|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 91 No. 8 (April 15), 1998:
pp. 2753-2759
The SH2-Containing Inositol Polyphosphate 5-Phosphatase, Ship, Is
Expressed During Hematopoiesis and Spermatogenesis
By
Qiurong Liu,
Fouad Shalaby,
Jamie Jones,
Denis Bouchard, and
Daniel J. Dumont
From the Amgen Institute, Toronto, Ontario, Canada; Samuel Lunenfeld
Research Institute, Mount Sinai Hospital, Toronto, Ontario, Canada; and
the Department of Medical Biophysics, University of Toronto, Toronto,
Ontario, Canada.
 |
ABSTRACT |
Ship is a recently identified SH2-containing inositol
polyphosphate 5-phosphatase that has been implicated as an important signaling molecule in cell-culture systems. To understand the physiologic function of Ship in vivo, we performed expression studies
of Ship during mouse development. Results of this study demonstrate the
expression of ship to be in late primitive-streak stage embryos
(7.5 days postcoitus [dpc]), when hematopoiesis is thought to begin,
and the expression is restricted to the hematopoietic lineage in mouse
embryo. In adult mice, Ship expression continues to be in the majority
of cells from hematopoietic origin, including granulocytes, monocytes,
and lymphocytes, and is also found in the spermatids of the testis.
Furthermore, the level of Ship expression is developmentally regulated
during T-cell maturation. These results suggest a possible role for
Ship in the differentiation and maintenance of the hematopoietic
lineages and in spermatogenesis.
| |
INTRODUCTION |
A HALLMARK OF EARLY hematopoiesis in the
mouse embryo is the appearance of primitive nucleated erythroid cells
in the extraembryonic yolk sac mesoderm during late primitive-streak
stage (7.5 to 8.5 days postcoitus [dpc]). This event occurs in blood
islands, which are aggregations of mesenchymal cells in the yolk sac.
Within each blood island, the central cells separate from those at the periphery to form two distinctive populations of cells: hematopoietic stem cells and endothelial cells. It is believed that both arise from a
common mesoderm precursor known as the hemangioblast.1,2 In
an attempt to gain insight into the molecular events of early hematopoiesis, we have isolated Ship, a gene expressed in
5-fluorouracil (5FU)-treated bone marrow.3
ship encodes an inositol polyphosphate 5-phosphatase that
hydrolyzes phosphotidylinositol(3,4,5) polyphosphate
[PtdIns(3,4,5)P3] and inositol(1,3,4,5)polyphosphate
(IP4).4,5 PtdIns(3,4,5)P3 is the
major product of PI3 kinase and is a common second messenger in
delivering signals from multiple surface receptors. Recently, Ship has
been shown to reduce the level of PtdIns(3,4,5)P3 and inhibit biologic effects induced by PI 3 kinase activation in Xenopus oocytes.6 IP 4 is another in vitro
substrate identified for Ship. It has been proposed that IP 4 activates calcium influx through the cytoplasmic
membrane7 and that recruitment of Ship to the
membrane could account for the reported inhibition of calcium entry
during negative signaling.8,9
In addition to the enzymatic inositol 5-phosphatase domain in the
central portion of the protein, Ship contains an SH2 domain at the
N-terminal end, three putative SH3-interacting motifs, and two
potential PTB domain-binding sites (NPXY) at the C-terminal to the
inositol phosphatase region. The SH2 domain was shown to be essential
for the tyrosine phosphorylation of Ship.10 It is likely
that this phosphorylation occurs when Ship binds to a tyrosine
kinase11 or to proteins that can bring it to a tyrosine kinase. The NPXY motifs of Ship were shown to be essential for the
association with Shc during T-cell receptor signaling.12 Indeed, Ship was first identified as a Shc-associated
tyrosine-phosphorylated protein in cells of hematopoietic origin,
following cytokine stimulation,13,14 and Shc association
with a 140-kD protein, most likely Ship, was often detected in leukemic
cell lines.15,16 Since Shc is a mediator of signal
transduction from growth factor receptors to the Ras
pathway,17 Ship's involvement in Ras signaling
has been a target for investigation. Taken together, the data indicate Ship may be an important signaling molecule that can be engaged in
diversified pathways.
To gain insight into the possible function of Ship, we investigated its
expression during mouse development. Here, we report the expression of
ship to be within the hematopoietic lineage and spermatids.
Furthermore, we show that this expression is first detected at the
onset of hematopoietic differentiation during mouse development.
| |
MATERIALS AND METHODS |
Reagents.
Rabbit antihuman von Willebrand factor antibody was from
DAKO (Carpinteria, CA) and was shown to react with mouse
von Willebrand factor specifically. The immunohistochemical staining,
peroxidase substrates, and biotin/avidin blocking kit were from
Vector Laboratories (Burlingame, CA). Poly(A+) RNA blots
were from Clontech (Palo Alto, CA). All other reagents were purchased
from Fisher Scientific (Pittsburgh, PA) unless otherwise indicated.
