|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 91 No. 7 (April 1), 1998:
pp. 2433-2442
Somatic Hypermutation, Clonal Diversity, and Preferential Expression
of the VH 51p1/VL kv325 Immunoglobulin Gene
Combination in Hepatitis C Virus-Associated Immunocytomas
By
Martin Ivanovski,
Federico Silvestri,
Gabriele Pozzato,
Shubha Anand,
Cesare Mazzaro,
Oscar R. Burrone, and
Dimitar G. Efremov
From the Molecular Immunology Group, International Centre for Genetic
Engineering & Biotechnology; the Institute of Internal Medicine,
Ospedale di Cattinara, Trieste; and the 2nd Division of General
Medicine, Ospedale di Pordenone, Pordenone, Italy.
 |
ABSTRACT |
A high prevalence of chronic hepatitis C virus (HCV) infection has
recently been shown in a subset of B-cell non-Hodgkin's lymphomas,
most of which belong to the lymphoplasmacytoid lymphoma/immunocytoma subtype and are characterized by the production of a monoclonal IgM
cryoglobulin with rheumatoid factor activity. To better define the
stage of differentiation of the malignant B cell and to investigate the
role of chronic antigen stimulation in the pathogenesis of the
HCV-associated immunocytomas, we analyzed the variable (V) region gene
repertoire in 16 cases with this type of tumor. The lymphoma-derived V
gene sequences were successfully determined in 8 cases; 5 of them
expressed the 51p1 VH gene in combination with the kv325
VL gene. Moreover, a monoclonal 51p1-expressing B-cell
population was detected in 4 of the remaining immunocytomas by an
allele-specific Ig gene fingerprinting assay, indicating that
HCV-associated immunocytomas represent clonal proliferations of a
highly selected B-cell population. Somatic mutations and intraclonal
diversity were observed in all of the lymphoma V genes, and clonally
related IgM and IgG VH transcripts indicative of isotype
switching were present in one case. These findings are consistent with
an antigen-driven process and support a role for chronic antigen
stimulation in the growth and clonal evolution of HCV-associated
immunocytomas.
| |
INTRODUCTION |
THE HEPATITIS C VIRUS (HCV) has recently
been recognized as the major etiologic factor of Type II mixed
cryoglobulinemia (MC).1,2 This chronic
immune-complex-mediated disease is characterized by an underlying
proliferation of monoclonal B cells which typically secrete a
cryoprecipitable IgMk rheumatoid factor (RF).3,4 Type II MC
frequently evolves into overt B-cell non-Hodgkin's lymphoma (NHL),
suggesting that chronic HCV infection can lead to both a benign and a
malignant lymphoproliferative disorder.5,6
Recent studies have also shown a high prevalence of anti-HCV antibodies
and HCV viremia in unselected patients with NHL, which in some series
from Italy exceeded 30% of the cases.7,8 More detailed
analysis of the prevalence of HCV in different histological subtypes of
NHL have shown that almost half of the cases belong to the
lymphoplasmacytoid lymphoma/immunocytoma subtype.9-12 This type of tumor consists of a diffuse proliferation of small lymphoid cells which show maturation to plasma cells and characteristically express surface IgM and B-cell-associated antigens but lack CD5. The
sites of tumor involvement include bone marrow (BM), lymph nodes (LN),
spleen, and frequently peripheral blood (PB), and a monoclonal serum
paraprotein of the IgM type is present in the majority of
patients.13 Other types of NHLs that have been reported to
be associated with a chronic HCV infection include diffuse large
cell-lymphoma and mucosa-associated lymphoid tissue (MALT) lymphoma.14-19 However, regardless of the histological
subtype, it seems that more than 50% of the patients with
HCV-associated lymphomas have detectable levels of cryoglobulins in
their sera.9,11,12,17
Although considerable amount of data has accumulated that supports a
strong association between HCV and certain lymphoproliferative disorders, very little is known about the mechanism through which the
virus could induce the expansion of particular B-cell clones. The most
plausible mechanism is that certain B-cell clones proliferate as a
consequence of chronic antigen stimulation either by the virus alone or
by HCV-containing immune complexes.20 To investigate the
role of antigen stimulation in the development of malignant HCV-associated lymphoproliferations, we have analyzed the variable region gene repertoire of 16 immunocytomas, among which 13 secreted a
cryoprecipitable IgMk RF. The VH and VL gene
sequences were successfully determined in 8 and 7 cases, respectively,
and 5 cases were found to coexpress the 51p1 VH gene with
the kv325 VL gene. Somatic mutations were detected in all
of the lymphoma V gene sequences, supporting a role for antigen
stimulation in the growth and clonal evolution of these tumors.
| |
MATERIALS AND METHODS |
Patients' characteristics and histopathologic evaluation.
Sixteen patients with lymphoplasmacytoid lymphoma/immunocytoma and a
chronic HCV infection were included in the study population. Diagnosis
of lymphoma was based on clinical findings (lymphadenopathy, splenomegaly, and/or cytopenia), histopathologic evaluation of LN and/or BM biopsies, and immunophenotypic analysis for
surface B- and T-lymphocytic markers. Basic workup at diagnosis
included a detailed history, physical examination, hematologic
parameters, standard metabolic profile, urinalysis, and
thoraco-abdominal computed tomographic scans. BM biopsies
were performed in all patients with a Jamshidi's needle,
fixed in B5 solution for 2 hours, decalcified in Decal for
two hours, and embedded in paraffin. From each block representative
sections were cut and stained with Hematoxilin and Eosin
(H&E), Giemsa, periodic acid-Schiff, and Pearls and
Gomori. The percentage of
neoplastic infiltrate and the pattern of infiltration were assessed by
two different hemopathologists. Paraffin sections were used for
immunohistochemical staining with the avidin-biotin-peroxidase complex
method with the following monoclonal antibodies (MoAbs):
anti-CD45, anti-CD20, anti-IgM, anti-IgD, anti-IgG, anti-IgA, anti- ,
and anti- Ig light chain (all from DAKO, Glostrup, Denmark). LN
biopsies were performed as clinically indicated. Histological material
was fixed in formalin and routinely processed (embedded in paraffin and
stained with H&E). BM and PB lymphocytes were also
analyzed by flowcytometry with MoAbs against CD19, CD20, CD5, SmIg, and
and light chains (all from Becton Dickinson, Mountain View,
CA). Double-immunofluorescence labeling with anti-CD5 and anti-CD19 was
performed in all cases to exclude B-cell chronic lymphocytic leukemia.
The lymphomas were classified according to the Revised
European-American Classification of Lymphoid Neoplasms,13
based on the presence of lymphoid infiltrates consisting of small ovoid
lymphocytes, plasmacytoid lymphocytes, and plasma cells. The lymphoid
cells showed CD20 positivity and light chain restriction, whereas the
plasmacytoid and plasma cells were positive for cytoplasmatic Ig.
Serum anti-HCV antibodies and HCV RNA were detected in all patients by
enzyme-linked immunosorbent assay (HCV 2.0; Ortho Diagnostic Systems,
Raritan, NJ) and reverse transcription/polymerase chain reaction
(RT/PCR),9,11 respectively. The HCV genotypes
were determined as described elsewhere.9,11 A monoclonal
IgM component was detected in the serum of 15 patients. Serum
rheumatoid factor (normal value < 40 IU/mL) and circulating serum
cryoglobulins (considered as positive if  1%) were present in 13 cases. At the time of first sampling, immunophenotyping of peripheral
blood lymphocytes showed a / ratio indicative of a clonally
expanded B-cell population in 8 cases (SEG, SS, HAZ, MS, LC2, LC3, LC4, and LC5). Some relevant clinical and laboratory characteristics of the
patients are shown in Table 1.
