a different
expression (Fig 2) minimum of 63935 MESF in
the TC106 (ES) cell line and a maximum of 330815 MESF in the 6647 (ES)
cell line (Table 1). The positive control
M07e cell line showed 365960 MESF.
View larger version (28K):
[in this window]
[in a new window]
| Fig 2.
c-kit Expression on human sarcoma cell lines
analyzed by flow cytometry. Control MoAb ( ) and anti CD117-PE ().
(A) M07e, (B) 6647 (ES), (C) TC32 (PNET), (D) TC106 (ES), (E) PDN13
(PNET), (F) PDN12 (PNET), (G) PDE02 (ES).
|
|
SCF binding.
The c-kit binding ability was analyzed by using biotinylated
rh-SCF. The cytofluorimetric detection of the SCF-FITC bound to cells
was positive in 6 out of 6 (100%) samples tested with specific
inhibition. A representative case is shown (6647 ES) in Fig
3.
View larger version (13K):
[in this window]
[in a new window]
| Fig 3.
Cytofluorimetric profile of SCF specific binding and SCF
binding inhibition after coincubation with 20 µg of goat anti-human SCF neutralizing antibody in a representative case (6647, ES) of
sarcoma cells. The heavy solid line represents the background of the
negative staining control, the light solid line represents the SCF-FITC
staining, and the dotted line represents the SCF-FITC staining after
coincubation with anti-human SCF antibody.
|
|
Protein tyrosine phosphorylation induced by rhSCF.
Using flow cytometry, we tested the ability of the SCF to induce
protein tyrosine phosphorylation in the six cell lines. We observed a 10-fold increase, compared with untreated cells, of intracellular phosphotyrosine 10 minutes after stimulation with rhSCF
(a representative case PDN12 is shown in Fig
4). The specific c-kit
phosphorylation after SCF treatment was shown by using Western blotting
analysis on c-kit immunoprecipitates (Fig
5).
View larger version (15K):
[in this window]
[in a new window]
| Fig 4.
Cytofluorimetric detection of intracellular
phosphotyrosine in PDN12 (PNET) cell line. The dotted line ()
represents phosphotyrosine in cells in serum-free condition for 24 hours. The solid line () shows the phosphotyrosine 10 minutes after
stimulation with rhSCF (0.5 µg/106 cells).
|
|
View larger version (32K):
[in this window]
[in a new window]
| Fig 5.
(A) SCF-induced tyrosine phosphorylation of
c-kit. TC32 (PNET) and M-07e (control) cells were incubated for
10 minutes with 0.5 µg/106 cells rhSCF, lysed, and
immunoprecipitated with c-kit antiserum. Proteins were resolved
by 7% SDS-PAGE, transferred to PDVF, and immunoblotted with
antiphosphotyrosine antibody. Molecular mass of protein standards are
indicated in kD. (TC32  SCF), TC32 untreated cells;
(TC32 + SCF), TC32 SCF treated cells; (M-07e SCF), M-07e untreated cells; (M-07e + SCF), M-07e treated cells. (B)
c-kit Immunoblot. The immunoblot from (A) was stripped and
reprobed with an anti-c-kit MoAb.
|
|
SCF and c-kit RNA expression.
All of the cellular lines studied, apart from TC106 (ES), expressed the
mRNA of SCF (Fig 6). In addition, 13 sarcoma biopsies were examined for c-kit and SCF mRNA
expression; 12 out of the 13 (92%) samples examined seemed to
coexpress RNA for SCF and c-kit; whereas one sample only
showed SCF mRNA (Fig 7A and B).
View larger version (20K):
[in this window]
[in a new window]
| Fig 6.
SCF mRNA RT-PCR analysis. The specific 409- and 494-bp
PCR fragments are visible in 5 out of 6 (83%) of sarcoma cell lines. Lane 1, 6647 (ES); lane 2, TC32 (PNET); lane 3, TC106 (ES); lane 4, PDN13 (PNET); lane 5, PDN12 (PNET); lane 6, PDE02 (ES); lane 7, B
lymphoblastoid EBV-transformed cell line SCF mRNA neg; lane 8, No
DNA.
|
|
View larger version (23K):
[in this window]
[in a new window]
| Fig 7.