The following antibodies were used in flow cytometry: FcBlock (2.4G2),
phycoerythrin (PE)-conjugated anti-  TCR (H57-597), PE-conjugated
anti-B220 (RA3-6B2), PE-conjugated anti-CD4 (L3T4), biotinylated
anti-IgD (11-26C-2a), biotinylated anti-IgM (R6-60.2), and biotinylated
anti-CD8 (53-6.7) (all from PharMingen, San Diego, CA). Biotinylated
antibodies were visualized using Streptavidin-Red670 (Gibco/BRL).
Fluorescein isothiocyanate (FITC)-conjugated goat antirabbit IgG
(Jackson ImmunoResearch Laboratories, West Grove, PA) was
used to label rabbit anti-Ship antibody in all of the flow cytometry
assays.
Northern, RNA in situ hybridization, and reverse-transcriptase
polymerase chain reaction analysis.
A 1.5-kb DNA fragment corresponding to the 3 -end and a 1.3-kb fragment
from the 5-end of the ship cDNA were independently random
prime-labeled and hybridized to a poly(A) RNA blot (Clontech) in 50%
formamide solution that contained 4X SSPE, 1% sodium
dodecyl sulfate (SDS), 0.5% blotto, and 10% dextran sulfate at 42°C
overnight. The blot was washed twice with 0.1× SSC and 0.1% SDS at
55°C for 15 minutes each and autoradiographed.
Embryos at different stages of mouse development were isolated, fixed
overnight in 4% paraformaldehyde, dehydrated with ethanol and xylene,
processed for paraffin embedding, sectioned at 6 µm, and mounted on
3-amino-propyltriethoxysilane-treated slides (Sigma, St Louis,
MO). After removal of paraffin, the sections were
predigested with protease K (Boehringer Mannheim, Mannheim, Germany),
acetylated with acetic anhydride, dehydrated, and hybridized as
described by Frohman et al,18 except that base hydrolysis
of the probe was omitted. Antisense 35S-labeled riboprobe
was synthesized following Xho I digestion of a partial Ship
cDNA clone, pE41, which contains sequences 1 to 1342 of the gene. Sense
probe was made from pE41 plasmid digested with Not I.
For reverse-transcriptase polymerase chain reaction (RT-PCR),
Trizol (Life Technologies Inc, Gaithersburg, MD)
was used to extract total RNA from embryos. These embryos were
genotyped by Southern blot analysis of DNA prepared from cone and
trophoblast cells cultured in embryonic stem (ES) cell
medium without leukemia inhibitory factor (LIF) for 10 to 14 days to
ensure the loss of maternal cells.19 Five micrograms of RNA
was reverse-transcribed using Superscript reverse transcriptase (BRL)
in 20-µL reactions. PCR was then performed using 0.5 µL of the cDNA
and the following primers: 5-CAGAATCTACCAACAGGCGTT-3 of Ship
sequence 987 to 1007 and 5-GAGAAACCAGGACGTGATCTT-3 of complementary
Ship sequence 1408 to 1388 to yield a product of 421 bp.
Primers for Flt1 selected were Flt1A TGTGGAGAAACTTGGTGACCT,
and Flt1BTGGAGAACAGCAGGACTCCTT, to yield a fragment
of 504 bp.
Antibody production and immunohistochemistry.
DNA sequences coding for the region between the SH2 domain and the
inositol phosphatase homologous sequences of Ship (nucleotide 827 to 1350) were released from plasmid pE41 by SacI and
NotI digestion and subcloned into a glutathione S-transferase
(GST) expression vector. GST fusion protein was expressed in
Escherichia coli and recovered from cell lysate with
glutathione-agarose beads.20 Antiserum against mouse Ship
was generated by immunizing rabbits with purified GST fusion protein.
Specific antibody from rabbit serum was affinity-purified by passing
through a GST-conjugated Sepharose-4B column followed by adsorption to
the antigen-conjugated Sepharose. Antibody was eluted from the column
using 100 mmol/L glycine pH 2.5 and dialyzed against 1×
phosphate-buffered saline (PBS) at 4°C overnight. The antibody was
aliquotted and stored at  70°C in 1% bovine serum albumin (BSA)
and 0.1% NaN3.
Mouse embryos of different stages were isolated and fixed in
Histochoice MB solution (Amresco, Solar, OH) for 4 hours, soaked in
30% sucrose overnight, embedded in O.C.T. compount
(tissue talc; Miles, Elkhart, IN), and sectioned at 8 µm with a Jung
CM3000 cryostat (Leica, Heerbrugg, Switzerland). The frozen sections were mounted on superfrost/plus microscope slides,
air-dried, and fix-permeabilized in 50% methanol/acetone at 20°C
for 10 minutes. All slides were stored at 70°C until use.
The sections were brought to room temperature in a sealed box, rinsed
twice in PBS, and immunostained with Vectastain Elite ABC kit
(Vector Laboratories) as per the manufacturer's protocol. After
immunostaining, the slides were rinsed twice with tap water and
counterstained with Harris' hematoxylin (BDH, Dorset, UK) for 1 minute, rinsed with running water for 30 seconds, dehydrated, and
mounted with cover glass.