PCR amplification, cloning, and sequencing of VH and
VL region genes.
Total cellular RNA was isolated from peripheral blood mononuclear cells
(PBMC), BM aspirates, and LN biopsies using the guanidinium thiocyanate-phenol-chloroform procedure.21 The PCR
amplification, cloning, and sequencing of the VH region
genes has been described in detail elsewhere.22 Briefly,
one µg of RNA was reverse transcribed using random hexamers and the
GeneAmp RNA/PCR kit (Perkin Elmer Cetus, Norwalk, CT), and then PCR
amplified with a degenerate VH FWR1 primer (hFW1: 5
AGGTGCAGCTGGA(T)GG(C)AGTC(G)T(G)GG 3) and a Cµ specific
oligonucleotide primer (hM3: 5 GGAAAAGGGTTGGGGCGGAT 3) located eight
nucleotides downstream from the beginning of the CH1 exon.
Some samples were also amplified with the FWR1 primer used in
combination with a C (hcG1: 5 GGAAGACCGATGGGCCCTTG 3) or a C
(hA2: 5 CGAAGACCTTGGGGCTGGTC 3) specific primer located in the same
region of the corresponding CH1 exon as the Cµ primer. The VL region genes were amplified using an equimolar
mixture of 6 Vk family-specific primers (Vk1F:
5 GTGTGCACTCCGACATCCAGATGACCCAGTCT 3, Vk2F: 5
GTGTGCACTCCGATGTTGTGATGACTCAGTCT 3, Vk3F: 5
GTGTGCACTCCGAAATTGTGTTGACGCAGTCT 3, Vk4F: 5
GTGTGCACTCCGACATCGTGATGACCCAGTCT 3, Vk5F: 5
GTGTGCACTCCGAAACGACACTCACGCAGTCT 3, Vk6F: 5
GTGTGCACTCCGAAATTGTGCTGACTCAGTCT 3) and a primer from the end of the
Ck gene (hCK: 5 CTAACACTCTCCCCTGTTGAA 3). The amplified
PCR fragments were purified by electroelution from 1.2% agarose gels,
ligated in the Sma I site of pUC18 (Pharmacia LKB, Uppsala, Sweden),
and used to transform Escherichia coli strain DH5. Clones
were picked randomly, and double-stranded DNA template was prepared and
sequenced using the T7 Sequencing Kit (Pharmacia LKB). Candidate
germline genes were assigned by searching the VBASE
directory.23 The assignment of DH gene segments was performed by comparison with published germline
sequences,24,25 according to the criteria used in Yamada et
al.25
Ig gene fingerprinting analysis.
The presence of an expanded B-cell clone in the PBMC and lymph node
samples was investigated by a previously described isotype-specific Ig
gene fingerprinting procedure,26 with small modifications. Briefly, a 20-µL aliquot of each VH PCR was labeled by
primer extension with an internal 32P-labeled
oligonucleotide complementary to a conserved sequence in human
VH framework 3 (FW3) regions (hFW3: 5
CTGAGGACACGGCCGTGTATTACTG 3, codons 84 to 92). The reaction mixtures
(20 µL of the PCR sample, 10 pmol/L of 32P-end-labeled
primer, 200 µmol/L dNTP, 0.5 µL of GeneAmp 10 × PCR Buffer, and
1.25 U of Taq polymerase, in a final volume of 25 µL) were subjected
to denaturation at 95°C for 8 minutes, annealing at 64°C for 1 minute, and extension at 72°C for 15 minutes. Two microliters of each
reaction were analyzed on denaturing 6M urea 6% polyacrylamide
sequencing gels, with sequencing reactions used as size markers. In
some experiments the labeling reactions were performed with two
radioactively labeled primers, ie, hFW3 and 51p1F (5
GATCATCCCTATCTTTGGTACAG 3). 51p1F is homologous to a sequence in the
complementarity-determining-region 2 (CDR2) of 51p1-related alleles of
the VH1-69 locus,27 and is located 113 nucleotides (nt) upstream from the hFW3 primer. With this approach the fingerprint of the 51p1-related transcripts can be related
with the fingerprint of all VH transcripts. If an expanded B-cell clone expressing a 51p1-related allele is present, a dominant band will be seen in the fingerprint of 51p1-related transcripts.
Analysis of mutations.
The probability (P) that excess or scarcity of replacement
(R) mutations in the CDRs or FWRs resulted by chance only was
calculated with the binomial distribution model28 using
Microsoft Excell software (Microsoft Corp, Redmond, WA). The gene
specific CDR Rf and FWR Rf values provided in Chang and
Casali29 were used instead of the more approximate value of
0.75. The P values were calculated by analyzing the mutations
from each set of clonally related transcripts in toto (counting each
mutation only once),28 and also by analyzing each clone
individually.
| |
RESULTS |
Clonal VH gene rearrangements in PB, BM, and LN specimens
of HCV-associated immunocytomas.
Ig gene fingerprinting analysis of IgM heavy chain transcripts was
performed on mRNA extracted from PBMC, BM, and LN specimens to detect
the monoclonal VH gene rearrangements of the malignant clones (Figs 1 and
2). Expanded
IgM-expressing B-cell clones were detected in the peripheral blood of
10 cases (MS, SS, SEG, HAZ, FAV, LC2, LC3, LC4, LC6, and LC7) and in
the BM aspirates and LN biopsy of patients MS, SEG, LC4, FAV, and SEL.
The rearranged lymphoma VH genes from the specimens with
only a few or absent residual normal B cells (SS-PB, SEG-BM and -PB,
LC2-PB, LC3-PB, HAZ-PB, LC4-BM and -PB, SEL-LN, and MS-BM and -PB) were
subsequently cloned and sequenced (see below). No attempt was made to
clone the lymphoma VH genes from the remaining cases
because the number of polyclonal IgM+ B cells seemed to be
too high to allow easy identification of the malignant clones.
View larger version (77K):
[in this window]
[in a new window]
| Fig 1.
Ig gene fingerprinting analysis of
IgM-expressing B cells from 13 patients with HCV-associated
immunocytoma. The µVH region transcripts were PCR
amplified using a degenerate FW1 primer and a primer from the
CH1 exon of the Cµ gene (scheme). To obtain better size
fractionation and easier visualization of these fragments, radioactively labeled complementary copies of the CDR3/FW4 regions were
synthesized by primer extension of a consensus 32P-labeled
FW3 oligonucleotide. Autoradiograms obtained after the size separation
of these fragments on sequencing polyacrylamide gel
electrophoresis gels are shown in the lower part of the
figure. Monoclonal B-cell populations contain a single band in the
fingerprint (samples LC3-PB, SS-PB, HAZ-PB, MS-PB1, and SEG-PB1),
representing the unique CDR3 length of their
VHDJH rearrangement. Polyclonal B-cell
populations show a ladder of bands, consistent with the different CDR3
lengths of their VHDJH rearrangements. Entirely polyclonal B-cell populations show a Gaussian distribution of the bands
in the fingerprint (samples LC8-PB, LC9-PB). A band of stronger
intensity, as seen in cases LC2-PB, LC6-PB, LC7-PB, MS-BM2, SEG-BM2,
LC4-BM2, and LC4-PB2, indicates a monoclonal B-cell expansion within a
polyclonal B-cell population. The source of the analyzed sample is
indicated after each case. Samples in cases MS, SEG, and LC4 were
collected at two different time points separated by more than one year
(indicated as 1 and 2).
|
|
View larger version (74K):
[in this window]
[in a new window]
| Fig 2.