SCF and c-kit mRNA RT-PCR analysis in 13 sarcoma's biopsies (lanes 1 through 13), and B lymphoblastoid
EBV-transformed cell line SCF and c-kit mRNA neg (lane 14). (A)
The specific c-kit 749-bp PCR fragment is visible in 12 out of
13 (92%) samples. (B) The SCF specific 409- and 494-bp PCR fragments
are visible in 13 out of 13 (100%) samples.
|
|
Detection of SCF production by tumor cell lines.
Detectable levels, higher than medium alone, were found in five of six
supernatants. The TC106 (ES) cell line showed no SCF production
compared with medium alone. Four cell lines showed a low production
level (less than 12 pg), whereas TC32 (PNET) production was 36 pg
(Table 2).
Effect of the SCF on apoptosis.
After 24 hours, five out of the six cell lines (without SCF) showed
apoptosis ranging from 15.5% in PDE02 (ES) to 83% in TC106 (ES). This
phenomenon was not present in TC32 (PNET). SCF addition, in the
responders' cell lines, showed a decrease in the percentage of
apoptotic cells in relation to nontreated cells, with a more evident
decrease in 6647 (ES) (90%) and in PDE02 (ES) (54%) (Fig 8).
View larger version (59K):
[in this window]
[in a new window]
| Fig 8.
SCF activity on apoptosis inhibition in sarcoma cell
lines. The evaluation was performed in serum-free conditions 24 hours after administration of exogenous SCF (0.5 µg/106 cells).
Each experiment was performed at least twice (mean of two reproducible
experiments). Five of six (83%) of the cell lines showed an evident
reduction in percentage of the apoptotic cells. ( ), SCF; ( ),
SCF+.
|
|
S Phase and apoptosis after exposure to anti-c-kit
neutralizing MoAb.
To test whether c-kit expression contributes to Sarcoma cell
proliferation or apoptosis, the cell lines were treated in culture with
neutralizing c-kit MoAb. After culture with anti-c-kit
neutralizing antibody, cell cycle analysis in three cell lines (6647 [ES], TC32 [PNET], and TC106 [ES]) showed an increase of the S
phase after 24 hours and a decrease at 72 hours, with a maximum effect after 7 days (Fig 9). In the last 2 PNET
cell lines (PDN12 and PDN13) the addition of neutralizing
anti-c-kit antibody had a decreasing effect of S phase at 24 hours, reaching 0 value in the PDN13 after 7 days of culture.
View larger version (46K):
[in this window]
[in a new window]
| Fig 9.
S phase and apoptosis in sarcoma cell lines treated with
anti c-kit neutralizing antibody 0.4 µg/104 cells
for 24 hours, 72 hours, and 7 days. The cells were grown in complete
medium. Control cells were treated with V-8 antibody, and the value
at 7 days was reported (the results at 24 hours and 72 hours were
comparable). Each experiment was performed in duplicate (mean of two
reproducible experiments).
|
|
All cell lines showed increased apoptotic phenomenon. In fact, on day
7, five out of six (83%) had more than 30% apoptotic cells (range,
31.5% to 100%). By contrast, the control cells treated with V-8
antibody at the same dilution did not modify the apoptosis of S phase.
The PDE02 (ES) cell line showed only 16% of apoptosis after 7 days
(Fig 10), but a longer incubation time
(14 days) increased apoptotic percentage (50%) (data not shown).
View larger version (20K):
[in this window]
[in a new window]
| Fig 10.
Specific action of c-kit neutralizing antibody
in two lines. PDE02 (ES) (A,C,E,G) and 6647 (ES) (B,D,F,H) cultured in
complete medium. Cytofluorimetric profile of the propidium iodide
staining of DNA content in basal condition (A,B) with 0.4 µg/104 cells of V-8 for 7 days (C,D), with 0.4 µg/104 cells of anti-c-kit neutralizing antibody
for 72 hours (E,F) and for 7 days (G,H). The reduction of S phase and
the increment of the apoptotic phenomenon appear at 72 hours (E,F) and
is more evident after 7 days (G,H) (13% in PDE02 and 46% in 6647).
These results were confirmed by TdT assay.
|
|
Effect of c-kit antisense oligonucleotides on growth of
cell lines.
