|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
Blood, Vol. 91 No. 8 (April 15), 1998:
pp. 2781-2792
By
From the Division of Hematology-Oncology, Cornell University Medical
College, New York; James Ewing Laboratory of Developmental
Hematopoiesis, Memorial Sloan-Kettering Cancer Center, New York;
Division of Pulmonary and Critical Care Medicine, The New York
Hospital-Cornell Medical Center, New York, NY; Dana-Farber Cancer
Institute, Laboratory of Infectious Diseases, Harvard Medical School,
Boston, MA; and Children's Hospital, Philadelphia, PA.
Replication-deficient adenoviral vectors (AdVec), which infect
cycling and noncycling cells with high efficiency, low toxicity, and
ease of delivery, provide ideal vehicles to study the expression of
regulatory genes controlling different stages of hematopoiesis. To
examine the infection efficiency of AdVec in hematopoietic precursor
and progenitor cells, we used a replication-deficient adenovector
expressing the humanized form of the cDNA for green fluorescent protein
(AdGFP), permitting assessment of infection efficiency and kinetics of
transgene expression in viable hematopoietic cells using flow cytometry
and fluorescence microscopy. Flow-cytometric analysis of ex vivo
expanded hematopoietic precursor cells infected with a multiplicity of
infection (MOI) of 100 of AdGFP show that 78% of megakaryocytic
(CD41a+ and CD42b+) cells, 82% of
dendritic (CD1a+) cells, 41% of RBC precursors
(glycophorin A+), and 32% of monocytic
(CD14+) cells expressed GFP. Nineteen percent ± 1%
of freshly isolated CD34+ cells from peripheral blood
leukapheresis products infected under the same conditions expressed
GFP. Morphologic evaluation of ex vivo expanded, AdGFP-infected
CD34+ cells showed normal maturation. The functional
capacity of AdGFP-infected CD34+ cells was analyzed by
quantifying clonogeneic efficiency and proliferative capacity.
Infection of CD34+ progenitor cells with MOIs of 1 to 100 did not impair clonogeneic efficiency of CD34+ cells.
However, MOI greater than 100 resulted in a significant inhibition of
colony-forming unit-granulocyte/granulocyte-macrophage (CFU-G/GM)
formation. In sequential dilution expansion over 3 weeks (Delta assay),
the cytokine-driven proliferative potential of CD34+
cells was not impaired following exposure to AdGFP at MOIs of 1 to
1,000. The GFP+ population expanded 10- to 15-fold at
high MOIs (500 to 1,000), indicating multiple copies of the transgene
in the initially infected CD34+ cells, which were
expressed in subsequent progenies. These data show that AdVec deliver
transgenes with high efficiency and low toxicity to hematopoietic
progenitor and precursor cells. Introduction of marker genes such as
GFP into hematopoietic cells by AdVec will provide a valuable system
for study of development, homing, and trafficking of hematopoietic
precursor and progenitor cells in vitro and in vivo. Furthermore, these
results provide insights into the design of gene therapy strategies for
treatment of hematologic disorders by AdVec.
INDUCED EXPRESSION OF regulatory or
marker genes in hematopoietic cells provides a powerful tool for the
study of regulation of hematopoietic progenitor- and precursor-cell
proliferation, differentiation, maturation, and trafficking.
Furthermore, overexpression of cytokines, lymphokines, surface
receptors, and chemoresistance proteins in hematopoietic precursor
cells may lead to new approaches for the treatment of neoplastic,
inflammatory, or inherited hematologic disorders.
Transfer of genes by retroviral vectors requires cycling of the target
cells to achieve integration and stable transgene expression. Such an
approach is thus not suitable for targeting of differentiated, postmitotic hematopoietic precursor cells. Introduction of genes into
such cells by traditional transfection techniques such as calcium
phosphate, electroporation, or lipofection results in low transduction
efficiency, significant toxicity, and cell loss.1-3 Adenoviral vectors (AdVec) have several advantages over other strategies for gene delivery to hematopoietic precursor cells. AdVec do
not require cycling of the target cell for gene transfer and their
integrin-dependent mechanism for cell entry,4,5 as well as
their efficient mechanism for gene delivery from the cell surface to
the nucleus,6 renders them ideal candidate vectors for gene
targeting into hematopoietic progenitor and precursor cells.