Flow cytometry.
Spleen, thymus, and bone marrow cells were prepared according to
standard procedures.21 A total of 106 cells
were incubated in staining buffer (PBS, 1% fetal bovine serum, and
0.1% NaN3) with saturating amounts of antibodies against lineage-specific surface antigens at 4°C for 30 minutes. Cells were
then fixed and permeabilized with FIX and PERM solutions as per the
manufacturer's instructions (CALTAG, South San Francisco, CA). To detect Ship expression, 0.2 µg of anti-Ship
antibody was included in the permeabilization step, followed by
incubation with 0.5 µg FITC-conjugated antirabbit IgG in 100 µL PBS
at room temperature for 15 minutes. The cells were thoroughly washed
with PBS and analyzed using a FACSCalibur flow cytometer and
CELLQuest software (Becton Dickinson, Mountain View, CA).
Windows for the analysis of lymphocytes, granulocytes, and monocytes
were set using forward and side scatter on the CELLQuest software
(Becton Dickinson).
| |
RESULTS |
Ship is expressed in the hematopoietic lineages and in the adult
testis.
To determine the pattern of ship expression, we first
performed Northern analysis on poly(A+) RNA from various adult mouse tissues. A single 5.0-kb transcript was detected in all the tissues analyzed. However, the level of ship expression was different among the tissues. The highest levels were found in spleen, lung, and
testis, and the lowest in the liver (Fig
1). This variation suggested cell-type
specificity of ship expression. To localize ship
expression to specific cell types during development, RNA in situ
hybridization was performed on embryo sections from different stages of
mouse development. No hybridization was detected in any organs in the
sagittal sections of 12.5- to 15.5-dpc embryos, except for punctated
signals within the developing liver (data not shown). Since definitive
hematopoiesis begins in the embryonic mouse liver at approximately 12 dpc,22 and these early hematopoietic cells appear
intermingled with hepatocytes, the RNA in situ hybridization results
raised the possibility that ship is expressed in hematopoietic cells in the developing liver.
View larger version (54K):
[in this window]
[in a new window]
| Fig 1.
Northern analysis: 2 µg poly(A+) RNA from
various adult mouse tissues was loaded in each lane. A 1.3-kb fragment
from the 5 end of ship cDNA was used as probe. The membrane
was reprobed with mouse actin probe to measure the amount of RNA in
each lane. The same result was obtained with a 1.5-kb probe from the
3-end of the ship cDNA clone.
|
|
To determine further the cell types that express ship,
immunohistochemical staining was performed on sagittal sections of mouse embryos. Consistent with the RNA in situ hybridization result, immunohistochemical staining detected ship expression only
in the liver and occasional single cells under the skin. Normally, hematopoietic cells can be distinguished from other mesenchymal cells
in the liver by the distinct shape of their nuclei and their irregular
sizes. Close examination of the ship-expressing cells in the
liver indicate that they are hematopoietic cells. Megakaryocytes can
undergo as many as seven duplications of the nuclei and cytoplasmic constituents without cell division. As a result, they appear as distinctively giant cells with large, irregular, multilobular nuclei
(Fig 2a and b, cells labeled "M").
When compared with the section stained with antibody against von
Willebrand factor (Fig 2a), a protein synthesized by megakaryocytes and
endothelial cells, it was evident that ship was expressed in
megakaryocytes and not in endothelial cells (Fig 2b). Furthermore,
Ship-positive staining could be found in monocyte-macrophages,
identified by their intermediate cell size and cashew nut-shaped nuclei
(Fig 2b and c, arrowheads), and in granulocytes, specified by their
small sizes and horseshoe or sometimes ring-shaped nuclei (Fig 2b and
c, arrows); the ship-expressing cells found scattered under
the skin are mast cells identified by their extensive cytoplasm packed
with large granules (data not shown). Staining on 10.5-dpc embryo
sections showed ship expression in the large nucleated
erythroblasts (Fig 2d). The hematopoietic identity of the
ship-expressing cells was substantiated by coexpression of
ship with CD43, a surface marker expressed by most
hematopoietic stem cells,23 through fluorescence
coimmunostaining (data not shown).
View larger version (125K):
[in this window]
[in a new window]
| Fig 2.
Immunohistochemical staining of sections across the liver
from a 15.5-dpc mouse embryo. (a) Section stained with anti-von Willebrand factor antibody. Cells expressing von Willebrand factor are
visualized by a brown color. En, endothelial cells; M, megakaryocyte. (b) Sections stained with anti-Ship antibody. Representative
Ship-expressing cells with distinctive morphology of granulocyte or
monocyte/macrophage are denoted by arrows and arrowheads, respectively.
