|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 91 No. 7 (April 1), 1998:
pp. 2475-2481
Mechanisms of Growth Control of Kaposi's Sarcoma-Associated Herpes
Virus-Associated Primary Effusion Lymphoma Cells
By
Hiroya Asou,
Jonathan W. Said,
Rong Yang,
Reinhold Munker,
Dorothy
J. Park,
Nanao Kamada, and
H. Phillip Koeffler
From the Division of Hematology/Oncology and Pathology, Cedars-Sinai
Medical Center, UCLA School of Medicine, Los Angeles, CA; and the
Department of Cancer Cytogenetics, Division of Molecular Biology,
Research Institute for Radiation Biology and Medicine, Hiroshima
University, Hiroshima, Japan.
 |
ABSTRACT |
Primary effusion lymphoma (PEL) is a distinct clinicopathologic
entity associated with Kaposi's sarcoma-associated herpes virus
(KSHV). Several cytokines, including interleukin-6 (IL-6), basic
fibroblast growth factor (bFGF), and platelet-derived growth factor
(PDGF) may be important for survival of KS cells. However, little is
known about the interaction of cytokines with KSHV-infected lymphocytes
from PEL. Therefore, we investigated what cytokines were produced by
KSHV-infected PEL cell lines (KS-1, BC-1, BC-2), what cytokine
receptors were expressed by these cells, what response these cells had
to selected cytokines, and what was the effect of IL-6 antisense
phosphorothioated oligonucleotides. Reverse transcriptase-polymerase
chain reaction (RT-PCR) and protein studies showed that these three
cell lines produced IL-10, IL-6, and the receptors for IL-6. The
granulocyte macrophage colony-stimulating factor (GM-CSF), IL-1 ,
IL-8, IL-12, bFGF, PDGF, and c-kit transcripts were not
detected in the cell lines. High levels (0.7 to 5 ng/mL/106
cells/48 hours) of IL-6 protein were consistently detected in supernatants of the cell lines by enzyme-linked immunosorbent assay
(ELISA) tests. In clonogenic assays, interferon- (IFN- ) and
IFN- suppressed the clonal growth of the PEL cells, but GM-CSF, IL-4, IL-6, IL-8, IL-10, and oncostatin M did not change it. We examined for several autocrine loops that have been suggested to occur
in KS. Experiments using antisense oligonucleotides showed that the
clonal growth of KS-1 and BC-1 was nearly 100% inhibited by IL-6
antisense oligonucleotides (10 µmol/L), but not at all by either
oligonucleotides ( 10 µmol/L) to IL-6 sense, IL-6 scrambled, viral
IL-6 (vIL-6) antisense, or IL-10 antisense. Furthermore, the IL-6
antisense oligonucleotides had no effect on two B-cell lymphoma cell
lines, which were not infected with KSHV. Addition of IL-6 antibody did
not inhibit clonal growth of any of the cell lines. Taken together, we
have defined the cytokines and their receptors expressed on PEL cells
and have found that these cells synthesized IL-6 and IL-6 receptors;
interruption of this pathway by IL-6 antisense oligonucleotides
specifically prevented the growth of these cells. These findings will
offer potential new therapeutic strategies for PEL.
 |
INTRODUCTION |
RECENTLY, KAPOSI'S sarcoma-associated
herpes virus (KSHV or HHV8) has been associated with Kaposi's sarcoma
(KS) and primary effusion lymphomas (PEL).1-4 KSHV is a
-2 herpes virus (genus Rhadinovirus) and is the first member of this
genus known to infect humans.5 KSHV-associated lymphomas
arise predominantly, but not exclusively, in human immunodeficiency
virus (HIV)-positive patients and are characterized by presentation as
malignant effusions without solid tumor masses.6-8 PEL
exhibits distinctive clinical and biologic features, including
immunoblastic morphology, indeterminate immunophenotype, clonal Ig gene
rearrangements indicating a B-cell genotype; and the cells frequently
contain the Epstein-Barr virus (EBV) in the absence of
c-myc gene rearrangements.6-8 However, the
pathogenesis and growth control mechanisms of PEL are not well
understood.
Prior studies of KS-derived cell lines have shown that these cells can
produce several cytokines including granulocyte macrophage colony-stimulating factor (GM-CSF), tumor necrosis factor (TNF), interleukin-1 (IL-1 ),9-16 as well as small
inflammatory cytokines known as chemokines.17 Of particular
interest, IL-6, oncostatin M, and platelet-derived growth factor (PDGF)
have been reported as autocrine growth factors in KS. Recently,
investigators have suggested that KSHV may provoke cytokine production
in KS.17 Moreover, four virus proteins are of interest: two
of them are similar to two human macrophage inflammatory protein (MIP)
chemokines, another is partially homologous to IL-6, and a fourth is
similar to interferon regulatory factor (IRF).18,19 In
addition, KSHV may be present in bone marrow stromal cells in patients
with multiple myeloma, and viral stimulation of IL-6 may influence the
growth of the myeloma cells.20,21 Furthermore, IL-10 and
IL-12 were reported as autocrine growth factors for acquired
immunodeficiency syndrome (AIDS)-related B-cell
lymphomas.22,23 These facts encouraged us to study the
expression of human cytokines and their receptors, as well as their
regulation to understand their involvement in KSHV-infected PEL cells.