To study the specific role of the SCF receptor, we examined the effect
of c-kit sense and antisense oligonucleotides on the growth of
two sarcoma cell lines. The treatment of 6647 (PNET) and TC32 (ES) cell
lines with c-kit antisense oligonucleotides resulted in an
inhibition of cell growth. Treated cells showed a growth depression in
comparison with untreated cells or sense-oligos-treated cells. This
observation was directly shown by the significant (P < .001) reduction in the absolute number of cells. Even
the 3H-thymidine uptake data showed a significant
(P < .001) reduction of growth activity in the
oligo-treated cells (Fig 11A and B).
View larger version (13K):
[in this window]
[in a new window]
| Fig 11.
Cell growth inhibition by c-kit antisense
oligonucleotides. Untreated and treated 6647 cells (sense or antisense
oligos 2 µmol/L) incubated 7 days at 37°C 5% CO2. (A)
Absolute number of cells, mean of three different experiments. ( ),
mean; (), SD; ( ) SEM. (B) 6647 oligos-treated cells were
incubated in triplicate for 6 hours with 4 µCi/mL of
3H-thymidine. (), mean; (), SD; (), SEM. The
differences between treated and untreated cells showed a statistical
significance (P < .001).
|
|
| |
DISCUSSION |
This is the first study that underlines the presence of the
c-kit/SCF system in ES and PNET and indicates that SCF is
involved in cellular proliferation and, above all, is protecting cells from apoptosis. c-kit Was found in all of the cell lines
examined, with a consistent level of positivity that was comparable, in certain cases, with that of the M-07e line which was used as a positive
control. The binding experiments and the intracellular phosphotyrosine
and immunoprecipitation studies showed how this receptor is both
specifically and functionally activated by the exogenus SCF.
Furthermore, five out of the six cell lines expressed the mRNA of the
SCF. Correspondingly, the analysis of the mRNA of c-kit and SCF
performed on bioptic samples confirmed and reinforced these
observations, suggesting that the hypothesis of a c-kit/SCF autocrine loop.
Significant levels of SCF in the medium were only found in one cellular
line (TC32). This may indicate that there was either a failed
translation of the message or immediate consumption, by means of
interaction with the receptor. The experiments with c-kit
blocking antibody and antisense oligonucleotides could suggest that the
second hypothesis is more likely. On the other hand, the receptor's
activation in TC32 cell line after exposure to exogenous SCF could
indicate that endogenus SCF is not able to activate all receptors.
Moreover, the addition of exogenous SCF in the serum-free culture, the
c-kit receptor block, and the antisense oligonucleotide experiments (performed only on two cellular lines: 6647 [ES] and TC32
[PNET]), clearly indicated that the SCF is capable of both increasing
cellular proliferation and, more importantly, inhibiting the apoptosis
in the ES and PNET.
This fact is hardly surprising for a variety of reasons. SCF plays a
crucial role in the hematopoiesis, development, and organization of the
neural crest and the cells that derive from the crest (eg, melanocytes).4 In the hematopoiesis, in synergy with other growth factors, it stimulates the proliferation of the more immature staminal cells and the commissioned progenitors, protecting them from
apoptosis.7,8,24-26 In certain acute myeloid leukemias, the
SCF, either by itself or together with other growth factors, is capable
of stimulating the self-maintenance and proliferation of leukemia
blasts.12 In some human melanoma lines that present mRNA
for both SCF and c-kit, the SCF can increase the percentage of
S phase cells and the formation of colonies in agar.27
Similar results were obtained in neuroblastoma, infant tumors of
neuroectoderm derivation, producing the functional block of the
c-kit receptors with an MoAb. In this manner Cohen et
al15 were the first to assume the function of the autocrine
loop between the SCF and its receptor, but a more recent study further
indicated that the main role of the SCF in neuroblastomas could be that
of protecting the cells from apoptosis.16
Our study underlines the presence of this growth factor and its
receptors in ES and PNET, and also explains a functional
apoptosis-preventing role. Even if the data indicate that prevention of
apoptosis is not complete and decreases if the experiments lasted for 3 days (data not shown), it however suggests that other
factors are necessary for the complete cell survival. Whether
c-kit and SCF play a significant role in the growth of these
soft tissue sarcoma of neuroectodermic origin remains to be determined.