We evaluated transduction efficiency and duration of transgene
expression mediated by AdVec expressing the jellyfish Aequorea victoria green fluorescent protein (AdGFP) in ex vivo expanded and
terminally differentiated, postmitotic hematopoietic cells, as well as
freshly isolated CD34+ progenitor cells. Recent reports
have shown that adenoviral mediated gene transfer into hematopoietic
progenitors using Escherichia coli Purification of Human CD34+ Cells
Ex vivo Expansion of CD34+ Cells
Antibodies and Cytokines Monoclonal antibodies. All of the monoclonal antibodies used for flow cytometry experiments were directly conjugated with phycoerythrin (PE). Dendritic cells were detected by CD1a-PE (SK9, IgG2b; Becton Dickinson, San Jose, CA), monocytic cells by CD14-PE (UCHM-1, IgG2a; Sigma, St Louis, MO), myeloid cells by CD15-FITC (DU-HL60-3, IgM; Sigma), stem cells by CD34-PE (8G12, IgG1; Becton Dickinson), megakaryocytic precursor and progenitor cells by CD41a-PE (GPllbIllla, HIP8, IgG1; Pharmingen, San Diego, CA), mature megakaryocytes by CD42b-PE (GPIb SZ2, IgG1) and CD62-PE (GMP140, AC 1.2, IgG1; Becton Dickinson), and erythroid precursor cells by rhodamine-conjugated antibody to glycophorin (AD2, 10 Immunotech, Westbrook, ME). Cytokines.
The following cytokines were used Kit ligand (20 ng/mL; Amgen,
Thousand Oaks, CA), G-CSF (100 ng/mL; Amgen), GM-CSF (100 ng/mL; Sandoz, Basel, Switzerland), TPO (50 ng/mL; R&D Systems,
Minneapolis, MN), IL-3 (50 ng/mL; Sandoz), IL-6 (20 ng/mL; Amgen); EPO
(6 U/mL; Amgen), and TNF- AdVec Construction and Preparation The humanized GFP cDNA12 was subcloned as a NotI fragment into the plasmid pCMVSV2+,13 which creates an expression cassette with the CMV immediate-early promoter and a synthetic splice site upstream of the gene and the SV40 early polyadenylation site downstream of the gene. In pCMVSV2+, the expression cassette lies between the left end of the adenovirus genome (nucleotides 1 to 355) and the truncated E1B, pIX region (nucleotides 3333 through 5790). Coinfection of human embryonic kidney (HEK) 293 cells with the pCMVSV2+ GFP plasmid and the adenoviral backbone prepared from delE3 adenovirus backbone plasmid14 produced a full-length, replication-incompetent, E1- and E3-deficient adenovector expressing GFP. AdGFP was prepared by expansion of a single plaque generated in HEK 293 cells, which gave fluorescence. Large-scale preparations were routinely tested for titer (plaque-forming units [PFU]) by plaquing on HEK 293 cells and replication-competent adenovirus (RCA) by plaquing on A549 cells.15,16 A PFU to RCA ratio of greater than 106 was considered acceptable. The absolute amount of RCA present in the preparations is less than 1 RCA in the total dose administered. This is the same criteria the Food and Drug Administration has established for clinical studies, and the method used to detect RCA is the same as we used for clinical preparations. There is no detectable RCA+ virus or E1+ GFP virus in the preparation, and assessment of the cultures demonstrated no RCA+ virus.Adenovector Infection of Ex Vivo Expanded Hematopoietic Precursor Cells On day 10 of expansion, the cells were incubated with AdGFP (12 hours at 37°C) at various MOIs in 200 to 300 µL of serum-free medium (X-Vivo 15; BioWhittaker, Walkersville, MD) in flat-bottom 12-well plates. Following incubation, the cells were resuspended in the original expansion medium, including cytokines and serum as appropriate, and expanded for 7 to 14 more days. Subsequently, aliquots of cells were stained with lineage-specific, fluorescein-conjugated antibodies and analyzed by two-color flow cytometry for GFP expression.Flow Cytometry Before flow cytometry, viability of the cells was routinely determined by trypan blue exclusion. On average, 80% to 95% of cells were viable. AdGFP-infected hematopoietic precursor cells were washed and stained (30 minutes at 4°C) with PE- or rhodamine 1 (RD1)-conjugated monoclonal antibodies. Noninfected ex vivo expanded hematopoietic cells were stained with PE- or fluorescein isothiocyanate (FITC) conjugated IgG control isotype. Immediately after staining, the cells were washed with PBS/0.1% bovine serum albumin (BSA) and analyzed by two-color flow cytometry using an Elite Profile II flow cytometer (Coulter, Hialeah, FL). For determination of cells coexpressing GFP and the lineage-specific marker, a fluorescence intensity 1/fluorescence intensity 2 (FL1/FL2) dot-plot display was used. Log FL1 (x-axis) indicates the fluorescence intensity of GFP+ cells. Log FL2 (y-axis) represents the fluorescence intensity of ex vivo expanded hematopoietic precursor cells labeled with the PE- or RD1-conjugated monoclonal antibody. GFP+ cells labeled with lineage-specific antibody are designated as FL1(GFP+) · FL2+ and GFP
cells labeled with lineage-specific antibody are designated as FL1(GFP) · FL2+. The quantification of
cells in the different subgroups was performed by analyzing at least
10,000 cells and the proportion of transgene-expressing lineage-differentiated cells was calculated using the following formula:
Cell Sorting of GFP-Expressing CD34+ Cells Purified human CD34+ cells (purity, 99.6%) were infected with AdGFP at MOI of 100 as described earlier. Twenty-four hours after infection, 11% of the CD34+ cells expressed GFP. Subsequently, the cells were stained with propidium iodine and the viable cells (>90%) were sorted into GFP+ and GFP fractions using fluorescence-activated cell sorting
(FACS Star Plus cell sorter and LYSIS Program; Becton Dickinson).