This study suggests that IL-6 is an important cell survival factor for
PEL cells; and IL-6 antisense oligonucleotides perhaps can be a
therapeutic agent for PEL.
 |
MATERIALS AND METHODS |
Cell lines.
Three PEL cell lines (KS-1,BC-1, and BC-2) were used in this study. The
KS-1 cell line was established from a lymphomatous pleural effusion
collected from a HIV-negative patient.24 The BC-1 and BC-2
cell lines were derived from malignant effusion samples collected from
AIDS-related lymphomas.25 All of these cell lines are
positive for KSHV. BC-1 and BC-2 cell lines harbor EBV, but the KS-1
cell line is negative for EBV.24,25 EW36 and DS179 are
non-AIDS-related B-cell lymphoma cell lines, which are not infected
with either KSHV or EBV.22,23 The cell lines were
maintained in suspension culture in RPMI 1640 plus 10% fetal bovine
serum (FBS) at 37°C in 5% CO2, and subcultured every 3 to 4 days.
Reverse transcriptase-polymerase chain reaction (RT-PCR).
Total RNA was isolated from three PEL cell lines by using Trizol
(GIBCO-BRL, Gaithersburg, MD). The cDNA synthesis was
performed using Moloney murine leukemia virus RT. The cDNA product was
amplified by commercially available primers for cytokines and their
receptors (Clontech Laboratories, Palo Alto, CA). Gene expression of
GM-CSF, IL-1 , IL-8, IL-10, IL-12, TNF , PDGF , basic fibroblast
growth factor (bFGF), IL-4 receptor (IL-4R), IL-6R, and c-kit
was analyzed in this study. Efficiency of RT was controlled in each
sample by PCR amplification of -2 microglobulin using amplimers
yielding a 135-bp product (sense
5 -GGAAAAG-ATGAGTATGCCTG-3 , antisense 5 -TTCACTCAATCCAAATGC-GG-3 ). Thirty cycles of
PCR amplification were performed for evaluation of each of the
cytokines and their receptors.
Quantification of IL-6 and IL-10.
IL-6 and IL-10 were quantified by using an IL-6 or IL-10-specific
enzyme-linked immunosorbent assay (ELISA) (ELISA kits purchased from R
& D Systems, Minneapolis, MN). The IL-6 antibody has no cross-reactivity with vIL-6.18 PEL cells (1 × 106 /mL) were treated without or with
12-0-tetradecanoylphorbol 13-acetate (TPA; Sigma, St Louis, MO) at 10 ng/mL for 48 hours; subsequently supernatants of cultured cells were
collected and examined for IL-6 production by ELISA.
Expression of IL-6 receptor.
Western blot analysis was performed with monoclonal mouse antihuman
IL-6 receptor antibody (R & D Systems), which recognized 55 kD IL-6 receptor protein. Sodium dodecyl
sulfate-polyacrylamide gel electropheresis (SDS-PAGE) was performed as
previously described.26 Briefly, proteins (40 µg) were
size fractionated under denaturing conditions on 12.5 % SDS-PAGE-running gel and transferred to Immobilon polyvinylidine
fluoride membrane (Millipore, Bedford, MA) The protein was
detected using the enhanced chemiluminescence system from Amersham
(Arlington Heights, IL).
Colony formation assay in soft-gel.
Cells were cultured in a two-layer soft-agar system for 14 days as
previously described,27 and colonies were counted using an
inverted microscope. Lymphoma cell lines were plated at 5,000 to
25,000/mL. Various cytokines (0.1 to 1,000 ng/mL), interferon- -2b (IFN- -2b; Schering, Kenilworth, NJ, 1 to 10,000 U/mL),
IFN -1b (Genentech Inc, San Francisco, CA, 1 to 10,000 U/mL), antihuman IL-6 antibodies (1 to 1,000 ng/mL, R & D Systems),
all-trans retinoic acid (ATRA, Sigma, 10 11
to 10 7 mol/L), or -, and -human chorionic
gonadotropin (hCG, Sigma, 0.01 to 0.1 µg) were mixed into the lower
agar layer. The GM-CSF, IL-4, IL-6, IL-8, IL-10, and oncostatin M were
purchased from Genzyme Corp, Cambridge, MA.
Treatment of cell lines with sense and antisense oligonucleotides.
A 15-base antisense phosphorotioated oligonucleotides (TCCTGGGGGTACTGG)
specific for sequences in the second exon of the human IL-6 gene were
synthesized (Research Genetics, Huntsville, AL). Two
scramble oligonucleotides (C-1, C-2) for the human IL-6 were synthesized as controls (C-1, GCGTTAGCGTCGGT; C-2, CGTTACGTGGGGGCT). Two antisense oligonucleotides were designed for viral IL-6
(CAACTTGAACCAGCACAT, +1 to +18; GATGTGCGTCTTACTCAG, +427 to +444). An
IL-10 antisense oligonucleotide (AGCAGTGCTGAGCTGTGCAT) was made as
previously reported.28 Sense oligonucletides (control) were
synthesized for human IL-6, virus IL-6, and IL-10; and they were used
as controls in each of the antisense oligonucleotide experiments. The
oligonucleotides were custom-made, containing phosphorothioate, and
were purified by reverse-phase high performance liquid chromatography.