(c) Section as in panel b under higher magnification. (d) Section
across yolk sac of a 10.5-dpc mouse embryo stained with anti-Ship
antibody. The large round cells with big nuclei are nucleated
erythroblasts. Original magnifications: ×200 for a and b; ×400 for
c and d.
|
|
Although restriction of ship expression to hematopoietic
cells could explain the abundance of ship message in adult
spleena lymphoid organ in adult lifethe high levels of
ship transcript in the lung and testis needed to be
addressed. Immunohistochemical staining on sections from carefully
washed adult lung showed no significant positive staining (data not
shown). However, positive signals were detected in the seminiferous
tubules of testes (Fig 3). In the active
seminiferous tubules, spermatogonia (Fig 3b, labeled "S"), the
germ cells characterized by large round nuclei with condensed
chromatin, are found in the basal layer of the seminiferous epithelium.
Also near the basal layer are Sertoli cells (Fig 3b, labeled
"St"), which are identified by their triangular nuclei, dispersed
chromatin, and extensive cytoplasm. As spermatogonia go through
meiosis, newly derived spermatids (Fig 3b, arrows) settle next to
spermatogonia, away from the basal layer. Mature spermatozoa develop
from spermatids and locate themselves close to the lumen of
seminiferous tubules, with their tails floating inside the
lumen.22 Immunohistochemical and fluorescence staining with
anti-Ship antibody clearly demonstrated ship expression in spermatids, but not in spermatogonia or Sertoli cells (Fig 3). Moreover, Ship is predominantly localized to the membrane of spermatids (Fig 3c).
View larger version (94K):
[in this window]
[in a new window]
| Fig 3.
Immunohistochemical staining with anti-Ship antibody on
sections across adult testis. (a) Cross section of a seminiferous tubule shows positive staining within the tubule. (b) Cross section of
a seminiferous tubule photographed under higher magnification with
basal layer of the tubule on the right, lumen on the left. S,
spermatogonia; St, Sertoli cells; arrows point to spermatids. (c)
Indirect fluorescence staining with anti-Ship antibody on adjacent
section of panel a. ship expression is visualized by the green
fluorescence in spermatids. Original magnifications: ×200 for a and
c; ×400 for b.
|
|
Ship is expressed at the beginning of hematopoiesis.
During late embryonic development, the fetal liver is the center of
definitive hematopoiesis,22 and primitive hematopoiesis initiates from blood islands in the yolk sac at a much earlier stage
(at ~7.5 dpc) during development.1 To determine if
ship expression coincides with the onset of hematopoietic
development, we performed RT-PCR on RNAs isolated from 7.5-dpc and
8.5-dpc embryos of wild-type and flk-1 mutant mice.
flk-1 codes for a tyrosine kinase receptor that is
specifically expressed in early hematopoietic and endothelial cells.
Mice that carry a null mutation of the flk-1 gene die at
8.5-dpc due to the lack of hematopoietic and endothelial
cells.19 RT-PCR analysis on RNA isolated from 7.5-dpc and
8.5-dpc flk-1-deficient embryos showed no expression of
ship, whereas ship was expressed in wild-type and
heterozygous embryo littermates at both stages (Fig
4 and data not shown). These results
demonstrate that ship is expressed at the earliest time of
hematopoietic development and that its expression is restricted to
hematopoietic and/or endothelial cells at the stage of
development.
View larger version (44K):
[in this window]
[in a new window]
| Fig 4.
RT-PCR analysis on RNA isolated from 7.5-dpc embryos of
wild-type (+/+), heterozygote (+/), and homozygote (/)
flk-1 mutant mice. RT-PCR on flt-1 was included as an
internal control for the quality of RNA preparation. RT+ and RT,
with or without reverse transcriptase in reverse transcription.
|
|
The level of ship expression is developmentally regulated during
T-cell maturation.
As we have shown, ship is expressed at the onset of
hematopoiesis (7.5 dpc) and this expression is maintained within a
variety of hematopoietic lineages in fetal liver. To investigate a
possible role for Ship during hematopoietic cell development in adults, permeabilized bone marrow cells were labeled with FITC-conjugated antirabbit antibody in the presence or absence of rabbit anti-Ship antibody, and the expression in various subpopulations of hematopoietic cells was determined by the intensity of fluorescence staining in the
gated cell population. Essentially all cells in the lymphocyte lineage,
cells in the myeloid lineage (mostly granulocytes, as in Fig
5), and cells in the size group of early
hematopoietic progenitor cells and monocytes (monocyte in Fig 5) showed
significantly increased intensity of fluorescence labeling in the
presence of anti-Ship antibody, which indicates that ship is
expressed in these cells.
View larger version (33K):
[in this window]
[in a new window]
| Fig 5.
Flow-cytometric analysis on single-cell populations from
bone marrow of 6-week-old female mice. Cell populations were gated according to cell-size distribution and are indicated on the top of
each plot. Histograms in each plot represent the fluorescence intensity
of cells treated with (filled area) or without (solid line) anti-Ship
antibody. Each plot is representative of 3 independent experiments.
|
|
Lymphocytes consist of B-cell and T-cell populations. It is known that
T cells go through three distinct stages during thymic
development, defined by expression of the CD4 and CD8 surface markers.