Ig gene fingerprinting analysis of IgM (µ), IgG (),
and IgA () heavy chain transcripts present in a neoplastic lymph
node and a PB sample obtained from patient SEL. A dominant band
corresponding to the lymphoma VH gene rearrangement can be
seen in the fingerprint of the µ and transcripts from the lymph
node. A prominent band of the same size is present in the fingerprint
of µ transcripts expressed by PB lymphocytes. Sequencing reactions
were used as markers to determine the exact sizes of the bands.
|
|
View larger version (61K):
[in this window]
[in a new window]
| Fig 3.
Deduced amino acid sequences of immunocytoma
VH genes. The amino acid sequences of the most homologous
germline VH genes are shown above the lymphoma sequences.
Dashes indicate sequence identity. Amino acid replacement mutations are
shown as upper case letters. The location of silent mutations in the
nucleotide sequence is indicated with lower case letters. PB, BM, and
LN indicate the tissue from which the lymphoma VH sequence
was obtained. Sequences labeled with an asterisk were obtained from an
independent set of RT/PCR, cloning, and sequencing reactions. The IgG
VH sequences from SEL are labeled gSEL.
|
|
The IgG and IgA heavy chain transcripts in the samples with a
monoclonal IgM+ B-cell population were similarly analyzed
with the fingerprinting procedure to investigate the occurrence of
immunoglobulin isotype switching in HCV-associated immunocytoma. A
prominent band with an identical CDR3 length as the IgM-derived
VH gene sequence was detected in the IgG fingerprint of the
lymph node sample from patient SEL (Fig 2). Subsequent cloning and
sequencing of the PCR products showed clonal filiation of the IgM and
IgG VH gene sequences, demonstrating that a subset of the
lymphoma B cells had undergone Ig heavy-chain class switching (Fig
3). The inability to detect IgG- or
IgA-expressing immunocytoma B cells in the remaining cases could be
caused by limitations in the sensitivity of the technique, and does not
imply that isotype switching is an infrequent event in HCV-associated
immunocytoma.
View larger version (37K):
[in this window]
[in a new window]
| Fig 4.
Deduced amino acid sequences of immunocytoma
VL genes. The amino acid sequences of the most homologous
germline VL genes are shown above the lymphoma sequences.
Dashes indicate sequence identity. Amino acid replacement mutations are
shown as upper case letters. The location of silent mutations in the
nucleotide sequence is indicated with lower case letters.
|
|
VH gene sequences of HCV-associated immunocytomas.
Complete nucleotide sequences of the productive
VHDJH gene rearrangements were obtained for
eight cases; the deduced amino acid sequences are shown in Fig 3. At
least three randomly selected clones from each VH PCR were
sequenced, and in most of the cases all of the VH gene
sequences from a single patient were clonally related (Fig 3 and Table
2). In three cases (SEG, LC4, and MS) the
tumor-derived VH gene sequences were obtained from both a BM and a PB sample which were collected at two different time points
separated by more than 1 year. The length of the CDR3 region of the
predominant VH sequence was identical to the size of the major (or unique) band in the Ig gene fingerprint in all cases.
The germline counterparts of the lymphoma VH genes were
assigned by searching the VBASE directory.23 Five of the
VH genes shared more than 95% homology with the
VHI family gene 51p1 (Table 2). Two other cases expressed
VH genes most closely related to the VHIII
family members DP47 and DP51, whereas the last VH gene sequence was most homologous to the VHIV family gene
VH4.21.
All of the lymphoma VH genes showed numerous single
nucleotide differences from the candidate germline genes (Fig 3). These nucleotide substitutions were apparently somatic mutations because they
were obtained again after a second set of RT/PCR, cloning, and
sequencing reactions. Moreover, many of the mutations in the lymphoma
VH genes obtained from the first samplings in patients SEG,
LC4, and MS were found also in the lymphoma VH sequences obtained from the second samplings. Finally, most of the mutations found in the lymph node specimen of patient SEL were shared between the
clonally related IgM and IgG VH gene sequences. On the
other hand, certain mutations were found only in a single clone or were shared only among some of the clones of a given VDJ rearrangement. Mutations of this kind were detected in all of the lymphomas, indicating that intraclonal heterogeneity of VH gene
sequences is a frequent phenomenon in HCV-associated immunocytoma.
VL gene sequences of HCV-associated immunocytomas.
A predominant or unique VK sequence was obtained in seven
cases (Fig 4). Sequencing of seven clones
from the last case (patient MS) yielded seven different VK
sequences. The inability to detect the lymphoma VK sequence
in this case was presumably because of considerable differences with
the sequence of the 5 VK PCR primers; the VH
gene of this case was most extensively mutated, and the same is likely
to have happened with the lymphoma VK gene.
View larger version (72K):
[in this window]
[in a new window]
| Fig 5.
Allele-specific Ig gene fingerprinting of IgM-expressing
B cells. A schematic representation of the procedure is shown at the
top of the figure. The positions of the PCR primers (hFW1 and hM3) and
the primers used for labeling the PCR products (hFW3 and 51p1F) are
indicated. The autoradiograms show the analysis of peripheral blood
lymphocytes from five normal controls (NC1-5) and eight cases with
HCV-associated immunocytoma (a BM sample from MEL was also analyzed).
The locations of the bands corresponding to 51p1 transcripts and all
VH transcripts are indicated. Expanded 51p1-expressing
B-cell clones can clearly be seen in cases LC1, LC6, LC7, and MEL.
|
|
The VL sequences were analyzed essentially as described for
the VH sequences, with a minimum of three clones sequenced
from each VK PCR. Five of the sequences were most
homologous to the VKIII family gene kv325 (Table
3). One of the remaining two cases expressed the VKIII family gene Vg, whereas the last
sequence was most closely related to the VKIV family gene
DPK24. Interestingly, all of the lymphoma kv325 VL genes
were paired with a 51p1-derived VH gene. Somatic mutations
and intraclonal diversity were also observed in the VL
sequences, although to an apparently lesser extent than in the case of
the lymphoma VH sequences.
Distribution of mutations in lymphoma VH and
VL genes.
To address the possible role of antigen selection in the clonal
evolution of the HCV-associated immunocytomas, we investigated the
distribution of replacement and silent mutations in the CDRs of the
VH and VL genes. Although most of the sequences
showed a higher replacement-to-silent (R:S) ratio in the CDRs than in the FWRs, the probability for obtaining the observed
number of R mutations in the CDRs by chance alone was smaller than 0.05 only in the case of one VH gene (case MS) and two
VL genes (cases SEG and LC4). The absence of significant
clustering of replacement mutations in the CDRs argues against
selection for variants with higher antigen binding
affinity.28,29 On the other hand, lower numbers of R
mutations than expected by chance alone were evident in most of the
FWRs, indicating selective pressure for maintenance of functional Ig
molecules.
Preferential expression of the 51p1 VH gene in
HCV-associated immunocytomas.