Various concentrations (0.01 to 10 µmol/L) of both oligonucleotides
were tested. In clonogenic assays, oligonucleotides were mixed into the
lower agar layer; and the two-layer, soft-agar system was used, as
described above.
 |
RESULTS |
Expression of cytokines and cytokine receptors in PEL cell lines.
In RT-PCR studies, all three PEL cell lines (KS-1, BC-1, and BC-2)
showed the same pattern of cytokine and cytokine receptor expression. IL-10 and IL-6R were expressed in the PEL cell lines (Fig 1). The GM-CSF, IL-1 , IL-8, IL-12,
bFGF, PDGF , IL-4R, and c-kit were not detected in the cell
lines (Table 1). Expression of IL-6R
protein was detected in the PEL cell lines by Western blot analysis
(Fig 2).

View larger version (53K):
[in this window]
[in a new window]
| Fig 1.
Detection of IL-6R mRNA and IL-10 mRNA in the PEL cell
lines. One microgram of RNA was used for cDNA synthesis. RT-PCR was performed for IL-6R, IL-10, c-kit and -2 microglobulin. One
fifth of the PCR mixture was analyzed by ethidium bromide staining of the 1.5% agarose gel (Lane 1, positive controls; lane 2, KS-1 cells;
lane 3, BC-1 cells; lane 4, BC-2; lane 5, Jurkat cells, as a negative
control; lane 6, water control). All three PEL cell lines were positive
for IL-6R (A), 251-bp, IL-10 (B), 204-bp, and -2 microglobulin (D),
but negative for c-kit (C), 388-bp.
|
|

View larger version (13K):
[in this window]
[in a new window]
| Fig 2.
Expression of IL-6R protein. Three PEL cell lines (lane
2, KS-1; lane 3, BC-1; lane 4, BC-2) expressed IL-6R protein (55 kD) by
Western blot analysis. Myeloma cell line U266 (lane 1) was the positive
control.
|
|
IL-6 and IL-10 production in the PEL cells.
The supernatants of the three PEL cell lines and five
KSHV , EBV B-cell lymphoma cell
lines were analyzed for IL-6 production by ELISA. As shown in
Table 2, high levels of IL-6 (0.7 to 5 mg/mL), and IL-10 (0.21 to 17 mg/mL) were detected consistently in the
supernatants of the PEL cell lines. Exposure to TPA (10 ng/48 h)
resulted in 70% and 40% decrease of synthesis of IL-6 from KS-1 and
BC-1 (106 cells/mL), respectively. IL-6 production was
decreased in supernatants from the TPA-treated PEL cells (Table 2).
Exposure of the cells to vIL-6 antisense oligonucleotides did not
effect the IL-6 production from the PEL cells (data not shown).
The effect of cytokines and other agents on clonogenic growth of PEL
cells.
Neither IL-6, GM-CSF, IL-4, IL-8, IL-10, nor oncostatin M stimulated
the clonal growth of either the KS-1 or BC-1 cell lines (Table 3). Also, anti-IL-6 antibodies,
ATRA, -hCG, and -hCG (Table 3) did not suppress the clonal growth
of KS-1 and BC-1 cell lines. On the other hand, IFN- and IFN-
markedly inhibited clonal growth of KS-1 (Table 3). Effective dose
inhibiting 50% clonal growth [ED50] of KS-1 was 500 U/mL and 1,000 U/mL for IFN- and IFN- ,
respectively; and ED50 for BC-1 was 10,000 U/mL for IFN- . Growth of BC-1 was not affected by IFN- (Table 3).
Effects of IL-6 antisense oligonucleotides on clonal growth of PEL
cells.
Exposure to human IL-6 antisense oligonucleotides resulted in a
significant decrease in the clonal growth of the PEL cells with colony
formation nearly 100% inhibited by 10 µmol/L IL-6 antisense
oligonucleotides (Figs 3 and
4). IL-6 sense or scramble oligonucleotides
(10 µmol/L) did not inhibit clonal growth of PEL cells. When cells
(105/mL) were treated with IL-6 antisense oligonucleotides
for 3 days in suspension culture, IL-6 production was markedly
decreased in supernatants from the antisense-treated PEL cells.
Production of IL-6 in the sense and antisense oligonucleotides-treated
cultures was 200 pg/mL and 50 pg/mL, respectively in KS-1; 4,500 pg/mL and 750 pg/mL, respectively, in BC-1. The vIL-6 and IL-10 antisense oligonucleotides (10 µmol/L) had no effect on clonal growth of the
PEL cells (Fig 5 and Table 1). Furthermore,
the clonal growth of two
KSHV ,EBV , B-cell lymphoma lines
(EW36, DS179) was not inhibited by the IL-6 antisense oligonucleotides
(data not shown).

View larger version (19K):
[in this window]
[in a new window]
| Fig 3.