Analysis after sorting showed a recovery of 70% of input
CD34+ cells with viability of greater than 90% for both
fractions.
Blockage of Vitronectin Receptor Before AdGFP Infection CD41a+ cells expanded with TPO/KL/IL-6 were incubated with 0.1 µg/mL of monoclonal antibody to vitronectin receptor (VnR) ( v 3 integrin, L203, a gift from T.J.
Wickham, GenVec, Rockville, MD) for 2 hours before AdGFP infection.
After washing, the cells were infected with AdGFP (100 MOI, 12 hours,
37°C). Twelve hours and 36 hours after infection, the expression of
GFP by CD41a+ cells was analyzed by flow cytometry and
compared with AdGFP-infected CD41a+ cells that were not
preincubated with anti-VnR antibodies.
Morphology and Cell Counts Liquid cultures and cytospin preparations were assayed by UV microscopy for intracellular GFP expression. Phase-contrast microscopy of liquid culture and light microscopy (Nikon, UFX-IIA) of Wright-Giemsa-stained cytospin preparations were used to document cell morphology and maturation features (camera, Nikon FX-35A; color print film, Kodak ASA 200 to 400). Cell numbers and viability of expanded cells were routinely determined by trypan blue exclusion using Neubauer hematocytometer chambers.Southern Blot Analysis for Adenoviral DNA Total DNA was extracted using protease K digestion and phenol-chloroform extraction. The DNA was digested over night with HindIII at 37°C. Ten micrograms of digested DNA were electrophoresed on a 1.2% agarose gel and subsequently transferred to nitrocellulose membrane. Hybridization (30 minutes at 65°C) was performed with a 32P-labeled adenovirus-specific probe detecting the 2.9-kb digestion product of the E4 gene.Semiquantitative Reverse-Transcriptase Polymerase Chain Reaction for the Common Coxsackie and Adenovirus Receptor (CAR) Total RNA extracts were prepared from CD34+ cells and expanded CD41a+ cells, which were enriched for megakaryocytic cells to 98% purity using immunoaffinity columns.17 RNA was extracted using the Ultraspec RNA isolation system (Biotecx Laboratories, Houston, TX). Reverse-transcriptase polymerase chain reaction (RT-PCR) was performed for simultaneous amplification of the transcription products of the recently described common receptor for coxsackie B and adenovirus (CAR)18 and the housekeeping gene for human glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The primers for CAR were designed using the cDNA sequence from the National Center for Biotechnology Information gene bank (accession no. Y07593) to provide an amplification product of 432 bp (5 -primer: TCTCATCTGTGCTCTCCGTG;
3-primer: TAATTTGGGGGAGACTGGTG). The primers for GAPDH were designed
using the gene sequence published at NCBI gene bank (accession no.