The 51p1/Humkv325 gene combination was expressed in five of the eight
lymphomas for which VH and VL gene sequences
were determined. The remaining eight lymphomas were screened for
monoclonal 51p1 rearrangements using an allele-specific Ig gene
fingerprinting assay. This was performed by including a 51p1-specific
oligonucleotide in the labeling step of the Ig gene fingerprinting
analysis, which allows detection of a monoclonal 51p1-expressing B-cell
population among IgM+ B cells expressing other
VH genes (Fig 5). The specificity of this assay was
previously established by analyzing more than 30 chronic lymphocytic
leukemia (CLL) cases with characterized VH gene sequences
(only cases with a monoclonal 51p1 rearrangement showed a single band
in the 51p1 fingerprint), and more than 60 cases without any
lymphoproliferative disorder (DGE, unpublished observations, July
1997). Most of the latter cases showed a polyclonal pattern of 51p1 transcripts (examples are NC1-4 in Fig 5), whereas in
the remaining cases 51p1 transcripts could not be detected (NC5 in Fig
5). This type of normal pattern was observed in cases LC5, LC8, LC9,
and FAV, whereas the remaining four cases (LC1, LC6, LC7, and MEL)
showed a dominant single band in the 51p1 fingerprint, indicating a
monoclonal expansion of 51p1-expressing IgM+ B cells. Thus,
it seems probable that these four lymphomas also expressed Ig molecules
encoded by the 51p1 VH gene.
| |
DISCUSSION |
Nucleotide sequence analysis of VH and VL genes
has provided useful information regarding the pathogenesis and the
stage of differentiation for many B-cell neoplasms.30-41
The presence of somatic mutations suggests that the malignant B cells
have passed the germinal center stage of differentiation, whereas the
finding of a restricted V gene repertoire and a high frequency of
replacement mutations in the CDRs are indicative of a role for antigen
selection in the pathogenesis of the disease. We now show that the
antibodies expressed by the malignant B cells in HCV-associated
immunocytomas are preferentially encoded by a restricted set of
VH and VL genes. The 51p1/kv325 gene
combination encoded the variable regions in five of the eight cases for
which complete nucleotide sequences were determined. Considering also
the data obtained with the Ig gene fingerprinting technique, it seems
that 9 of the 16 VH genes were derived from the 51p1 gene,
indicating that this VH gene is highly overrepresented in
HCV-associated immunocytoma.
The frequent usage of the 51p1/kv325 combination in HCV-associated
immunocytomas is not surprising, considering that the malignant B cells
in most cases produced a monoclonal cryoglobulin with RF activity (8 of
the 13 cases with a type II cryoglobulin had a monoclonal 51p1
rearrangement). Early studies using anti-idiotypic antibodies have
shown that more than 60% of monoclonal RFs from patients with type II
MC express the Wa cross-reactive idiotype (CRI), which, in turn, in
more than 70% of the cases is associated with the light chain CRI
17.109 and the heavy chain CRI G6.5 The latter two CRIs are
characteristic for VL and VH regions encoded by
germline kv325 and 51p1 genes, respectively. Thus, these data indicate
that HCV-associated immunocytoma most likely represents the malignant
counterpart of type II MC.
The VH and VL gene sequences from all of the
HCV-associated immunocytomas showed a number of nucleotide differences
with respect to their germline counterparts. In addition, substantial
intraclonal VH and/or VL gene diversity
was evident in each case, consistent with an ongoing somatic
hypermutation process in the tumor cells subsequent to the neoplastic
transformation. A similar phenotype has been observed in a number of
other B-cell malignancies such as follicular lymphoma,30
gastric and salivary gland MALT lymphoma,35,40 Burkitt's
lymphoma,36 and monoclonal gammopathy of undetermined significance,37 indicating that the malignant events in
these neoplasms might have occurred at a similar stage of B-cell
differentiation.
Clonally related transcripts of the IgM and IgG heavy chain isotype
were detected in one of the HCV-associated immunocytomas, providing
evidence for isotype switching in a subset of the malignant B cells.
Isotype switching and somatic hypermutation are processes which
typically occur in the germinal centers of lymphoid tissues during a
T-cell-dependent antibody response, and are consistent with a role for
antigen stimulation in the clonal evolution of the lymphoma. The RF
activity of the Igs from most of the HCV-associated immunocytomas
suggests that the proliferation of the neoplastic B cells was driven by
immune complexes composed of polyclonal IgG and HCV. T cells specific
for IgG Fc are normally deleted,42 but the RF-producing B
cells may obtain T-cell help from HCV-specific T cells while presenting
peptides derived from HCV proteins present in the immune
complexes.43 Interestingly, however, the pattern of somatic
mutations in the HCV-associated immunocytoma V genes is not suggestive
for selection of changes which could increase the affinity for the
antigen. Rather, the low number of replacement mutations in the CDRs is
indicative of selection against mutations which could generate
high-affinity antibodies. This is most clearly seen in the case of the
51p1-encoded VH regions which have an overall R:S ratio in
the CDRs of only 1.2 (12:10), which is substantially lower than the R:S
ratio of 3.6 expected from random accumulation of nucleotide changes in
the absence of selective pressure.29 A high R:S ratio which
was significantly different from the one expected for random mutations
was seen only in the VH CDRs of the lymphoma immunoglobulin
that lacked RF activity (patient MS, Table 2). The CDRs of the light
chains similarly lacked high R:S ratios, which was especially evident
in the case of the kv325-encoded VL domains. A low number
of R mutations was also observed in the FWRs of most of the
VH and VL domains. Negative selection against R
mutations in the FWRs is consistent with selective pressure for
maintenance of functional Ig molecules, and further indicates the
requirement for a functional B-cell receptor in the clonal evolution of
the HCV-associated immunocytomas.
Rheumatoid factor antibodies that are induced after immunization of
healthy donors are frequently encoded by the 51p1/kv325 combination,44 indicating a common cellular origin with the monoclonal RFs of type II MC and HCV-associated immunocytoma. Nucleotide sequence analysis of 51p1-encoded RFs from healthy immunized
donors also shows a strong selection against R mutations in the CDRs,
and moreover, no increase in the affinity for the Fc region of IgG with
the accumulation of mutations.45 Intraclonal diversity and
absence of significant clustering of R mutations in the CDRs has also
been observed in a 51p1/kv325-encoded RF from a patient with type II
MC.46 Also in this case the affinity for the Fc region of
IgG did not change after substituting the mutated 51p1 and kv325 genes
with their germline counterparts.47 Thus, although all of
the above data indicate that antigen stimulation can lead to the
proliferation, somatic mutation, and isotype switching of RF-expressing
B cells, it also seems that B cells expressing high affinity RF
receptors are either not selected or are eliminated by peripheral
tolerance mechanisms.48-50
Preferential use of the 51p1 gene has also been observed in CLL, with a
prevalence of more than 20% in particular geographic areas
(31,51 and DGE, unpublished observations, July
1997). However, unlike the HCV-associated immunocytomas,
the 51p1 VH sequences in CLL are almost exclusively
unmutated and usually have significantly longer CDR3
regions.51,52 A more striking similarity regarding V gene
repertoire and somatic hypermutation exists between HCV-associated immunocytoma and salivary gland MALT lymphoma. In two recent studies by
Bahler et al40,53 the 51p1 gene was found in 10 of the 18 VH sequences and was associated with a kv325 VL
region in all cases in which the VL sequence was reported.
Although the antigen specificity of the lymphoma Igs in this study is
unknown, it is interesting to note that salivary gland MALT lymphomas
are typically associated with Sjogren's syndrome, which is frequently
characterized by the presence of RFs and cryoglobulins in patients'
sera. Somatic hypermutation, intraclonal diversity, and selection
against R mutations in the CDRs was also observed in this study,
indicating similar events in the pathogenesis of HCV-associated
immunocytomas and salivary gland MALT lymphomas.