Effect of human IL-6 antisense oligonucleotides on clonal
growth of KSHV-infected lymphoma cell lines. The PEL cell lines (A),
KS-1; (B), BC-1, and the KSHV-negative lymphoma cell line (C), EW36
were cultured in soft agar with human IL-6 sense ( ), scramble (C-1)
( ), or antisense ( )phosphorotioated oligonucleotides at 1, 5, and
10 µmol/L. Results were expressed as a percentage of control cells
not exposed to oligonucleotides; results represent the mean ± SD of
three experiments done in triplicate. Results with another scramble
oligonucleotide (C-2, 10 µmol/L) showed similar results as the
C-1 scramble oligonucleotides.
|
|

View larger version (143K):
[in this window]
[in a new window]

View larger version (121K):
[in this window]
[in a new window]
| Fig 4.
Lymphoma colonies formed by the BC-1 cells treated with
either sense or antisense IL-6 oligonucleotides. Cells were plated at
5,000 cells/mL and cultured for 14 days with either IL-6 sense (10 µmol/L) (A) or IL-6 antisense oligonucleotides (10 µmol/L) (B).
Colony formation was almost completely inhibited in cultures containing
IL-6 antisense oligonucleotides.
|
|

View larger version (10K):
[in this window]
[in a new window]
| Fig 5.
Effect of viral IL-6 antisense oligonucleotides on clonal
growth of KSHV-infected lymphoma cell lines. The PEL cell lines (A)
KS-1 and (B) BC-1 were cultured in soft agar with either IL-6 sense
( ) or antisense ( ) phosphorotioated oligonucleotides at 1, 5, and
10 µmol/L. Results were expressed as a percentage of control cells
not exposed to oligonucleotides; results represent the mean ± standard deviation (SD) of three experiments done in triplicate.
|
|
 |
DISCUSSION |
We detected significant IL-6 production and IL-6R expression in the
KSHV-associated PEL cells; and the IL-6 antisense oligonucleotides decreased clonal growth of these PEL cells. IL-6 has been suggested to
be involved in three other KSHV-associated diseases,
KS,11 Castleman's disease,29 and multiple
myeloma.30 Studies have suggested that IL-6 is an
autocrine growth factor for AIDS-KS cells.11 Taken
together, these data suggest that IL-6 production may have an important
role in the pathogenesis of KSHV-associated diseases. In our studies,
even though IL-6 antisense oligonucleotides profoundly inhibited the
clonal proliferation of the PEL, exogenously added IL-6 did not enhance
and IL-6 antibodies did not inhibit clonal growth of the KSHV-infected
cells. These results suggest that the IL-6 stimulatory signal may be
transmitted via an intracellular interaction between IL-6 and its
receptor.31
Our previous data showed that TPA induced lytic viral production in
KS-1 cells, and Renne et al32 and Verbeek et
al33 have found that TPA-treatment also induced lytic viral
production in BC-1 cells. Our present data showed that TPA suppressed
human IL-6 production from the PEL cells. Therefore, activation of KSHV does not stimulate production of human IL-6 from the PEL cells.
Of particular interest is how IFN- and IFN- cause growth
inhibition of the PEL cells. These IFNs did not suppress production of
IL-6 by the PEL cells, and the inhibition of clonal growth of the PEL
cells caused by the IFNs could not be reversed by the addition of IL-6
(data not shown). Therefore, the growth inhibitory effect of IFNs does
not occur as a result of downregulation of IL-6 production by the PEL
cells.
The GM-CSF, IL-1 , TNF- , bFGF, and PDGF- cytokines are
expressed in KS, but were not detected in the PEL cells. Thus, these cytokines may not be closely associated with KSHV infection, and their
production in KS may be due to the KS phenotype. Furthermore, both ATRA
and hCGH have been reported to inhibit the growth of KS,34,35 but we found that these compounds did not suppress the growth of the PEL cells; again showing the difference in response of two different KSHV-associated malignancies.
The growth control of PEL cells appears to be different from that of
other AIDS-related lymphomas. Both IL-10 and IL-12, which have been
reported as autocrine growth factors for AIDS-related lymphomas,22,23 do not appear to be important for
the growth of the PEL cells. Also, expression of c-kit was
not detected in the PEL cells. This cytokine receptor is
usually expressed on CD30+, anaplastic large cell lymphomas
(ALCL).36 Some PEL cases expressed CD30 on their surface
and showed ALCL-like morphology.4 The expression of
c-kit may be a good marker to distinguish PEL from ALCL.
This and the study of Moore et al18 are several of the
initial reports describing the expression and regulation of
cytokines and their receptors associated with PEL. We provide evidence
that IL-6 is associated with the growth of PEL. The analysis of the level of IL-6 production using sera and effusions from individuals with
PEL may provide an indirect marker of extent of disease and/or prognosis. Moreover, our results indicate that IL-6 antisense oligonucleotides might be a new therapeutic approach for PEL. In vivo
experiments using the IL-6 antisense oligonucleotides are now ongoing
in our laboratory.
 |
FOOTNOTES |
Submitted May 12, 1997;
accepted November 16, 1997.
Supported in part by National Institutes of Health Grants No. UO1 CA
66533-02 and CA 42710, the Concern Foundation, and the Parker Hughes
Trust. H.P.K. is a member of the Jonsson Comprehensive Cancer Center
and holds the Mark Goodson Chair in Oncology Research. D.J.P. is
supported in part by the UCLA AIDS Institute grant (UCLA CFAR, NIAID,
NIH).