The hypothesis that the SCF and c-kit mRNA transcripts from
tumor samples were not derived from tumor cells themselves, but from
contaminating hematopoietic cells within the sample is not probable
fact. All the biopsies were obtained from massively infiltrated tissue.
Furthermore, in two cases in which suitable samples were available the
c-kit expression was shown by flow cytometry (data not shown).
The results obtained on the cellular lines would indicate that
SCF/c-kit plays a functional role. Therefore, it can be
strongly suggested that this role is also present in tumors in vivo.
This data also suggests that among the growth factors used in
therapeutic protocol, SCF must be used cautiously with these patients.
| |
FOOTNOTES |
Submitted May 15, 1997;
accepted November 10, 1997.
Supported by grants from Associazione Italiana per la Ricerca sul
Cancro (A.I.R.C., Milan) and Consiglio Nazionale delle Ricerche (CNR,
Rome) grant no. 97.04176.CT04 to E.M. and G.B., MURST ex 60%
University of Turin.
Address reprint requests to Enrico Madon, MD, Dept of
Pediatrics, University of Turin, Piazza Polonia, 94, 10126 Torino,
Italy
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.
| |
ACKNOWLEDGMENT |
We thank Fabio Malavasi, MD, for providing the V-8 antibody; F. Lund-Johansen, MD, for providing the Py-PE antibody; and A. Pagani, MD,
for providing cell lines. We are indebted to Mary Lo Bianco for
reviewing the English language of the manuscript.
| |
REFERENCES |
1.
Yarden Y,
Kuang WS,
Yang-Feng T,
Coussens L,
Munemitsu S,
Dull TJ,
Chen E,
Schlessingen J,
Francke U,
Ullrich A:
Human proto-oncogene c-kit, a new cell-surface-receptor tyrosine kinase for an unidentified ligand.
EMBO J
6:3341,
1987[Medline]
[Order article via Infotrieve]
2.
Williams DE,
Eisenman J,
Baird A,
Rauch C,
Van NK,
March CJ,
Park LS,
Martin U,
Mochizuki DE,
Bowel HS:
Identification of a ligand for the c-kit proto-oncogene.
Cell
63:167,
1990[Medline]
[Order article via Infotrieve]
3.
Hung E,
Notch K,
Beer DR,
Chi TIE,
Buck J,
Lam HAW,
Welder D,
Elder P,
Besmear P:
The hematopoietic growth factor KL is encoded by the SI locus and is the ligand of the c-kit receptor, the gene product of the W locus.
Cell
63:225,
1990[Medline]
[Order article via Infotrieve]
4.
Nocka K,
Majumder S,
Chabot B,
Ray P,
Cervone M,
Bernstein A,
Besmear P:
Expression of c-kit gene products is known cellular targets of W mutations in normal and W mutant mice. Evidence for an impaired c-kit kinase in mutant mice.
Genes Dev
3:816,
1989[Abstract/Free Full Text]
5.
Mintz B,
Russel ES:
Gene induced embryological modifications of primordial germ cells in the mouse.
J Exp Zool
134:207,
1957[Medline]
[Order article via Infotrieve]
6.
Mayer TC,
Green TC:
An experimental analysis of the pigment defect caused by mutations at the W and SI loci in mice.
Dev Biol
18:62,
1968[Medline]
[Order article via Infotrieve]
7.
Bernstein ID,
Andrews RG,
Zsebo KM:
Recombinant human stem cell factor enhances the formation of colonies by CD34+ line cells, and the generation of colony-forming cell progeny from CD34+ line cells cultured with interleukin-3, granulocyte colony-stimulating factor, or granulocyte-macrophage colony stimulating factor.
Blood
77:2316,
1991[Abstract/Free Full Text]
8.
Broxmeyer HE,
Cooper S,
Lu L,
Hangoc G,
Anderson D,
Cosman D,
Lyman SD,
Williams DE:
Effect of murine mast cell growth factor (c-kit proto-oncogene ligand) on colony formation by human marrow hematopoietic progenitor cells.
Blood
77:2142,
1991[Abstract/Free Full Text]
9.