In summary, the data presented in this study indicate that
HCV-associated immunocytomas represent clonal proliferations of a
highly selected B-cell population. The tumor cells from most of these
cases secrete a cryoprecipitable RF that is frequently encoded by the
51p1 VH gene in combination with the kv325 VL
gene. The V genes in these lymphomas undergo changes typical of a
T-cell-dependent antibody response, indicating a role for chronic
antigen stimulation by HCV-containing immune complexes in the clonal
evolution of HCV-associated immunocytomas.
| |
FOOTNOTES |
Submitted August 4, 1997;
accepted November 11, 1997.
Supported in part by a grant no. 42 from the Istituto Superiore Di
Sanita within the frame of the Primo Progetto Di Ricerca Epatite
Virale.
Address reprint requests to Dimitar G. Efremov, MD, PhD, ICGEB, Area
Science Park, Padriciano 99, 34012 Trieste, Italy.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.
| |
ACKNOWLEDGMENT |
We thank Dr Nicholas Chiorazzi for valuable comments and critical
reading of the manuscript.
| |
REFERENCES |
1.
Agnello V,
Chung RT,
Kaplan LM:
A role for hepatitis C virus infection in type II cryoglobulinemia.
N Engl J Med
327:1490,
1992[Abstract]
2.
Misiani R,
Bellavita P,
Fenili D,
Borelli G,
Marchesi D,
Massazza M,
Vendramin G,
Comotti B,
Tanzi E,
Scudeller G:
Hepatitis C virus infection in patients with essential mixed cryoglobulinemia.
Ann Intern Med
117:573,
1992
3.
Perl A,
Gorevic PD,
Ryan DH,
Condemi JJ,
Ruszkowski RJ,
Abraham GN:
Clonal B cell expansion in patients with essential mixed cryoglobulinemia.
Clin Exp Immunol
76:54,
1989[Medline]
[Order article via Infotrieve]
4.
Franzin F,
Efremov DG,
Pozzato G,
Tulissi P,
Batista F,
Burrone O:
Clonal B-cell expansions in peripheral blood of HCV-infected patients.
Br J Haematol
90:548,
1995[Medline]
[Order article via Infotrieve]
5.
Gorevic PD,
Frangione B:
Mixed cryoglobulinemia crossreactive idiotypes: Implications for the relationship of MC to rheumatic and lymphoproliferative disease.
Semin Hematol
28:79,
1991[Medline]
[Order article via Infotrieve]
6.
Pozzato G,
Mazzaro C,
Crovatto M,
Modolo ML,
Ceselli S,
Mazzi G,
Sulfaro S,
Franzin F,
Tulissi P,
Moretti M,
Santini GF:
Low-grade malignant lymphoma, hepatitis C virus infection, and mixed cryoglobulinemia.
Blood
84:3047,
1994[Abstract/Free Full Text]
7.
Ferri C,
Caracciolo F,
Zignego AL,
La Civita L,
Monti M,
Longombardo G,
Lombardini F,
Greco F,
Capochiani E,
Mazzoni A,
Mazzaro C,
Pasero GP:
Hepatitis C virus infection in patients with non-Hodgkin's lymphoma.
Br J Haematol
88:392,
1994[Medline]
[Order article via Infotrieve]
8.
Luppi M,
Ferrari MG,
Bonaccorsi G,
Longo G,
Narni F,
Barozzi P,
Marasca R,
Mussini C,
Torelli G:
Hepatitis C virus infection in subsets of neoplastic lymphoproliferations not associated with cryoglobulinemia.
Leukemia
10:351,
1996[Medline]
[Order article via Infotrieve]
9.
Silvestri F,
Pipan C,
Barillari G,
Zaja F,
Fanin R,
Infanti L,
Russo D,
Falasca E,
Botta GA,
Baccarani M:
Prevalence of hepatitis C virus infection in patients with lymphoproliferative disorders.
Blood
87:4296,
1996[Abstract/Free Full Text]
10. (letter)
Musto P,
dell'Olio M,
Carotenuto M,
Mangia A,
Andriulli A:
Hepatitis C virus infection: A new bridge between hematologists and gastroenterologists?
Blood
88:752,
1996[Free Full Text]
11.
Mazzaro C,
Zagonel V,
Monfardini S,
Tulissi P,
Pussini E,
Fanni M,
Sorio R,
Bortolus R,
Crovatto M,
Santini G,
Tiribelli C,
Sasso F,
Masutti R,
Pozzato G:
Hepatitis C virus and non-Hodgkin's lymphomas.
Br J Haematol
94:544,
1996[Medline]
[Order article via Infotrieve]
12.
Silvestri F,
Barillari G,
Fanin R,
Pipan C,
Falasca E,
Salmaso F,
Zaja F,
Infanti L,
Patriarca F,
Botta GA,
Baccarani M:
Hepatitis C virus infection among cryoglobulinemic and non-cryoglobulinemic B-cell non-Hodgkin's lymphomas.
Haematologica
82:314,
1997[Abstract/Free Full Text]
13.
Harris NL,
Jaffe ES,
Stein H,
Banks PM,
Chan JKC,
Cleary ML,
Delsol G,
Dewolf-Peeters C,
Falini B,
Gatter KC,
Grogan TM,
Isaacson PG,
Knowles DM,
Mason DY,
Muller-Hermelink HK,
Pileri SA,
Piris MA,
Ralfkiaer E,
Warnke RA:
A Revised European-American Classification of Lymphoid Neoplasms: A proposal from the International Lymphoma Study Group.
Blood
84:1361,
1994[Free Full Text]
14.
Pioltelli P,
Zehender G,
Monti G,
Monteverde A,
Galli M:
HCV and non-Hodgkin's lymphoma.
Lancet
347:624,
1996[Medline]
[Order article via Infotrieve]
15.
Luppi M,
Longo G,
Ferrari MG,
Ferrara L,
Marasca R,
Barozzi P,
Morselli M,
Emilia G,
Torelli G:
Additional neoplasms and HCV infection in low-grade lymphoma of MALT type.
Br J Haematol
94:373,
1996[Medline]
[Order article via Infotrieve]
16.
De Vita S,
Sansonno D,
Dolcetti R,
Ferraccioli G,
Carbone A,
Cornacchiulo V,
Santini G,
Crovatto M,
Gloghini A,
Dammacco F,
Boiocchi M:
Hepatitis C virus within a malignant lymphoma lesion in the course of type II mixed cryoglobulinemia.
Blood
86:1887,
1995[Abstract/Free Full Text]
17.
De Vita S,
Sacco C,
Sansono D,
Gloghini A,
Dammacco F,
Crovatto M,
Santini G,
Dolcetti R,
Boiocchi M,
Carbone A,
Zagonel V:
Characterization of overt B-cell lymphomas in patients with hepatitis C virus infection.
Blood
90:776,
1997[Abstract/Free Full Text]
18. (abstr)
Zuckerman T,
Zuckerman E,
Douer D,
Fong T-L,
Nathwani BN,
Velankar M,
Gutenkunst K,
Qian GD,
Levine AM:
Hepatitis C virus infection in patients with B-cell non-Hodgkin's lymphoma.
Blood
88:222a,
1996
19. (letter)
Silvestri F,
Barillari G,
Fanin R,
Salmaso F,
Infanti L,
Zaja F,
Baccarani M:
Hepatitis C virus infection (and additional neoplasms) among marginal zone lymphomas.