Address reprint requests to H. Phillip Koeffler, MD, Department of
Medicine, Division of Hematology/Oncology, Cedars-Sinai Medical
Center/UCLA School of Medicine, 8700 Beverly Blvd, B208, Los Angeles,
CA 90048.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.
 |
ACKNOWLEDGMENT |
We thank Dr Ethel Cesarman for providing us BC-1 and BC-2 cell lines,
Dr David Benjamin for very generously providing the EW36 and DS179 cell
lines, and Scholastica Park and Marge Goldberg for technical
assistance.
 |
REFERENCES |
1.
Chang Y,
Cesarman E,
Pessin MS,
Lee F,
Culpepper J,
Knowles DM,
Moore PS:
Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposi's sarcoma.
Science
266:1865,
1994[Abstract/Free Full Text]
2.
Moore PS,
Chang Y:
Detection of herpesvirus like DNA sequences in Kaposi's sarcoma in patients with and those without HIV infection.
N Engl J Med
332:1181,
1995[Abstract/Free Full Text]
3.
Cesarman E,
Chang Y,
Moore PS,
Said JW,
Knowles DM:
Kaposi's sarcoma-associated herpesvirus-like sequences in AIDS-related body-cavity-based lymphomas.
N Engl J Med
332:1186,
1995[Abstract/Free Full Text]
4.
Nador RG,
Cesarman E,
Chadburn A,
Dawson DB,
Ansari MQ,
Said J,
Knowles DM:
Primary effusion lymphoma: A distinct clinicopathologic entity associated with Kaposi's sarcoma-associated herpesvirus.
Blood
88:645,
1996[Abstract/Free Full Text]
5.
Moore PS,
Gao S-J,
Dominguez G,
Cesarman E,
Lungu O,
Knowles DM,
Garber R,
Pellett PE,
Mcgeoch DJ,
Chang Y:
Primary characterization of a herpesvirus agent associated with Kaposi's sacoma.
J Virol
70:549-558,
1996[Abstract]
6.
Knowels DM,
Inghirami G,
Ubriaco A,
Dalla-Favera R:
Molecular genetic analysis of three AIDS-associated neoplasms of uncertain lineage demonstrates their B-cell derivation and the possible pathogenetic role of the Epstein-Barr virus.
Blood
73:792,
1989[Abstract/Free Full Text]
7.
Walts AE,
Shintaku IP,
Said JW:
Diagnosis of malignant lymphoma in effusions from patients with AIDS by gene rearrangement.
Am J Clin Pathol
94:170,
1990[Medline]
[Order article via Infotrieve]
8.
Green I,
Espiritu E,
Ladanyi M,
Chaponda R,
Wieczorek R,
Gallo L,
Feiner H:
Primary lymphomatous effusions in AIDS: A morphological, immunophenotypic, and molecular study.
Mod Pathol
8:39,
1995[Medline]
[Order article via Infotrieve]
9.
Corbeil J,
Evans LA,
Vasak E,
Cooper DA,
Penny R:
Culture and properties of cells derived from Kaposi's sarcoma.
J Immunol
146:2972,
1991[Abstract]
10.
Ensoli B,
Nakamura S,
Salahuddin SZ,
Biberfeld PD,
Larsson L,
Bearer B,
Wong-Staal F,
Gallo RC:
AIDS-Kaposi's sarcoma-derived cells express cytokines with autocrine and paracrine growth effects.
Science
243:223,
1989[Abstract/Free Full Text]
11.
Miles SA,
Rezai AR,
Salazar-Gonzalez JF,
Meyden MV,
Stevens RH,
Logan D,
Mitsuyasu R,
Taga T,
Hirano T,
Kishimoto T,
Martinez-Maza OL:
AIDS Kaposi's sarcoma-derived cells produce and respond to interleukin 6.
Proc Natl Acad Sci USA
87:4068,
1990[Abstract/Free Full Text]
12.
Werner S,
Hofschneider P,
Roth WK:
Cells derived from sporadic and AIDS-related Kaposi's sarcoma reveal identical cytochemical and molecular properties in vitro.
Int J Cancer
43:1137,
1989[Medline]
[Order article via Infotrieve]
13.
Nair BC,
Devico AL,
Nakamura S,
Copeland TD,
Chen Y,
Patel A,
O'Neil T,
Oroszlan S,
Gallo RC,
Sarngadhoran MG:
Identification of major growth factor for AIDS-Kaposi's sarcoma cells as oncostatin M.
Science
255:1430,
1992[Abstract/Free Full Text]
14.
Miles SA,
Martinez-Maza O,
Rezai A,
Magpantay L,
Kishimoto T,
Nakamura S,
Radka S,
Linsley P:
Oncostatin M as a potent mitogen for AIDS-Kaposi's sarcoma-derived cells.
Science
255:1432,
1992[Abstract/Free Full Text]
15.
Basilico C,
Moscatelli D:
The FGF family of growth factors and oncogene.
Adv Cancer Res
59:115,
1992[Medline]
[Order article via Infotrieve]
16.