McNiece IK,
Langley KE,
Zsebo KM:
Recombinant human stem cell factor synergizes with GM-CSF, IL-3 and EPO to stimulate human progenitor cells of myeloid and erythroid lineages.
Exp Hematol
19:226,
1991[Medline]
[Order article via Infotrieve]
10.
Turner AM,
Zsebo KM,
Martin F,
Jacobsen FW,
Bennett LG,
Broudy VC:
Nonhematopoietic tumor cell lines express stem cell factor and display c-kit receptor.
Blood
80:374,
1992[Abstract/Free Full Text]
11.
Natali PG,
Nicotra MR,
Sures I,
Santoro E,
Bigotti A,
Ullrich A:
Expression of c-kit receptor in normal and transformed human nonlymphoid tissues.
Cancer Res
52:6139,
1992[Abstract/Free Full Text]
12.
Pietsch T,
Kyas U,
Steffens U,
Yakisan E,
Hadam MR,
Ludwig WD,
Zsebo K,
Welte K:
Effects of human stem cell factor (c-kit ligand) on proliferation of myeloid leukemia cells: Heterogeneity in response and synergy with other hematopoietic growth factors.
Blood
80:1199,
1992[Abstract/Free Full Text]
13.
Krystal GW,
Hines SJ,
Organ CP:
Autocrine growth of small cell lung cancer mediated by co-expression of c-kit and stem cell factor.
Cancer Res
56:370,
1996[Abstract/Free Full Text]
14.
Hines SJ,
Organ C,
Kornstein MJ,
Krystal GW:
Co-expression of the c-kit and stem cell factor genes in breast carcinomas.
Cell Growth Differ
6:769,
1995[Abstract]
15.
Cohen PS,
Chan JP,
Lipkunskaya M,
Biedler JL,
Seeger RC:
Expression of stem cell factor and c-kit in human neuroblastoma.
Blood
84:3465,
1994[Abstract/Free Full Text]
16.
Timues F,
Crescenzio N,
Valle P,
Pistamiglio P,
Piglione M,
Garelli E,
Ricotti E,
Rocchi P,
Strippoli PL,
Cordero di Montezemolo L,
Madon E,
Ramenghi U,
Basso G:
Stem cell factor suppresses apoptosis in neuroblastoma cell lines.
Exp Hematology
25:1253,
1997[Medline]
[Order article via Infotrieve]
17.
Cavazzana AO,
Miser JS,
Jefferson J,
Triche TJ:
Experimental evidence for s neuronal origin of Ewing's Sarcoma of Bone.
Am J Pathol
127:507,
1987[Abstract]
18.
Pagani A,
Fischer-Colbrie R,
Eder U,
Pellin A,
Llombart-Bosch A,
Bussolati G:
Neural and mesenchymal differentiations in Ewing's Sarcoma cell lines. Morphological, immunophenotypic, molecular biological and cytogenetic evidence.
Int J Cancer
63:738,
1995[Medline]
[Order article via Infotrieve]
19.
Rosolen A,
Todesco A,
Colamonici OR,
Basso G,
Fraschella E:
Expression of type I Interferon receptor in solid tumors of childhood.
Mod Pathol
10:55,
1997[Medline]
[Order article via Infotrieve]
20.
Avanzi GC,
Brizzi MF,
Giannotti J,
Ciarletta A,
Yang Y-C,
Pegoraro L,
Clark SC:
M-07e human leukemic factor-dependent cell line provides a rapid and sensitive bioassay for the human cytokines GM-CSF and IL3.
J Cell Physiol
145:458,
1990[Medline]
[Order article via Infotrieve]
21.
Lund-Johansen F,
Frey T,
Ledbetter JA,
Thompson PA:
Apoptosis in hemopoietic cells is associated with an extensive decrease in cellular phosphotyrosine content that can be inhibited by the tyrosine phosphatase antagonist pervanadate.
Cytometry
25:182,
1996[Medline]
[Order article via Infotrieve]
22.
Brizzi MF,
Zini MG,
Aronica MG,
Blechman J,
Yarden Y,
Pegoraro L:
Convergence of signaling by interleukin 3 granulocyte-macrophage colony stimulating factor and mast cell growth factor on JAK2 tyrosine kinase.