These are, in order of increasing maturity,
CD4 CD8 double-negative (DN),
CD4+CD8+ double-positive (DP), and
CD4+ or CD8+ single-positive (SP). During this
process, the level of T-cell receptor ( TCR) expression
also increases.24 Therefore, mature T cells can be labeled
as SP cells or TCRhi cells. On the other hand, the
process of B-cell maturation is defined by expression of surface
molecules to be B220+IgM premature,
IgMhiIgD immature, and
IgMloIgD+ mature cells.25 Flow
cytometry analysis on thymocytes labeled with different colored
anti-Ship and anti- TCR antibodies showed higher Ship-labeled
fluorescence intensity in TCRhi mature T cells than in
TCRlo immature T cells (Fig
6B). No difference in the fluorescence intensity was detected among T cells of these two gated populations when thymocytes were stained for Cbl (Fig 6A) or Shc (data not shown),
proteins known to be expressed constitutively in these cells. With the
use of three-color labeling, we were able to gate the CD4+,
CD8+ and the DP (CD4+CD8+) cells
and compare the relative Ship-labeled fluorescence intensity among
these three subpopulations of the thymocytes. As shown in Fig 6C, the
peak of Ship fluorescence intensity for CD4+ cells overlaps
with that of CD8+ cells and is at a value higher than that
for DP cells. This result substantiated our previous observation on the
two-color staining, to show that the level of ship
expression in mature T cells is higher than in immature T cells. No
obvious difference in the level of Ship expression was detected in
B220+IgM,
IgMhiIgD, and
IgMloIgD+ cells in the bone marrow (data not
shown).
View larger version (34K):
[in this window]
[in a new window]
| Fig 6.
Flow cytometric analysis on adult lymphocytes. (A)
PE-anti-TCR and FITC-anti-Cbl double staining on lymphocyte. (B)
PE-anti-TCR and FITC-anti-Ship double staining on lymphocytes.
The TCRhi and TCRlo populations are
gated (indicated in the upper panel as TCRhi and
TCRlo), and FITC fluorescence intensity among the gated
cell populations are compared by overlay histogram (lower panel). (C)
FITC-anti-Ship, PE-anti-CD4, Texas red-anti-CD8 triple-color staining
on lymphocytes. CD4+, CD8+, and DP cells
are gated as indicated in the upper panel. FITC fluorescence intensity
in the gated cell populations, which correspond to the levels of
ship expression, is compared in an overlay histogram (lower
panel). SP in the lower histogram of panel C represents both
CD4+ (solid line) and CD8+ (filled area)
cells. Each plot is representative of 5 independent experiments.
|
|
| |
DISCUSSION |
In this study, we have investigated the expression of ship
during mouse development by Northern analysis, RNA in situ
hybridization, immunohistochemistry, and flow cytometry. We have shown
the following: (1) ship expression during early development
is only detected at sites of hematopoiesis, such as the yolk sac and
the liver of mouse embryos; (2) ship expression is detected
in hematopoietic cells, such as megakaryocytes, myeloid cells,
monocyte/macrophages, tissue basophils (mast cells), and nucleated
erythroblasts; (3) through the use of flk-1 null mutant
mouse embryos, we have demonstrated that ship is not expressed
in embryos that do not form hematopoietic and endothelial cells, which
suggests ship's expression in one or both of these
lineages; and (4) the expression of ship is not detected in
endothelial cells by immunohistochemical staining (Fig 2b and d), nor
is it detected in endothelial cell lines (data not shown). Taken
together, these results demonstrate Ship expression to be exclusively
in the hematopoietic lineages during embryonic mouse development.
Furthermore, the expression of Ship in 7.5-dpc embryos suggests that
ship is expressed in the presumed common precursor of
endothelial and hematopoietic cells, the hemangioblast.1,2 Whether Ship plays a role in hematopoietic commitment and
differentiation from the hemangioblast remains to be investigated.
Although Ship is only detected in cells of the hematopoietic origin in
prenatal animals, Northern analysis on RNA prepared from adult tissues
detected ship message in a broad range of
tissues4,26 (Fig 1). Could ship expression be
turned on at a later stage in these adult organs? Results from
immunohistochemical staining on sections of the lung, liver, and kidney
(data not shown) showed no positive staining. Therefore, the
ship messages detected by Northern could be transcripts
produced by (1) various amount of hematopoietic cells existing in each
tissue; or (2) other cell types in the organ, and if so, they are not
translated. However, ship is expressed in spermatids of the
adult testis and the expression appears to be predominantly in the
membrane (Fig 3c). Membrane localization was demonstrated to be
necessary and sufficient for Ship's function,27 which
suggests that the Ship in spermatids is probably in an active form. The
role of Ship during spermatogenesis awaits further investigation.