Sciacca FL,
Sturzl M,
Bussolino F,
Sironi M,
Brandstetter H,
Zietz C,
Zhou D,
Matteucci C,
Peri G,
Sozzani S,
Benelli R,
Arese M,
Albini A,
Colotta F,
Mantovani A:
Expression of adhesion molecules, platelet-activating factor, and chemokines by Kaposi's sarcoma cells.
J Immunol
153:4816,
1994[Abstract]
17.
Weiss R:
Human herpesvirus 8 in lymphoma and Kaposi's sarcoma: Now the virus can be propagated.
Nat Med
2:277,
1996[Medline]
[Order article via Infotrieve]
18.
Moore PS,
Boshoff C,
Weiss RA,
Chang Y:
Molecular mimicry of human cytokines and cytokine response pathway genes by KSHV.
Science
274:1739,
1996[Abstract/Free Full Text]
19.
Russo JJ,
Bohenzky RA,
Chien M-C,
Chen J,
Yan M,
Maddalena D,
Parry JP,
Peruzzi D,
Edelman IS,
Chang Y,
Moore PS:
Nucleotide sequence of the Kaposi sarcoma-associated herpes virus (HHV8).
Proc Natl Acad Sci USA
93:14862,
1996[Abstract/Free Full Text]
20.
Retting MB,
Ma M,
Pold M,
Schiller G,
Belson D,
Savage A,
Nishikubo C,
Fraser J,
Said JW,
Berenson JR:
KSHV infection of multiple myeloma bone marrow stroma.
Science
276:1851,
1997[Abstract/Free Full Text]
21.
Said JW,
Retting MB,
Heppner K,
Koeffler HP,
Asou H,
Vescio RA,
Schiller G,
Belson D,
Savage A,
Shintaku IP,
Pinkus G,
Pinkus J,
Schrage M,
Green E,
Berenson JR:
Localization of Kaposi's sarcoma associated herpes virus in bone marrow biopsy samples from patients with multiple myeloma.
Blood
90:4278,
1997[Abstract/Free Full Text]
22.
Benjamin D,
Knobloch TJ,
Dayton MA:
Human B-cell interleukin-10: B- cell lines derived from patients with acquired immunodeficiency syndrome and Burkitt's lymphoma constitutively secrete large quantities of interleukin-10.
Blood
80:1289,
1992[Abstract/Free Full Text]
23.
Benjamin D,
Sharma V,
Kubin M,
Klein JL,
Sartori A,
Holliday J,
Trinchieri G:
IL-12 expression in AIDS-related lymphoma B cell lines.
J Immunol
156:1626,
1996[Abstract]
24.
Said JW,
Chien K,
Takeuchi S,
Tasaka T,
Asou H,
Cho SK,
de Vos S,
Cesarman E,
Knowles DM,
Koeffler HP:
1996. Kaposi's sarcoma-associated herpesvirus (KSHV or HHV8) in primary effusion lymphoma: Ultrastractural demonstration of herpesvirus in lymphoma cells.
Blood
87:4937,
1996[Abstract/Free Full Text]
25.
Cesarman E,
Moore PS,
Rao PH,
Inghirami G,
Knowles DM,
Chang Y:
In vitro establishment and characterization of two acquired immunodeficiency syndrome-related lymphoma cell lines (BC-1 and BC-2) containing Kaposi's sarcoma-associated herpesvirus-like (KSHV) DNA sequences.
Blood
86:2708,
1995[Abstract/Free Full Text]
26.
Douer D,
Koeffler HP:
Retinoic acid-inhibition of clonal growth of human myeloid leukemia cells.
J Clin Invest
69:277,
1982
27.
Zhang W,
Grasso L,
McClain CD,
Gambel AM,
Cha Y,
Travali S,
Deisseroth AN,
Mercer WP:
p53-independent induction of WAF/CIP1 in human leukemia cells is correlated with growth arrest accompanying monocyte-macrophage differentiation.
Cancer Res
55:668,
1995[Abstract/Free Full Text]
28.
Masood R,
Zhang Y,
Bond MW,
Scadden DT,
Moudgi T,
Law RE,
Kaplan MH,
Jung B,
Espinia BM,
Lunardi-Iskandar Y,
Levine AM,
Gill PS:
Interleukin-10 is an autocrine growth factor for acquired immunodeficiency syndrome-related B-cell lymphoma.
Blood
85:3423,
1995[Abstract/Free Full Text]
29.
Soulier J,
Grollet L,
Oksenhendler E,
Cacoub P,
Cazals-Hatem D,
Babinet P,
d'Agay MF,
Clauvel JP,
Raphael M,
Degos L,
Sigaux F:
Kaposi's sarcoma-associated herpesvirus-like DNA sequences in multicentric Castleman's disease.
Blood
86:1276,
1995[Abstract/Free Full Text]
30.
Kawano M,
Hirano T,
Matsuda T,
Taga T,
Horii Y,
Iwato K,
Asaoku H,
Tang B,
Tanabe O,
Tanaka H,
Kuramoto A,
Kishimoto T:
Autocrine generation requirement of BSF-2/IL-6 for human multiple myelomas.
Nature
332:83,
1988[Medline]
[Order article via Infotrieve]
31.