Br J Haematol
96:427,
1997[Medline]
[Order article via Infotrieve]
20.
Agnello V:
The aetiology of mixed cryoglobulinemia associated with hepatitis C virus infection.
Scand J Immunol
42:179,
1995[Medline]
[Order article via Infotrieve]
21.
Chomzynski P,
Sacchi N:
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal Biochem
162:156,
1987[Medline]
[Order article via Infotrieve]
22.
Efremov DG,
Ivanovski M,
Siljanovski N,
Pozzato G,
Cevreska L,
Fais F,
Chiorazzi N,
Batista FD,
Burrone OR:
Restricted immunoglobulin VH region repertoire in chronic lymphocytic leukemia patients with autoimmune hemolytic anemia.
Blood
87:3869,
1996[Abstract/Free Full Text]
23.
Cook GP,
Tomlison IM:
The human immunoglobulin VH repertoire.
Immunol Today
16:237,
1995[Medline]
[Order article via Infotrieve]
24. Kabat EA, Wu TT, Perry HM, Gottesman KS, Foeller C: Sequences of
Proteins of Immunological Interest (ed 5). Bethesda, MD, US Department
of Health and Human Services, 1991
25.
Yamada M,
Wasserman R,
Reichard BA,
Shane S,
Caton AJ,
Rovera G:
Preferential utilization of specific immunoglobulin heavy chain diversity and joining segments in adult human peripheral blood B lymphocytes.
J Exp Med
173:395,
1991[Abstract/Free Full Text]
26.
Efremov DG,
Ivanovski N,
Batista FD,
Pozzato G,
Burrone OR:
IgM-producing chronic lymphocytic leukemia cells undergo immunoglobulin isotype-switching without acquiring somatic mutations.
J Clin Invest
98:290,
1996[Medline]
[Order article via Infotrieve]
27.
Sasso EH,
van Dijk KW,
Bull AP,
Milner ECB:
A fetally expressed immunoglobulin VH1 gene belongs to a complex set of alleles.
J Clin Invest
91:2358,
1993
28.
Schlomchik MJ,
Aucoin AH,
Pisetsky DS,
Weigert MG:
Structure and function of anti-DNA autoantibodies derived from a single autoimmune mouse.
Proc Natl Acad Sci USA
84:9150,
1987[Abstract/Free Full Text]
29.
Chang B,
Casali P:
The CDR1 sequences of a major proportion of human germline Ig VH genes are inherently susceptible to amino acid replacement.
Immunol Today
15:367,
1994[Medline]
[Order article via Infotrieve]
30.
Bahler DW,
Levy R:
Clonal evolution of a follicular lymphoma: Evidence for antigen selection.
Proc Natl Acad Sci USA
89:6770,
1992[Abstract/Free Full Text]
31.
Kipps TJ,
Carson DA:
Autoantibodies in chronic lymphocytic leukemia and related systemic autoimmune diseases.
Blood
81:2475,
1993[Free Full Text]
32.
Wagner SD,
Martinelli V,
Luzzatto L:
Similar patterns of Vk gene usage but different degrees of somatic mutation in hairy cell leukemia, prolymphocytic leukemia, Waldenstrom's macroglobulinemia, and myeloma.
Blood
83:3647,
1994[Abstract/Free Full Text]
33.
Hsu FJ,
Levy R:
Preferential use of the VH4 Ig gene family by diffuse large-cell lymphoma.
Blood
86:3072,
1995[Abstract/Free Full Text]
34.
Qin Y,
Greiner A,
Trunk MJF,
Schmausser B,
Ott MM,
Muller-Hermelink HK:
Somatic hypermutation in low-grade mucosa-associated lymphoid tissue-type-B-cell lymphoma.
Blood
86:3528,
1995[Abstract/Free Full Text]
35.
Du M,
Diss TC,
Xu C,
Peng H,
Isaacson PG,
Pan L:
Ongoing mutation in MALT lymphoma immunoglobulin gene suggests that antigen stimulation plays a role in the clonal expansion.
Leukemia
10:1190,
1996[Medline]
[Order article via Infotrieve]
36.
Chapman CJ,
Zhou JX,
Gregory C,
Rickinson AB,
Stevenson FK:
VH and VL gene analysis in sporadic Burkitt's lymphoma show somatic hypermutation, intraclonal heterogeneity, and a role for antigen selection.
Blood
88:3562,
1996[Abstract/Free Full Text]
37.
Sahota SS,
Leo R,
Hamblin TJ,
Stevenson FK:
Ig VH gene mutational patterns indicate different tumor cell status in human myeloma and monoclonal gammopathy of undetermined significance.
Blood
87:746,
1996[Abstract/Free Full Text]
38.
Davi F,
Maloum K,
Michel A,
Pritsch O,
Magnac C,
Macintyre E,
Salomon-Nguyen F,
Binet J-L,
Dighiero G,
Merle-Beral H:
High frequency of somatic mutations in the VH genes expressed in prolymphocytic leukemia.
Blood
88:3953,
1996[Abstract/Free Full Text]
39.
Kuppers R,
Rajewsky K,
Hansman M-L:
Diffuse large cell lymphomas are derived from mature B cells carrying V region genes with a high load of somatic mutations and evidence of selection for antibody expression.
Eur J Immunol
27:1398,
1997[Medline]
[Order article via Infotrieve]
40.
Bahler DW,
Miklos JA,
Swerdlow SH:
Ongoing Ig gene hypermutation in salivary gland mucosa-associated lymphoid tissue-type lymphomas.
Blood
89:3335,
1997[Abstract/Free Full Text]
41.
Sahota SS,
Leo R,
Hamblin TJ,
Stevenson FK:
Myeloma VL and VH gene sequences reveal a complementary imprint of antigen selection in tumor cells.
Blood
89:219,
1997[Abstract/Free Full Text]
42.
Bikoff EK:
Tolerance for self Ig at the level of the Ly1+ T cell.
J Exp Med
158:1868,
1983[Abstract/Free Full Text]
43.
Roosnek E,
Lanzavecchia A:
Efficient and selective presentation of antigen-antibody complexes by rheumatoid factor B cells.
J Exp Med
173:487,
1991[Abstract/Free Full Text]
44.
Borretzen M,
Randen I,
Natvig JB,
Thompson KM:
Structural restriction in the heavy chain CDR3 of human rheumatoid factors.
J Immunol
155:3630,
1995[Abstract]
45.
Borretzen M,
Randen I,
Zdarsky E,
Forre O,
Natvig JB,
Thompson KM:
Control of autoantibody affinity by selection against amino acid replacements in the complementarity-determining regions.
Proc Natl Acad Sci USA
91:12917,
1994[Abstract/Free Full Text]
46.
Crouzier R,
Martin T,
Pasquali J-L:
Monoclonal IgM rheumatoid factor secreted by CD5-negative B-cells during mixed cryoglobulinemia: Evidence for somatic mutations and intraclonal diversity of the expressed VH region gene.
J Immunol
154:413,
1995[Abstract]
47.
Crouzier R,
Martin T,
Pasquali J-L:
Heavy chain variable region, light chain variable region, and heavy chain CDR3 influences on the mono- and polyreactivity and on the affinity of human monoclonal rheumatoid factors.
J Immunol
154:4526,
1995[Abstract]
48.
Tighe H,
Heaphy P,
Baird S,
Weigle WO,
Carson DA:
Human immunoglobulin (IgG) induced deletion of IgM rheumatoid factor B cells in transgenic mice.