M33197) to provide an amplification product of 627 bp (5-primer:
GGAAGGTGAAGGTCGGAGTC; 3-primer: AACATCATCCCTGCCTCTAG). Briefly,
primers were synthesized using 392 DNA/RNA Synthesizer (Applied
Biosystem, Perkin-Elmer Co, Foster City, CA) oligo synthesizer and
purified with NAP-25 columns (Pharmacia LKB
Biotechnology, Arlington, IL) according to the manufacturer's instructions. Then, 1 µg of RNA was mixed with 5 U AMV
RT (Promega, Madison, WI) and 5 U Tfl DNA polymerase (Promega) in the
presence of dNTP mix and of 5× reaction buffer (Tris base 242 mg/mL,
glacial acetic acid 57.1 µL/mL, 50 mmol/L EDTA, pH 8.0; Promega). For the RT reaction, the mixture was incubated at 48°C for 45 minutes followed by a denaturation step (94°C, 2 minutes) using a Perkin Elmer Thermocycler. Subsequently, 35 cycles of PCR reaction (94°C for
30 seconds, 56°C for 1 minute, and 68°C for 2 minutes) plus one
cycle of extension (68°C for 7 minutes) were performed. The RT-PCR
product was then electrophoresed on a 2% TBE-agarose gel and stained with ethidium bromide. RNA from CD34+ and
CD41a+ cells was compared with RNA isolated from human
umbilical cord vein endothelial cells (HUVEC; positive control) and the
KG1a leukemia cell line (negative control). For control of the
RT-reaction, RNA from the first sample of CD34+ cells was
treated with RNAse H (Boehringer Mannheim, Indianapolis, IN) 1 U/µL
at 37°C for 15 minutes before RT-PCR.
Clonogeneic Assay CD34+ cells (103 cells/mL) were plated in IMDM/20% FCS and 0.36% agarose in the presence of KL, EPO, IL-3, IL-6, and G-CSF (Table 1) and incubated at 37°C in 100% humidity and 5.2% CO2 for 14 days. Colonies that consisted of more than 50 cells were quantified using an inverted microscope (×40).Sequential Dilution Expansion (Delta Assay) AdGFP-infected CD34+ cells (4 × 104 cells/mL) were expanded for 7 days in IMDM/20% FCS in the presence of KL, IL-3, IL-6, G-CSF, and EPO. After 7 days, the cells were washed with IMDM/20% FCS and the viable cells were quantified using trypan blue exclusion. An aliquot of 4 × 104 cells was expanded again in the same conditions for another 7 days. This was repeated for three rounds and the cumulative number of cells produced over 21 days of expansion was calculated.19 Additionally, every week, the number of GFP+ cells was determined by flow cytometry and the cumulative number of GFP+ progeny generated during the expansion period was quantified.Statistics Results are shown as the mean ± SD of at least three experiments. For statistical comparison Student's t test for nonparametric data was used. For multivariable analysis, two-way analysis of variance (ANOVA) was performed.
Adenovirus Infection Efficiency of Hematopoietic Precursor Cells Human CD34+ cells purified from leukapheresed peripheral blood were expanded ex vivo for 10 days with various cytokine cocktails to generate cell populations enriched for lineage-committed precursor cells. Ex vivo expanded cells were then infected with different MOIs of AdGFP and analyzed for GFP expression by lineage-committed precursor cells using two-color flow cytometry 3 days after infection. A typical profile of GFP expression in different ex vivo expanded precursor cells with a MOI of 100 is shown in Fig 1A. Using PE-conjugated monoclonal antibody to different lineages, GFP expression (FITC expression) could be detected in 78% of megakaryocytic (CD41a+ and CD42b+) cells, 82% of dendritic (CD1a+) cells, 41% of RBC precursors (glycophorin A+), and 32% of monocytic (CD14+) cells. As summarized in Fig 1B, on average (n = 3 to 4), infection with 50 MOI of AdGFP resulted in GFP expression of 61.9% ± 8.2% of dendritic cells (CD1a+) generated with KL, GM-CSF, and TNF-; 29.7% ± 4.1% of megakaryocytic cells
(CD41a+) generated with TPO, KL, and IL-6; 15.9% ± 6.2% of monocytic cells (CD14+) obtained with GM-CSF,
KL, and IL-3; and 26.6% ± 4.0% of glycophorin A+ RBC
precursors obtained with KL and EPO. Higher MOIs (100 to 500) of AdGFP
resulted in a higher proportion of cells expressing GFP.
Kinetics of AdGFP Expression in Megakaryocytic and Erythroid Progenitor Cells The expression of the transgene over time was investigated in megakaryocytic (CD41a+) and erythrocytic (glycophorin A+) cells. After a lag phase of 2 to 4 hours following infection, the number of GFP+ CD41a+ cells, as well as the intensity of GFP expression (mean fluorescence intensity), increased as a function of time after infection and of the MOI used for infection (Fig 2). Seventy-two to 96 hours after infection, the number of GFP-expressing cells and their fluorescence intensity plateaued. Subsequently, the number of GFP-expressing megakaryocytes decreased, particularly if the cells were exposed to high MOI levels (100 to 500) (Fig 2A). The number of GFP-expressing glycophorin A+ cells increased with similar kinetics, reaching a maximum 120 to 144 hours after infection and remaining unchanged thereafter (Fig 2B).