Levy Y,
Tsapis A,
Brouet JC:
1991. Interleukin-6 antisense oligonucleotides inhibit the growth of human myeloma cell lines.
J Clin Invest
88:696,
1991
32.
Renne R,
Zhong W,
Herndier B,
McGrath M,
Abbey N,
Kedes D,
Ganem D:
Lytic growth of Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) in culture.
Nat Med
2:342,
1996[Medline]
[Order article via Infotrieve]
33. Verbeek W, Miles SA, Koeffler HP: Seroprevalence of KSHV
antibodies in homosexual, HIV-positive men without Kaposi's sarcoma
and their clinical follow up. (unpublished data)
34.
Guo W-X,
Gill PS,
Antakly T:
Inhibition of AIDS-Kaposi's sarcoma cell proliferation following retinoic acid receptor activation.
Cancer Res
55:823,
1995[Abstract/Free Full Text]
35.
Lunardi-Iskandar Y,
Bryant JL,
Zeman RA,
Lam VH,
Samaniego F,
Besnier JM,
Hermans P,
Thierry AR,
Gill P,
Gallo RC:
Tumorigenesis and metastasis of neoplastic Kaposi's sarcoma cell line in immunodeficient mice blocked by a human pregnancy hormone.
Nature
375:64,
1995[Medline]
[Order article via Infotrieve]
36.
Pinto A,
Gloghini A,
Gattei V,
Aldinucci D,
Zagonel V,
Carbone A:
Expression of the c-kit receptor in human lymphomas is restricted to Hodgkin's diseases and CD30+ anaplastic large cell lymphomas.
Blood
83:785,
1994[Abstract/Free Full Text]

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
H. R. Hensler, G. Rappocciolo, C. R. Rinaldo, and F. J. Jenkins
Cytokine production by human herpesvirus 8-infected dendritic cells
J. Gen. Virol.,
January 1, 2009;
90(1):
79 - 83.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Gasperini, S. Sakakibara, and G. Tosato
Contribution of viral and cellular cytokines to Kaposi's sarcoma-associated herpesvirus pathogenesis
J. Leukoc. Biol.,
October 1, 2008;
84(4):
994 - 1000.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-J. Zhang, R. S. Bonaparte, D. Patel, D. A. Stein, and P. L. Iversen
Blockade of viral interleukin-6 expression of Kaposi's sarcoma-associated herpesvirus
Mol. Cancer Ther.,
March 1, 2008;
7(3):
712 - 720.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S.-H. Sin, D. Roy, L. Wang, M. R. Staudt, F. D. Fakhari, D. D. Patel, D. Henry, W. J. Harrington Jr, B. A. Damania, and D. P. Dittmer
Rapamycin is efficacious against primary effusion lymphoma (PEL) cell lines in vivo by inhibiting autocrine signaling
Blood,
March 1, 2007;
109(5):
2165 - 2173.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. M. Brinkmann, M. Pietrek, O. Dittrich-Breiholz, M. Kracht, and T. F. Schulz
Modulation of Host Gene Expression by the K15 Protein of Kaposi's Sarcoma-Associated Herpesvirus
J. Virol.,
January 1, 2007;
81(1):
42 - 58.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. T. Perry and T. Compton
Kaposi's Sarcoma-Associated Herpesvirus Virions Inhibit Interferon Responses Induced by Envelope Glycoprotein gpK8.1
J. Virol.,
November 15, 2006;
80(22):
11105 - 11114.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Arguello, S. Paz, E. Hernandez, C. Corriveau-Bourque, L. M. Fawaz, J. Hiscott, and R. Lin
Leukotriene A4 Hydrolase Expression in PEL Cells Is Regulated at the Transcriptional Level and Leads to Increased Leukotriene B4 Production.