J Biol Chem
269:31680,
1996[Abstract/Free Full Text]
23.
Gorczyca W,
Gong J,
Darzynkiewicz Z:
Detection of DNA strand breaks in individual apoptotic cells by the in situ terminal deoxynucleotidyl transferase and nick translation assay.
Cancer Res
53:3186,
1993[Abstract/Free Full Text]
24.
Brandt J,
Briddel RA,
Sroure F,
Leemhuis TB,
Hoffman R:
Role of c-kit ligand in the expression of human hematopoietic progenitor cells.
Blood
79:634,
1992[Abstract/Free Full Text]
25.
McNiece IK,
Langley KE,
Zsebo KM:
Recombinant human cell factor synergizes with GM-CSF, G-CSF, IL-3 and EPO to stimulate human progenitor cells of myeloid and erythroid lineages.
Exp Hematol
19:226,
1991
26.
Caceres-Cortes J,
Rajotte D,
Dumouchesl J,
Haddad P,
Hoang T:
Product of the steel locus suppresses apoptosis in hemopoietic cells.
J Biol Chem
269:12084,
1994[Abstract/Free Full Text]
27.
Papadimitriou CA,
Topp MS,
Serve H,
Oelmann E,
Koemigsmann M,
Maurer J,
Oberberg D,
Reufi B,
Thiel E,
Berdel WE:
Recombinant human stem cell factor does exert minor stimulation of growth in small cell lung cancer and melanoma cell lines.
Eur J Cancer
31:2371,
1995
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
R. M. Popovici, N. K. Betzler, M. S. Krause, M. Luo, J. Jauckus, A. Germeyer, S. Bloethner, A. Schlotterer, R. Kumar, T. Strowitzki, et al.
Gene Expression Profiling of Human Endometrial-Trophoblast Interaction in a Coculture Model
Endocrinology,
December 1, 2006;
147(12):
5662 - 5675.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Tarn, Y. V. Skorobogatko, T. Taguchi, B. Eisenberg, M. von Mehren, and A. K. Godwin
Therapeutic Effect of Imatinib in Gastrointestinal Stromal Tumors: AKT Signaling Dependent and Independent Mechanisms.
Cancer Res.,
May 15, 2006;
66(10):
5477 - 5486.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Uccini, O. Mannarino, H. P. McDowell, U. Pauser, R. Vitali, P. G. Natali, P. Altavista, T. Andreano, S. Coco, R. Boldrini, et al.
Clinical and Molecular Evidence for c-kit Receptor as a Therapeutic Target in Neuroblastic Tumors
Clin. Cancer Res.,
January 1, 2005;
11(1):
380 - 389.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. Tamborini, L. Bonadiman, T. Negri, A. Greco, S. Staurengo, P. Bidoli, U. Pastorino, M. A. Pierotti, and S. Pilotti
Detection of Overexpressed and Phosphorylated Wild-Type Kit Receptor in Surgical Specimens of Small Cell Lung Cancer
Clin. Cancer Res.,
December 15, 2004;
10(24):
8214 - 8219.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. J. K. Williamson, B. C. Dibling, J. R. Boyne, P. Selby, and S. A. Burchill
Basic Fibroblast Growth Factor-induced Cell Death Is Effected through Sustained Activation of p38MAPK and Up-regulation of the Death Receptor p75NTR
J. Biol. Chem.,
November 12, 2004;
279(46):
47912 - 47928.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Catalano, S. Rodilossi, M. R. Rippo, P. Caprari, and A. Procopio
Induction of Stem Cell Factor/c-Kit/Slug Signal Transduction in Multidrug-resistant Malignant Mesothelioma Cells
J. Biol. Chem.,
November 5, 2004;
279(45):
46706 - 46714.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. Tamborini, L. Bonadiman, A. Greco, A. Gronchi, C. Riva, R. Bertulli, P. G. Casali, M. A. Pierotti, and S. Pilotti
Expression of Ligand-Activated KIT and Platelet-Derived Growth Factor Receptor {beta} Tyrosine Kinase Receptors in Synovial Sarcoma
Clin. Cancer Res.,
February 1, 2004;
10(3):
938 - 943.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. S. Merchant and C. J. Thiele
RESPONSE: Re: Potential Use of Imatinib in Ewing's Sarcoma: Evidence for In Vitro and In Vivo Activity
J Natl Cancer Inst,
July 16, 2003;
95(14):
1088 - 1089.