Blockage of Adenovector Infection by Anti-VnR Antibodies AdVec use a variety of integrins expressed on hematopoietic cells for attachment and cell entry. Megakaryocytes expressv3 integrins (VnR), which function as
adenoviral vector coreceptors.20,21 CD41a+
cells were infected with AdGFP (MOI, 100) after preincubation with
blocking monoclonal antibody (L203) to VnR. Subsequently, infection
efficiency was assessed by flow cytometry. Compared with
CD41a+ cells that had not been preincubated with VnR
monoclonal antibody, blockage of v3
integrins partially inhibited the infection of CD41a+ cells. As shown in Fig
3, 36 hours after AdGFP infection, the frequency of GFP-expressing CD41a+ cells was reduced from
50% (no preincubation with antibodies) to 15% (preincubation with 0.1 µg/mL of VnR monoclonal antibody).
Infection Efficiency of Purified CD34+ Cells A maximal expression of GFP in 19% ± 1% of CD34+ cells was achieved with an MOI of 50, 72 hours after infection (Fig 1B). Twenty-four hours after infection (MOI, 100), CD34+ cells expressing GFP were sorted by FACS. As shown in Fig 4A, 11% of the CD34+ cells expressed GFP. Analysis after sorting showed 98% of positively sorted cells expressing GFP (Fig 4B). The assessment of viability of GFP+ and GFP fraction by trypan blue
exclusion showed greater than 90% viable cells in both populations.
Proliferative Potential and Plating Efficiency of AdGFP-Infected CD34+ Cells The progenitor content of AdGFP-infected CD34+ cells was determined by clonogeneic assay in 0.36% agarose. The plating efficiency of unsorted, adenovector-exposed CD34+ cells remained unchanged over a range of 0 to 100 MOI (Fig 5). At an MOI of 1,000, there was a significant decrease in clonogeneic capacity to 20% to 30% of noninfected CD34+ cells. FACS-sorted 98% pure CD34+/GFP+ cells that were previously exposed to AdGFP with an MOI of 100 maintained normal plating efficiency (Fig 5).
Morphologic Assessment of AdGFP-Infected Precursor Cells
CD34+ Cells Express CAR
Noncycling hematopoietic cells are resistant to stable transgene
expression using currently available gene-transfer techniques. Introduction of transgenes with standard techniques, including calcium
phosphate transfection, lipofection, or electro-poration, are
inefficient, induce significant cell loss, and result in transient gene
expression.1-3 Unlike retrovirally mediated gene transfer, AdVec infect noncycling cells without the need for significant physical
manipulation and pathogenicity to the target cell. In this regard,
AdVec provide suitable vehicles for transferring genes into
hematopoietic progenitor cells and their precursors.
Submitted August 25, 1997;
accepted December 4, 1997.
1.
Weaver JC:
Electroporation: A general phenomenon for manipulation cells and tissues.
J Cell Biochem
51:426,
1993[Medline]
[Order article via Infotrieve]
2.
Watanabe M,
Shirayoshi Y,
Koshimizu U,
Hashimoto S,
Yonehara S,
Eguchi Y,
Tsujimoto Y,
Nakatsuji N:
Gene transfection of mouse primordial germ cells in vitro and analysis of their survival and growth control.
Exp Cell Res
230:76,
1997[Medline]
[Order article via Infotrieve]
3.
Crystal RG:
Transfer of genes to humans: Early lessons and obstacles to success.
Science
270:404,
1995
4.
Mathias P,
Wickham T,
Moore M,
Nemerow G:
Multiple adenovirus serotypes use alpha v integrins for infection.
J Virol
68:6811,
1994
5.
Wickham TJ,
Mathias P,
Cheresh DA,
Nemerow GR:
Integrins alpha v beta 3 and alpha v beta 5 promote adenovirus internalization but not virus attachment.
Cell
73:309,
1993[Medline]
[Order article via Infotrieve]
6.
Greber UF,
Willetts M,
Webster P,
Helenius A:
Stepwise dismantling of adenovirus 2 during entry into cells.
Cell
75:477,
1993[Medline]
[Order article via Infotrieve]
7.
Watanabe T,
Kuszynski C,
Ino K,
Heimann DG,
Shepard HM,
Yasui Y,
Maneval DC,
Talmadge JE:
Gene transfer into human bone marrow hematopoietic cells mediated by adenovirus vectors.