J. Immunol.,
June 1, 2006;
176(11):
7051 - 7061.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Xie, H. Pan, S. Yoo, and S.-J. Gao
Kaposi's Sarcoma-Associated Herpesvirus Induction of AP-1 and Interleukin 6 during Primary Infection Mediated by Multiple Mitogen-Activated Protein Kinase Pathways
J. Virol.,
December 15, 2005;
79(24):
15027 - 15037.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. M. Akula, P. W. Ford, A. G. Whitman, K. E. Hamden, B. A. Bryan, P. P. Cook, and J. A. McCubrey
B-Raf-dependent expression of vascular endothelial growth factor-A in Kaposi sarcoma-associated herpesvirus-infected human B cells
Blood,
June 1, 2005;
105(11):
4516 - 4522.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. McCormick and D. Ganem
The Kaposin B Protein of KSHV Activates the p38/MK2 Pathway and Stabilizes Cytokine mRNAs
Science,
February 4, 2005;
307(5710):
739 - 741.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Glaunsinger and D. Ganem
Highly Selective Escape from KSHV-mediated Host mRNA Shutoff and Its Implications for Viral Pathogenesis
J. Exp. Med.,
August 2, 2004;
200(3):
391 - 398.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. An, Y. Sun, and M. B. Rettig
Transcriptional coactivation of c-Jun by the KSHV-encoded LANA
Blood,
January 1, 2004;
103(1):
222 - 228.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Duplomb, B. Chaigne-Delalande, P. Vusio, S. Raher, Y. Jacques, A. Godard, and F. Blanchard
Soluble Mannose 6-Phosphate/Insulin-Like Growth Factor II (IGF-II) Receptor Inhibits Interleukin-6-Type Cytokine-Dependent Proliferation by Neutralization of IGF-II
Endocrinology,
December 1, 2003;
144(12):
5381 - 5389.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
U. Klein, A. Gloghini, G. Gaidano, A. Chadburn, E. Cesarman, R. Dalla-Favera, and A. Carbone
Gene expression profile analysis of AIDS-related primary effusion lymphoma (PEL) suggests a plasmablastic derivation and identifies PEL-specific transcripts
Blood,
May 15, 2003;
101(10):
4115 - 4121.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Cannon, N. J. Philpott, and E. Cesarman
The Kaposi's Sarcoma-Associated Herpesvirus G Protein-Coupled Receptor Has Broad Signaling Effects in Primary Effusion Lymphoma Cells
J. Virol.,
December 6, 2002;
77(1):
57 - 67.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Deng, J. T. Chu, M. B. Rettig, O. Martinez-Maza, and R. Sun
Rta of the human herpesvirus 8/Kaposi sarcoma-associated herpesvirus up-regulates human interleukin-6 gene expression
Blood,
August 13, 2002;
100(5):
1919 - 1921.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Li and J. Nicholas
Identification of Amino Acid Residues of gp130 Signal Transducer and gp80 {alpha} Receptor Subunit That Are Involved in Ligand Binding and Signaling by Human Herpesvirus 8-Encoded Interleukin-6
J. Virol.,
May 3, 2002;
76(11):
5627 - 5636.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Gwack, S. Hwang, C. Lim, Y. S. Won, C. H. Lee, and J. Choe
Kaposi's Sarcoma-associated Herpesvirus Open Reading Frame 50 Stimulates the Transcriptional Activity of STAT3
J. Biol. Chem.,
February 15, 2002;
277(8):
6438 - 6442.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. An, A. K. Lichtenstein, G. Brent, and M. B. Rettig
The Kaposi sarcoma-associated herpesvirus (KSHV) induces cellular interleukin 6 expression: role of the KSHV latency-associated nuclear antigen and the AP1 response element
Blood,
January 15, 2002;
99(2):
649 - 654.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Liu, Y. Okruzhnov, H. Li, and J. Nicholas
Human Herpesvirus 8 (HHV-8)-Encoded Cytokines Induce Expression of and Autocrine Signaling by Vascular Endothelial Growth Factor (VEGF) in HHV-8-Infected Primary-Effusion Lymphoma Cell Lines and Mediate VEGF-Independent Antiapoptotic Effects
J. Virol.,
November 15, 2001;
75(22):
10933 - 10940.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. L. Perez and S. Rudoy
Anti-CD20 Monoclonal Antibody Treatment of Human Herpesvirus 8-Associated, Body Cavity-Based Lymphoma with an Unusual Phenotype in a Human Immunodeficiency Virus-Negative Patient
Clin. Vaccine Immunol.,
September 1, 2001;
8(5):
993 - 996.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Li, H. Wang, and J. Nicholas
Detection of Direct Binding of Human Herpesvirus 8-Encoded Interleukin-6 (vIL-6) to both gp130 and IL-6 Receptor (IL-6R) and Identification of Amino Acid Residues of vIL-6 Important for IL-6R-Dependent and -Independent Signaling
J. Virol.,
April 1, 2001;
75(7):
3325 - 3334.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
J Nicholas
Evolutionary aspects of oncogenic herpesviruses
Mol. Pathol.,
October 1, 2000;
53(5):
222 - 237.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
Y. Aoki, R. Yarchoan, J. Braun, A. Iwamoto, and G. Tosato
Viral and cellular cytokines in AIDS-related malignant lymphomatous effusions
Blood,
August 15, 2000;
96(4):
1599 - 1601.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Pica, A. Volpi, A. Serafino, M. Fraschetti, O. Franzese, and E. Garaci
Autocrine nerve growth factor is essential for cell survival and viral maturation in HHV-8-infected primary effusion lymphoma cells
Blood,
May 1, 2000;
95(9):
2905 - 2912.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. D. Jones, Y. Aoki, Y. Chang, P. S. Moore, R. Yarchoan, and G. Tosato
Involvement of Interleukin-10 (IL-10) and Viral IL-6 in the Spontaneous Growth of Kaposi's Sarcoma Herpesvirus-Associated Infected Primary Effusion Lymphoma Cells
Blood,
October 15, 1999;
94(8):
2871 - 2879.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Wan, H. Wang, and J. Nicholas
Human Herpesvirus 8 Interleukin-6 (vIL-6) Signals through gp130 but Has Structural and Receptor-Binding Properties Distinct from Those of Human IL-6
J. Virol.,
October 1, 1999;
73(10):
8268 - 8278.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Aoki, E. S. Jaffe, Y. Chang, K. Jones, J. Teruya-Feldstein, P. S. Moore, and G. Tosato
Angiogenesis and Hematopoiesis Induced by Kaposi's Sarcoma-Associated Herpesvirus-Encoded Interleukin-6
Blood,
June 15, 1999;
93(12):
4034 - 4043.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|