J Exp Med
181:599,
1995[Abstract/Free Full Text]
49.
Tighe H,
Warnatz K,
Brinson D,
Corr M,
Weigle WO,
Baird SM,
Carson DA:
Peripheral deletion of rheumatoid factor B cells after abortive activation by IgG.
Proc Natl Acad Sci USA
94:646,
1997[Abstract/Free Full Text]
50.
Wang H,
Shlomchik MJ:
High affinity rheumatoid factor transgenic B cells are eliminated in normal mice.
J Immunol
159:1125,
1997[Abstract]
51.
Johnson TA,
Rassenti LZ,
Kipps TJ:
Ig VH1 genes expressed in B cell chronic lymphocytic leukemia exhibit distinctive molecular features.
J Immunol
158:235,
1997[Abstract]
52.
Efremov DG,
Ivanovski M,
Pozzato G,
Batista FD,
Burrone OR:
The leukemic cells of chronic lymphocytic leukemia patients with autoimmune hemolytic anemia produce isotype-switched immunoglobulins that are preferentially encoded by the 51p1 and DP-50 VH genes.
Ann NY Acad Sci
815:443,
1997[Medline]
[Order article via Infotrieve]
53. (abstr, suppl 1)
Bahler DW,
Miklos JA,
Kapadia SB,
Swerdlow SH:
Preferential use of specific immunoglobulin VH, D and JH genes by salivary gland MALT lymphomas.
Blood
88:375a,
1996
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
K. Machida, Y. Kondo, J. Y. Huang, Y.-C. Chen, K. T.-H. Cheng, Z. Keck, S. Foung, J. Dubuisson, V. M.-H. Sung, and M. M. C. Lai
Hepatitis C Virus (HCV)-Induced Immunoglobulin Hypermutation Reduces the Affinity and Neutralizing Activities of Antibodies against HCV Envelope Protein
J. Virol.,
July 1, 2008;
82(13):
6711 - 6720.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. Saadoun, M. Rosenzwajg, D. Landau, J. C. Piette, D. Klatzmann, and P. Cacoub
Restoration of peripheral immune homeostasis after rituximab in mixed cryoglobulinemia vasculitis
Blood,
June 1, 2008;
111(11):
5334 - 5341.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. D. Charles, R. M. Green, S. Marukian, A. H. Talal, G. V. Lake-Bakaar, I. M. Jacobson, C. M. Rice, and L. B. Dustin
Clonal expansion of immunoglobulin M+CD27+ B cells in HCV-associated mixed cryoglobulinemia
Blood,
February 1, 2008;
111(3):
1344 - 1356.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D S Viswanatha and A Dogan
Hepatitis C virus and lymphoma
J. Clin. Pathol.,
December 1, 2007;
60(12):
1378 - 1383.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. Saadoun, D. A. Landau, L. H. Calabrese, and P. P. Cacoub
Hepatitis C-associated mixed cryoglobulinaemia: a crossroad between autoimmunity and lymphoproliferation
Rheumatology,
August 1, 2007;
46(8):
1234 - 1242.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. Sene, N. Limal, P. Ghillani-Dalbin, D. Saadoun, J.-C. Piette, and P. Cacoub
Hepatitis C virus-associated B-cell proliferation--the role of serum B lymphocyte stimulator (BLyS/BAFF)
Rheumatology,
January 1, 2007;
46(1):
65 - 69.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G. Feldmann, H. D. Nischalke, J. Nattermann, B. Banas, T. Berg, C. Teschendorf, W. Schmiegel, U. Duhrsen, J. Halangk, A. Iwan, et al.
Induction of Interleukin-6 by Hepatitis C Virus Core Protein in Hepatitis C-Associated Mixed Cryoglobulinemia and B-Cell Non-Hodgkin's Lymphoma
Clin. Cancer Res.,
August 1, 2006;
12(15):
4491 - 4498.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. H. Margolin, E. H. Saunders, B. Bronfin, N. de Rosa, M. K. Axthelm, O. G. Goloubeva, S. Eapen, R. S. Gelman, and N. L. Letvin
Germinal Center Function in the Spleen during Simian HIV Infection in Rhesus Monkeys
J. Immunol.,
July 15, 2006;
177(2):
1108 - 1119.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
V. De Re, S. De Vita, D. Sansonno, D. Gasparotto, M. P. Simula, F. A. Tucci, A. Marzotto, M. Fabris, A. Gloghini, A. Carbone, et al.
Type II mixed cryoglobulinaemia as an oligo rather than a mono B-cell disorder: evidence from GeneScan and MALDI-TOF analyses
Rheumatology,
June 1, 2006;
45(6):
685 - 693.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
V. Racanelli, M. A. Frassanito, P. Leone, M. Galiano, V. De Re, F. Silvestris, and F. Dammacco
Antibody Production and In Vitro Behavior of CD27-Defined B-Cell Subsets: Persistent Hepatitis C Virus Infection Changes the Rules.
J. Virol.,
April 1, 2006;
80(8):
3923 - 3934.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Petlickovski, L. Laurenti, X. Li, S. Marietti, P. Chiusolo, S. Sica, G. Leone, and D. G. Efremov
Sustained signaling through the B-cell receptor induces Mcl-1 and promotes survival of chronic lymphocytic leukemia B cells
Blood,
June 15, 2005;
105(12):
4820 - 4827.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Carbonari, E. Caprini, T. Tedesco, F. Mazzetta, V. Tocco, M. Casato, G. Russo, and M. Fiorilli
Hepatitis C Virus Drives the Unconstrained Monoclonal Expansion of VH1-69-Expressing Memory B Cells in Type II Cryoglobulinemia: A Model of Infection-Driven Lymphomagenesis
J. Immunol.,
May 15, 2005;
174(10):
6532 - 6539.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Ahmad and F. Alvarez
Role of NK and NKT cells in the immunopathogenesis of HCV-induced hepatitis
J. Leukoc. Biol.,
October 1, 2004;
76(4):
743 - 759.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. D Cowgill, C. A Loffredo, S. A.-L. Eissa, N. Mokhtar, M. Abdel-Hamid, A. Fahmy, and G T. Strickland
Case-control study of non-Hodgkin's lymphoma and hepatitis C virus infection in Egypt
Int. J. Epidemiol.,
October 1, 2004;
33(5):
1034 - 1039.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Machida, K. T.-H. Cheng, V. M.-H. Sung, K. J. Lee, A. M. Levine, and M. M. C. Lai
Hepatitis C Virus Infection Activates the Immunologic (Type II) Isoform of Nitric Oxide Synthase and Thereby Enhances DNA Damage and Mutations of Cellular Genes
J. Virol.,
August 15, 2004;
78(16):
8835 - 8843.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Machida, K. T.-N. Cheng, V. M.-H. Sung, S. Shimodaira, K. L. Lindsay, A. M. Levine, M.-Y. Lai, and M. M. C. Lai
Hepatitis C virus induces a mutator phenotype: Enhanced mutations of immunoglobulin and protooncogenes
PNAS,
March 23, 2004;
101(12):
4262 - 4267.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. D. Aljurf, T. W. Owaidah, A. Ezzat, E. Ibrahim, and A. Tbakhi
Antigen- and/or immune-driven lymphoproliferative disorders
Ann. Onc.,
November 1, 2003;
14(11):
1595 - 1606.