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. Tamborini, L. Bonadiman, V. Albertini, M. A. Pierotti, and S. Pilotti
Re: Potential Use of Imatinib in Ewing's Sarcoma: Evidence for In Vitro and In Vivo Activity
J Natl Cancer Inst,
July 16, 2003;
95(14):
1087 - 1088.
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Madani, K. Kemmer, C. Sweeney, C. Corless, T. Ulbright, M. Heinrich, and L. Einhorn
Expression of KIT and epidermal growth factor receptor in chemotherapy refractory non-seminomatous germ-cell tumors
Ann. Onc.,
June 1, 2003;
14(6):
873 - 880.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Scotlandi, M. C. Manara, R. Strammiello, L. Landuzzi, S. Benini, S. Perdichizzi, M. Serra, A. Astolfi, G. Nicoletti, P.-L. Lollini, et al.
c-kit Receptor Expression in Ewing's Sarcoma: Lack of Prognostic Value but Therapeutic Targeting Opportunities in Appropriate Conditions
J. Clin. Oncol.,
May 15, 2003;
21(10):
1952 - 1960.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. J. Druker
Taking Aim at Ewing's Sarcoma: Is KIT a Target and Will Imatinib Work?
J Natl Cancer Inst,
November 20, 2002;
94(22):
1660 - 1661.
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. S. Merchant, C.-W. Woo, C. L. Mackall, and C. J. Thiele
Potential Use of Imatinib in Ewing's Sarcoma: Evidence for In Vitro and In Vivo Activity
J Natl Cancer Inst,
November 20, 2002;
94(22):
1673 - 1679.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. C. Heinrich, C. D. Blanke, B. J. Druker, and C. L. Corless
Inhibition of KIT Tyrosine Kinase Activity: A Novel Molecular Approach to the Treatment of KIT-Positive Malignancies
J. Clin. Oncol.,
March 15, 2002;
20(6):
1692 - 1703.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. M. Luger, S. G. O'Brien, J. Ratajczak, M. Z. Ratajczak, R. Mick, E. A. Stadtmauer, P. C. Nowell, J. M. Goldman, and A. M. Gewirtz
Oligodeoxynucleotide-mediated inhibition of c-myb gene expression in autografted bone marrow: a pilot study
Blood,
February 15, 2002;
99(4):
1150 - 1158.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G. W. Krystal, S. Honsawek, D. Kiewlich, C. Liang, S. Vasile, L. Sun, G. McMahon, and K. E. Lipson
Indolinone Tyrosine Kinase Inhibitors Block Kit Activation and Growth of Small Cell Lung Cancer Cells
Cancer Res.,
May 1, 2001;
61(9):
3660 - 3668.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
G. Bellone, A. Carbone, N. Sibona, O. Bosco, D. Tibaudi, C. Smirne, T. Martone, C. Gramigni, M. Camandona, G. Emanuelli, et al.
Aberrant Activation of c-kit Protects Colon Carcinoma Cells against Apoptosis and Enhances Their Invasive Potential
Cancer Res.,
March 1, 2001;
61(5):
2200 - 2206.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
L. Landuzzi, C. De Giovanni, G. Nicoletti, I. Rossi, C. Ricci, A. Astolfi, L. Scopece, K. Scotlandi, M. Serra, G. P. Bagnara, et al.
The Metastatic Ability of Ewing's Sarcoma Cells Is Modulated by Stem Cell Factor and by Its Receptor c-kit
Am. J. Pathol.,
December 1, 2000;
157(6):
2123 - 2131.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Pecere, M. V. Gazzola, C. Mucignat, C. Parolin, F. D. Vecchia, A. Cavaggioni, G. Basso, A. Diaspro, B. Salvato, M. Carli, et al.
Aloe-emodin Is a New Type of Anticancer Agent with Selective Activity against Neuroectodermal Tumors
Cancer Res.,
June 1, 2000;
60(11):
2800 - 2804.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Abstract
Introduction
Abstract