Our studies also provided evidence that ship is broadly
expressed in hematopoietic lineage. In fact, expression of
ship was detected in nucleated erythroblasts in the yolk sac
and in megakaryocytes, monocytes, neutrophils, and tissue basophils
during definitive hematopoiesis. Consistent with a previous
report,28 we also found that virtually all of the
lymphocytes, granulocytes, and monocyte/progenitor cells in the bone
marrow of adult mice express ship. Since these cells in
various hematopoietic lineages have different sets of surface receptors
for signal transduction, the wide expression pattern of ship
suggests that it may play a role in several distinct signaling
pathways.
In B lymphocytes, ship was expressed at a relatively
constant level throughout development. However, the level of
ship expression in T lymphocytes was upregulated as T cells
go through positive and negative selection from DP cells to become SP
cells. It is known that the DP to SP transition is a checkpoint for
selection of useful TCR specificities and is mediated by the TCR
complex.24 The regulated expression of ship
during this transition suggests that Ship plays an important role
either during the selection process or in T-cell immune responses. The
ability of Ship to interact with TCR complex  chain26
implies that Ship can do so through mediating TCR-initiated
signaling.
| |
FOOTNOTES |
Submitted June 11, 1997;
accepted November 24, 1997.
Address reprint requests to Daniel J. Dumont, PhD, Amgen
Institute, 620 University Ave, Suite 706, Toronto, Ontario, Canada M5G
2C1.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.
| |
ACKNOWLEDGMENT |
We thank Drs Josef Penninger and Jane McGlade for helpful discussions
and critical reading of the manuscript. We are also grateful to Renu
Sarao and Marissa Luchico for their help in preparation of the
manuscript.
| |
REFERENCES |
1.
Noden DM:
Embryonic origins and assembly of blood vessels.
Am Rev Respir Dis
140:1097,
1989[Medline]
[Order article via Infotrieve]
2.
Wagner RC:
Endothelial cell embryology and growth.
Adv Microcirc
9:45,
1980
3.
Liu Q,
Amgen EST Program,
Dumont D:
Molecular cloning and chromosomal localization in human and mouse of the SH2-containing inositol phosphatase, INPP5D(SHIP).
Genomics
39:109,
1997[Medline]
[Order article via Infotrieve]
4.
Damen ED,
Liu L,
Rosten P,
Humphries RK,
Jefferson AB,
Majerus PW,
Krystal G:
The 145-kDa protein induced to associate with Shc by multiple cytokines is an inositol tetraphosphate and phosphatidylinositol 3,4,5-trisphosphate 5-phosphatase.
Proc Natl Acad Sci USA
93:1689,
1996[Abstract/Free Full Text]
5.
Lioubin MN,
Algate PA,
Tsai S,
Carlberg K,
Aebersold R,
Rohrschneider LR:
p150Ship, a signal transduction molecule with inositol polyphosphate-5-phosphatase activity.
Genes Dev
10:1084,
1996[Abstract/Free Full Text]
6.
Deuter-Reinhard M,
Apell G,
Pot D,
Klippel A,
Williams LT,
Kavanaugh WM:
SIP/SHIP inhibits Xenopus oocyte maturation induced by insulin and phosphatidylinositol 3-kinase.
Mol Cell Biol
17:2559,
1997[Abstract]
7.
Lückhoff A,
Clapham DE:
Inositol 1,3,4,5-tetrakisphosphate activates an endothelial Ca2+-permeable channel.
Nature
355:356,
1992[Medline]
[Order article via Infotrieve]
8.
Ono M,
Bolland S,
Tempst P,
Ravetch JV:
Role of the inositol phosphatase SHIP in negative regulation of the immune system by the receptor Fc RIIB.
Nature
383:263,
1996[Medline]
[Order article via Infotrieve]
9.
Kiener PA,
Lioubin MN,
Rohrschneider LR,
Ledbetter JA,
Nadler SG,
Diegel ML:
Co-ligation of the antigen and Fc receptors give rise to the selective modulation of intracellular signaling in B cells.
J Biol Chem
272:3838,
1997[Abstract/Free Full Text]
10.
Liu L,
Damen JE,
Hughes MR,
Babic I,
Jirik FR,
Krystal G:
The Src homology 2 (SH2) domain of SH2-containing inositol phosphatase (SHIP) is essential for tyrosine phosphorylation of SHIP, its association with Shc, and its induction of apoptosis.
J Biol Chem
272:8983,
1997[Abstract/Free Full Text]
11.
Crowley MT,
Harmer SL,
DeFranco AL:
Activation-induced association of a 145-kDa tyrosine-phosphorylated protein with Shc and Syk in B lymphocytes and macrophages.
J Biol Chem
271:1145,
1996[Abstract/Free Full Text]
12.
Lamkin TD,
Walk SF,
Liu L,
Damen JE,
Krystal G,
Ravichandran KS:
Shc interaction with Shc homology 2 domain containing inositol phosphatase (SHIP) in vivo requires the Shc-phosphotyrosine binding domain and two specific phosphotyrosines on SHIP.