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. Zuckerman, A. Kessel, G. Slobodin, E. Sabo, D. Yeshurun, and E. Toubi
Antiviral Treatment Down-Regulates Peripheral B-Cell CD81 Expression and CD5 Expansion in Chronic Hepatitis C Virus Infection
J. Virol.,
October 1, 2003;
77(19):
10432 - 10436.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
N. C. Turner, G. Dusheiko, and A. Jones
Hepatitis C and B-cell lymphoma
Ann. Onc.,
September 1, 2003;
14(9):
1341 - 1345.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Mele, A. Pulsoni, E. Bianco, P. Musto, A. Szklo, M. G. Sanpaolo, E. Iannitto, A. De Renzo, B. Martino, V. Liso, et al.
Hepatitis C virus and B-cell non-Hodgkin lymphomas: an Italian multicenter case-control study
Blood,
August 1, 2003;
102(3):
996 - 999.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. H. Walsh, M. Thorselius, A. Johnson, O. Soderberg, M. Jerkeman, E. Bjorck, I. Eriksson, U. Thunberg, O. Landgren, M. Ehinger, et al.
Mutated VH genes and preferential VH3-21 use define new subsets of mantle cell lymphoma
Blood,
May 15, 2003;
101(10):
4047 - 4054.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Ni, E. Hembrador, A. M. Di Bisceglie, I. M. Jacobson, A. H. Talal, D. Butera, C. M. Rice, T. J. Chambers, and L. B. Dustin
Accumulation of B Lymphocytes with a Naive, Resting Phenotype in a Subset of Hepatitis C Patients
J. Immunol.,
March 15, 2003;
170(6):
3429 - 3439.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
V. M.-H. Sung, S. Shimodaira, A. L. Doughty, G. R. Picchio, H. Can, T. S. B. Yen, K. L. Lindsay, A. M. Levine, and M. M. C. Lai
Establishment of B-Cell Lymphoma Cell Lines Persistently Infected with Hepatitis C Virus In Vivo and In Vitro: the Apoptotic Effects of Virus Infection
J. Virol.,
February 1, 2003;
77(3):
2134 - 2146.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Giovannetti, F. Mazzetta, E. Caprini, A. Aiuti, M. Marziali, M. Pierdominici, A. Cossarizza, L. Chessa, E. Scala, I. Quinti, et al.
Skewed T-cell receptor repertoire, decreased thymic output, and predominance of terminally differentiated T cells in ataxia telangiectasia
Blood,
December 1, 2002;
100(12):
4082 - 4089.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. L. Zignego, C. Ferri, F. Giannelli, C. Giannini, P. Caini, M. Monti, M. E. Marrocchi, E. Di Pietro, G. La Villa, G. Laffi, et al.
Prevalence of bcl-2 Rearrangement in Patients with Hepatitis C Virus-Related Mixed Cryoglobulinemia with or without B-Cell Lymphomas
Ann Intern Med,
October 1, 2002;
137(7):
571 - 580.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
O. Hermine, F. Lefrere, J.-P. Bronowicki, X. Mariette, K. Jondeau, V. Eclache-Saudreau, B. Delmas, F. Valensi, P. Cacoub, C. Brechot, et al.
Regression of Splenic Lymphoma with Villous Lymphocytes after Treatment of Hepatitis C Virus Infection
N. Engl. J. Med.,
July 11, 2002;
347(2):
89 - 94.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Casato, C. Mecucci, V. Agnello, M. Fiorilli, G. B. Knight, C. Matteucci, L. Gao, and J. Kay
Regression of lymphoproliferative disorder after treatment for hepatitis C virus infection in a patient with partial trisomy 3, Bcl-2 overexpression, and type II cryoglobulinemia
Blood,
March 15, 2002;
99(6):
2259 - 2261.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G. Tobin, U. Thunberg, A. Johnson, I. Thorn, O. Soderberg, M. Hultdin, J. Botling, G. Enblad, J. Sallstrom, C. Sundstrom, et al.
Somatically mutated Ig VH3-21 genes characterize a new subset of chronic lymphocytic leukemia
Blood,
March 15, 2002;
99(6):
2262 - 2264.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. R. Quinn, C. H. Chan, K. G. Hadlock, S. K. H. Foung, M. Flint, and S. Levy
The B-cell receptor of a hepatitis C virus (HCV)-associated non-Hodgkin lymphoma binds the viral E2 envelope protein, implicating HCV in lymphomagenesis
Blood,
December 15, 2001;
98(13):
3745 - 3749.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
X Mariette
Lymphomas complicating Sjogren's syndrome and hepatitis C virus infection may share a common pathogenesis: chronic stimulation of rheumatoid factor B cells
Ann Rheum Dis,
November 1, 2001;
60(11):
1007 - 1011.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. Marasca, P. Vaccari, M. Luppi, P. Zucchini, I. Castelli, P. Barozzi, A. Cuoghi, and G. Torelli
Immunoglobulin Gene Mutations and Frequent Use of VH1-69 and VH4-34 Segments in Hepatitis C Virus-Positive and Hepatitis C Virus-Negative Nodal Marginal Zone B-Cell Lymphoma
Am. J. Pathol.,
July 1, 2001;
159(1):
253 - 261.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. Zuckerman, T. Zuckerman, D. Sahar, S. Streichman, D. Attias, E. Sabo, D. Yeshurun, and J. M. Rowe
The effect of antiviral therapy on t(14;18) translocation and immunoglobulin gene rearrangement in patients with chronic hepatitis C virus infection
Blood,
March 15, 2001;
97(6):
1555 - 1559.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. H. Chan, K. G. Hadlock, S. K. H. Foung, and S. Levy
VH1-69 gene is preferentially used by hepatitis C virus-associated B cell lymphomas and by normal B cells responding to the E2 viral antigen
Blood,
February 15, 2001;
97(4):
1023 - 1026.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
V. De Re, S. De Vita, A. Marzotto, M. Rupolo, A. Gloghini, B. Pivetta, D. Gasparotto, A. Carbone, and M. Boiocchi
Sequence analysis of the immunoglobulin antigen receptor of hepatitis C virus-associated non-Hodgkin lymphomas suggests that the malignant cells are derived from the rheumatoid factor-producing cells that occur mainly in type II cryoglobulinemia
Blood,
November 15, 2000;
96(10):
3578 - 3584.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Kitay-Cohen, A. Amiel, N. Hilzenrat, D. Buskila, Y. Ashur, M. Fejgin, E. Gaber, R. Safadi, R. Tur-kaspa, and M. Lishner
Bcl-2 rearrangement in patients with chronic hepatitis C associated with essential mixed cryoglobulinemia type II
Blood,
October 15, 2000;
96(8):
2910 - 2912.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. A. Miklos, S. H. Swerdlow, and D. W. Bahler
Salivary gland mucosa-associated lymphoid tissue lymphoma immunoglobulin VH genes show frequent use of V1-69 with distinctive CDR3 features
Blood,
June 15, 2000;
95(12):
3878 - 3884.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. Kuppers, U. Klein, M.-L. Hansmann, and K. Rajewsky
Cellular Origin of Human B-Cell Lymphomas
N. Engl. J. Med.,
November 11, 1999;
341(20):
1520 - 1529.
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. Pileri, Y. Uematsu, S. Campagnoli, G. Galli, F. Falugi, R. Petracca, A. J. Weiner, M. Houghton, D. Rosa, G. Grandi, et al.
Binding of Hepatitis C Virus to CD81
Science,
October 30, 1998;
282(5390):
938 - 941.
[Abstract]
[Full Text]
|
|
|
|
|
Abstract
Introduction
Abstract