Blood
87:5032,
1996
8.
Neering SJ,
Hardy SF,
Minamoto D,
Spratt SK,
Jordan CT:
Transduction of primitive human hematopoietic cells with recombinant adenovirus vectors.
Blood
88:1147,
1996
9.
Young JW,
Szabolcs P,
Moore MA:
Identification of dendritic cell colony-forming units among normal human CD34+ bone marrow progenitors that are expanded by c-kit-ligand and yield pure dendritic cell colonies in the presence of granulocyte/macrophage colony-stimulating factor and tumor necrosis factor alpha.
J Exp Med
182:1111,
1995
10.
Szabolcs P,
Moore MA,
Young JW:
Expansion of immunostimulatory dendritic cells among the myeloid progeny of human CD34+ bone marrow precursors cultured with c-kit ligand, granulocyte-macrophage colony-stimulating factor, and TNF-alpha.
J Immunol
154:5851,
1995[Abstract]
11.
Szabolcs P,
Feller ED,
Moore MA,
Young JW:
Progenitor recruitment and in vitro expansion of immunostimulatory dendritic cells from human CD34+ bone marrow cells by c-kit ligand, GM-CSF, and TNF alpha.
Adv Exp Med Biol
378:17,
1995[Medline]
[Order article via Infotrieve]
12.
Zolotukhin S,
Potter M,
Hauswirth WW,
Guy J,
Muzyczka N:
A "humanized" green fluorescent protein cDNA adapted for high-level expression in mammalian cells.
J Virol
70:4646,
1996[Abstract]
13.
Korst RJ,
Bewig B,
Crystal RG:
In vitro and in vivo transfer and expression of human surfactant sp-a- and sp-b-associated protein cdnas mediated by replication-deficient, recombinant adenoviral vectors.
Hum Gene Ther
6:277,
1995[Medline]
[Order article via Infotrieve]
14.
Yoon SO,
Lois C,
Alvirez M,
Alvarez-Buylla A,
Falk-Pedersen E,
Chao MV:
Adenovirus-mediated gene delivery into neuronal precursors of the adult mouse brain.
Proc Natl Acad Sci USA
93:11974,
1996
15.
Rosenfeld MA,
Siegfried W,
Yoshimura K,
Yoneyama K,
Fukayama M,
Stier LE,
Paakko PK,
Gilardi P,
Stratford-Perricaudet LD,
Perricaudet M,
Jallat S,
Pavirani A,
Lecocq J-P,
Crystal RG:
Adenovirus-mediated transfer of a recombinant alpha 1-antitrypsin gene to the lung epithelium in vivo [see comments].
Science
252:431,
1991
16.
Rosenfeld MA,
Yoshimura K,
Trapnell BC,
Yoneyama K,
Rosenthal ER,
Dalemans W,
Fukayama M,
Bargon J,
Stier LE,
Stratford-Perricaudet L,
Perricaudet M,
Guggino WB,
Pavirani A,
Lecocq J-P,
Crystal RG:
In vivo transfer of the human cystic fibrosis transmembrane conductance regulator gene to the airway epithelium.
Cell
68:143,
1992[Medline]
[Order article via Infotrieve]
17.
Mohle R,
Green D,
Moore MAS,
Nachman RL,
Rafii S:
Constitutive production and thrombin-induced release of vascular endothelial growth factor by human megakaryocytes and platelets.
Proc Natl Acad Sci USA
94:663,
1997
18.
Bergelson JM,
Cunningham JA,
Droguett G,
Kurt-Jones EA,
Krithivas A,
Hong JS,
Horwitz MS,
Crowell RL,
Finberg RW:
Isolation of a common receptor for coxsackie B viruses and adenoviruses 2 and 5.
Science
275:1320,
1997
19.
Moore MAS,
Hoskins I:
Ex vivo expansion of cord blood-derived stem cells and progenitors.
Blood Cells
20:468,
1994[Medline]
[Order article via Infotrieve]
20.
Huang S,
Endo RI,
Nemerow GR:
Upregulation of integrins
21.
Acsadi G,
Jani A,
Huard J,
Blaschuk K,
Massie B,
Holland P,
Lochmuller H,
Karpati G:
Cultured human myoblasts and myotubes show markedly different transducibility by replication-defective adenovirus recombinants.
Gene Ther
1:338,
1994[Medline]
[Order article via Infotrieve]
22.