J Biol Chem
272:10396,
1997[Abstract/Free Full Text]
13.
Lioubin MN,
Myles GM,
Carlberg K,
Bowtell D,
Rohrschneider LR:
Shc, Grb2, Sos1, and a 150-kilodalton tyrosine-phosphorylated protein form complexes with Fms in hematopoietic cells.
Mol Cell Biol
14:5682,
1994[Abstract/Free Full Text]
14.
Damen JE,
Liu L,
Cutler RL,
Krystal G:
Erythropoietin stimulates the tyrosine phosphorylation of Shc and its association with Grb2 and a 145-kd tyrosine phosphorylated protein.
Blood
82:2296,
1993[Abstract/Free Full Text]
15.
Pelicci G,
Lanfrancone L,
Salcini AE,
Romano A,
Mele S,
Borrello MG,
Segatto O,
Di Fiore PP,
Pelicci PG:
Constitutive phosphorylation of Shc proteins in human tumors.
Oncogene
11:899,
1995[Medline]
[Order article via Infotrieve]
16.
Jücker M,
Schiffer CA,
Feldman RA:
A tyrosine-phosphorylated protein of 140 kd is constitutively associated with the phosphotyrosine binding domain of Shc and the SH3 domains of Grb2 in acute myeloid leukemia cells.
Blood
89:2024,
1997[Abstract/Free Full Text]
17.
Rozakis-Adcock M,
McGlade J,
Mbamalu G,
Pelicci G,
Daly R,
Li W,
Batzer A,
Thomas S,
Brugge J,
Pelicci PG,
Schlessinger J,
Pawson T:
Association of the Shc and Grb2/Sem5 SH2-containing proteins is implicated in activation of the Ras pathway by tyrosine kinases.
Nature
360:689,
1992[Medline]
[Order article via Infotrieve]
18.
Frohman MA,
Boyle M,
Martin GR:
Isolation of the mouse Hox-2.9 gene: Analysis of the embryonic expression suggests that positional information along the anterior-posterior axis is specified by mesoderm.
Development
110:589,
1990[Abstract/Free Full Text]
19.
Shalaby F,
Rossant J,
Yamaguchi TP,
Gertsenstein M,
Wu X-F,
Breitman ML,
Schuh AC:
Failure of blood-island formation and vasculogenesis in Flk-1-deficient mice.
Nature
376:62,
1995[Medline]
[Order article via Infotrieve]
20. Ausubel FM, Brent R, Kingston RE, Moore DD, Sediman JG, Smith
JA, Struhl K: Expression and purification of glutathione-transferase fusion proteins. Curr Protocols Mol Biol 2:16.7.1, 1995
21.
Wallace VA,
Fung-Leung W-P,
Timms E,
Gray D,
Kishihara K,
Loh DY,
Penninger J,
Mak TW:
CD45RA and CD45RBhigh expression induced by thymic selection events.
J Exp Med
176:1657,
1992[Abstract/Free Full Text]
22. Rugh R: The Mouse, Its Reproduction and Development. New York,
NY, Oxford University Press, 1994
23.
Moore T,
Huang S,
Terstappen LWMM,
Bennett M,
Kumar V:
Expression of CD43 on murine and human pluripotent hematopoietic stem cells.
J Immunol
153:4978,
1994[Abstract]
24.
Zuniga-Pflucker JC,
Lenardo MJ:
Regulation of thymocyte development from immature progenitors.
Curr Opin Immunol
8:215,
1996[Medline]
[Order article via Infotrieve]
25. Austyn JM, Wood KJ: Principles of Cellular and Molecular
Immunology. New York, NY, Oxford University Press, 1994, p 442
26.
Osborne MA,
Zenner G,
Lubinus M,
Zhang X,
Songyang Z,
Cantley LC,
Majerus P,
Burn P,
Kochan JP:
The inositol 5-phosphatase SHIP binds to immunoreceptor signaling motifs and responds to high affinity IgE receptor aggregation.
J Biol Chem
271:29271,
1996[Abstract/Free Full Text]
27.
Ono M,
Okada H,
Bolland S,
Yanagi S,
Kurosaki T,
Ravetch JV:
Deletion of SHIP or SHP-1 reveals two distinct pathways for inhibitory signaling.
Cell
90:293,
1997[Medline]
[Order article via Infotrieve]
28.
Geier SJ,
Algate PA,
Carlberg K,
Flowers D,
Friedman C,
Trask B,
Rohrschneider LR:
The human SHIP gene is differentially expressed in cell lineages of the bone marrow and blood.
Blood
89:1876,
1997[Abstract/Free Full Text]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
J. C. Schimenti, J. L. Reynolds, and A. Planchart
Mutations in Serac1 or Synj2 cause proximal t haplotype-mediated male mouse sterility but not transmission ratio distortion
PNAS,
March 1, 2005;
102(9):
3342 - 3347.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Wang, R. J. Keogh, M. G. Hunter, C. A. Mitchell, R. S. Frey, K. Javaid, A. B. Malik, S. Schurmans, S. Tridandapani, and C. B. Marsh
SHIP2 Is Recruited to the Cell Membrane upon Macrophage Colony-Stimulating Factor (M-CSF) Stimulation and Regulates M-CSF-Induced Signaling
J. Immunol.,
December 1, 2004;
173(11):
6820 - 6830.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. L. Moody, L. Xu, C. D. Helgason, and F. R. Jirik
Anemia, thrombocytopenia, leukocytosis, extramedullary hematopoiesis, and impaired progenitor function in Pten+/-SHIP-/- mice: a novel model of myelodysplasia
Blood,
June 15, 2004;
103(12):
4503 - 4510.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Sasaoka, T. Wada, K. Fukui, S. Murakami, H. Ishihara, R. Suzuki, K. Tobe, T. Kadowaki, and M. Kobayashi
SH2-containing Inositol Phosphatase 2 Predominantly Regulates Akt2, and Not Akt1, Phosphorylation at the Plasma Membrane in Response to Insulin in 3T3-L1 Adipocytes
J. Biol. Chem.,
April 9, 2004;
279(15):
14835 - 14843.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. D. Helgason, J. Antonchuk, C. Bodner, and R. K. Humphries
Homeostasis and regeneration of the hematopoietic stem cell pool are altered in SHIP-deficient mice
Blood,
November 15, 2003;
102(10):
3541 - 3547.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Z. Tu, J. M. Ninos, Z. Ma, J.-W. Wang, M. P. Lemos, C. Desponts, T. Ghansah, J. M. Howson, and W. G. Kerr
Embryonic and hematopoietic stem cells express a novel SH2-containing inositol 5'-phosphatase isoform that partners with the Grb2 adapter protein
Blood,
October 1, 2001;
98(7):
2028 - 2038.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
N. Prasad, R. S. Topping, and S. J. Decker
SH2-Containing Inositol 5'-Phosphatase SHIP2 Associates with the p130Cas Adapter Protein and Regulates Cellular Adhesion and Spreading
Mol. Cell. Biol.,
February 15, 2001;
21(4):
1416 - 1428.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
C. D. Helgason, C. P. Kalberer, J. E. Damen, S. M. Chappel, N. Pineault, G. Krystal, and R. K. Humphries
A Dual Role for Src Homology 2 Domain-Containing Inositol-5-Phosphatase (Ship) in Immunity: Aberrant Development and Enhanced Function of B Lymphocytes in Ship-/- Mice
J. Exp. Med.,
March 6, 2000;
191(5):
781 - 794.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. R. Rohrschneider, J. F. Fuller, I. Wolf, Y. Liu, and D. M. Lucas
Structure, function, and biology of SHIP proteins
Genes & Dev.,
March 1, 2000;
14(5):
505 - 520.
[Full Text]
|
|
|
|
|
|
|
J. M. Mason, B. K. Beattie, Q. Liu, D. J. Dumont, and D. L. Barber
The SH2 Inositol 5-Phosphatase Ship1 Is Recruited in an SH2-dependent Manner to the Erythropoietin Receptor
J. Biol. Chem.,
February 11, 2000;
275(6):
4398 - 4406.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Hashimoto, K. Hirose, H. Okada, T. Kurosaki, and M. Iino
Inhibitory Modulation of B Cell Receptor-mediated Ca2+ Mobilization by Src Homology 2 Domain-containing Inositol 5'-Phosphatase (SHIP)
J. Biol. Chem.,
April 16, 1999;
274(16):
11203 - 11208.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. Wisniewski, A. Strife, S. Swendeman, H. Erdjument-Bromage, S. Geromanos, W. M. Kavanaugh, P. Tempst, and B. Clarkson
A Novel SH2-Containing Phosphatidylinositol 3,4,5-Trisphosphate 5-Phosphatase (SHIP2) Is Constitutively Tyrosine Phosphorylated and Associated With src Homologous and Collagen Gene (SHC) in Chronic Myelogenous Leukemia Progenitor Cells
Blood,
April 15, 1999;
93(8):
2707 - 2720.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. M. Lucas and L. R. Rohrschneider
A Novel Spliced Form of SH2-Containing Inositol Phosphatase Is Expressed During Myeloid Development
Blood,
March 15, 1999;
93(6):
1922 - 1933.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Huber, C. D. Helgason, J. E. Damen, L. Liu, R. K. Humphries, and G. Krystal
The src homology 2-containing inositol phosphatase (SHIP) is the gatekeeper of mast cell degranulation
PNAS,
September 15, 1998;
95(19):
11330 - 11335.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. Saint-Dic, S. C. Chang, G. S. Taylor, M. M. Provot, and T. S. Ross
Regulation of the Src Homology 2-containing Inositol 5-Phosphatase SHIP1 in HIP1/PDGFbeta R-transformed Cells
J. Biol. Chem.,
June 8, 2001;
276(24):
21192 - 21198.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Abstract
Introduction
Abstract