Liesveld JL,
Dipersio JF,
Abboud CN:
Integrins and adhesive receptors in normal and leukemic CD34+ progenitor cells: Potential regulatory checkpoints for cellular traffic.
Leuk Lymphoma
14:19,
1994[Medline]
[Order article via Infotrieve]
23.
Liesveld JL,
Winslow JM,
Frediani KE,
Ryan DH,
Abboud CN:
Expression of integrins and examination of their adhesive function in normal and leukemic hematopoietic cells.
Blood
81:112,
1993
24.
Huang S,
Kamata T,
Takada Y,
Ruggeri ZM,
Nemerow GR:
Adenovirus interaction with distinct integrins mediates separate events in cell entry and gene delivery to hematopoietic cells.
J Virol
70:4502,
1996[Abstract]
25.
Hierholzer JC:
Adenoviruses in the immunocompromised host.
Clin Microbiol Rev
5:262,
1992
26.
Chu Y,
Sperber K,
Mayer L,
Hsu MT:
Persistent infection human adenovirus type 5 in human monocyte cell lines.
Virology
188:793,
1992[Medline]
[Order article via Infotrieve]
27.
George KH:
Cloning and transfer.
J Natl Inst Health Res
8:61,
1996
28.
Ramachandran B,
Surrey S,
Schwartz E:
Megakaryocyte-specific positive regulatory sequence 5
29.
Usan G,
Prandini MH,
Berthier R:
Regulation of gene transcription during the differentiation of megakaryocytes.
Thromb Haemost
74:210,
1995[Medline]
[Order article via Infotrieve]
30.
Steinman RM:
The dendritic cell system and its role in immunogenicity.
Annu Rev Immunol
9:271,
1991[Medline]
[Order article via Infotrieve]
31.
Romani N,
Gruner S,
Brang D,
Kampgen E,
Lenz A,
Trockenbacher B,
Konwalinka G,
Fritsch PO,
Steinman RM,
Schuler G:
Proliferating dendritic cell progenitors in human blood.
J Exp Med
180:83,
1994
32.
Strobl H,
Riedl E,
Scheinecker C,
Bello-Fernandez C,
Pickl WF,
Rappersberger K,
Majdic O,
Knapp W:
TGF-beta 1 promotes in vitro development of dendritic cells from CD34+ hemopoietic progenitors.
J Immunol
157:1499,
1996[Abstract]
33.
Pickl WF,
Majdic O,
Kohl P,
Stockl J,
Riedl E,
Scheinecker C,
Bello-Fernandez C,
Knapp W:
Molecular and functional characteristics of dendritic cells generated from highly purified CD14+ peripheral blood monocytes.
J Immunol
157:3850,
1996[Abstract]
34.
Henderson RA,
Nimgaonkar MT,
Watkins SC,
Robbins PD,
Ball ED,
Finn OJ:
Human dendritic cells genetically engineered to express high levels of the human epithelial tumor antigen mucin (MUC-1).
Cancer Res
56:3763,
1996
35.
van Pampus EC,
Denkers IA,
van Geel BJ,
Huijgens PC,
Zevenbergen A,
Ossenkoppele GJ,
Langenhuijsen MM:
Expression of adhesion antigens of human bone marrow megakaryocytes, circulating megakaryocytes and blood platelets.
Eur J Haematol
49:122,
1992[Medline]
[Order article via Infotrieve]
36.
Cieutat AM,
Rosa JP,
Boffa MC:
Detection of GPIIIa (integrin beta 3 subunit) transcripts in human megakaryocytes by in situ hybridization on bone marrow.
Histopathology
22:179,
1993[Medline]
[Order article via Infotrieve]
37.
Philippeaux MM,
Vesin C,
Tacchini-Cottier F,
Piguet PF:
Activated human platelets express beta 2 integrin.
Eur J Haematol
56:130,
1996[Medline]
[Order article via Infotrieve]
38.
Zutter MM,
Painter AA,
Staatz WD,
Tsung YL:
Regulation of alpha 2 integrin gene expression in cells with megakaryocytic features: A common theme of three necessary elements.
Blood
86:3006,
1995
39.
Hagiwara T,
Nagasawa T,
Nagahisa H,
Takizawa M,
Osada M,
Abe T:
Expression of adhesion molecules on cytoplasmic processes of human megakaryocytes.
Exp Hematol
24:690,
1996[Medline]
[Order article via Infotrieve]
40.
Diacovo TG,
de Fougerolles AR,
Bainton DF,
Springer TA:
A functional integrin ligand on the surface of platelets: Intercellular adhesion molecule-2.
J Clin Invest
94:1243,
1994
41.
Gulino D,
Martinez P,
Delachanal E,
Concord E,
Duperray A,
Alemany M,
Marguerie G:
Expression and purification of a soluble functional form of the platelet alpha IIb beta 3 integrin.
Eur J Biochem
227:108,
1995[Medline]
[Order article via Infotrieve]
42.
McGregor JM,
Barker JN,
Ross EL,
MacDonald DM:
Epidermal dendritic cells in psoriasis possess a phenotype associated with antigen presentation: In situ expression of beta 2-integrins.
J Am Acad Dermatol
27:383,
1992[Medline]
[Order article via Infotrieve]
43.
Nicod LP,
el Habre F:
Adhesion molecules on human lung dendritic cells and their role for T-cell activation.
Am J Respir Cell Mol Biol
7:207,
1992
44.
Prickett TC,
McKenzie JL,
Hart DN:
Adhesion molecules on human tonsil dendritic cells.
Transplantation
53:483,
1992[Medline]
[Order article via Infotrieve]
45.
Lutz MB,
Winzler C,
Assmann C,
Ricciardi-Castagnoli P:
Priming of T cells with dendritic, macrophage and B cell lines in vivo requires more than surface expression of MHC II and B7 molecules
46.
Brown KA,
Bedford P,
Macey MG,
McCarthy DA,
Dumonde DC,
Knight SC:
Characterisation of adhesion molecules on the surface of dendritic cells isolated from human blood.
Adv Exp Med Biol
378:97,
1995[Medline]
[Order article via Infotrieve]
47.
Philipson L,
Lonberg-Holm K,
Petterson U:
Virus-receptor interaction in an adenovirus system.
J Virol
2:1064,
1968
48.
Gall J,
Kass-Eisler A,
Leinwand L,
Falk-Pedersen E:
Adenovirus type 5 and 7 capsid chimera: Fiber replacement alters receptor tropism without affecting primary immune neutralization epitopes.
J Virol
70:2116,
1996[Abstract]
49.
Kerst JM,
Sanders JB,
Slaper-Cortenbach IC,
Doorakkers MC,
Hooibrink B,
van Oers RH,
von dem Borne AE,
van der Schoot CE:
Alpha 4 beta 1 and alpha 5 beta 1 are differentially expressed during myelopoiesis and mediate the adherence of human CD34+ cells to fibronectin in an activation-dependent way.
Blood
81:344,
1993
50.
Burger SR,
Zutter MM,
Sturgill-Koszycki S,
Santoro SA:
Induced cell surface expression of functional alpha 2 beta 1 integrin during megakaryocytic differentiation of K562 leukemic cells.
Exp Cell Res
202:28,
1992[Medline]
[Order article via Infotrieve]
51.
Bellon T,
Lopez-Rodriguez C,
Rubio MA,
Jochems G,
Bernabeu C,
Corbi AL:
Regulated expression of p150,95 (CD11c/CD18; alpha X/beta 2) and VLA-4 (CD49d/CD29; alpha 4/beta 1) integrins during myeloid cell differentiation.
Eur J Immunol
24:41,
1994[Medline]
[Order article via Infotrieve]
52.
Debili N,
Masse JM,
Katz A,
Guichard J,
Breton-Gorius J,
Vainchenker W:
Effects of the recombinant hematopoietic growth factors interleukin-3, interleukin-6, stem cell factor, and leukemia inhibitory factor on the megakaryocytic differentiation of CD34+ cells.
Blood
82:84,
1993
53. Tomko RP, Xu R, Philipson L: HCAR, and MCAR: The human and mouse
cellular receptors for subgroup C adenoviruses and group B
coxsackieviruses. Proc Natl Acad Sci USA 43:6, 3353-6, 1997
54.
Song W,
Kong HL,
Carpenter H,
Torii H,
Granstein R,
Rafii S,
Moore MAS,
Crystal RG:
Dendritic cells genetically modified with an adenovirus vector encoding the cDNA for a antigen induce protective and therapeutic antitumor immunity.
J Exp Med
186:1247,
1997
55.
Ribas A,
Butterfield LH,
McBride WH,
Jilani SM,
Vollmer CM,
Lau R,
Dissette VB,
Hu B,
Chen AY,
Glaspy JA,
Economou JS:
Genetic immunization for the melanoma antigen MART-1/Melan-A using recombinant adenovirus-transduced murine dendritic cells.
Cancer Res
57:2865,
1997
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 1998 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Abstract
Introduction
Abstract
, MOI 10; 
, MOI 50;
, MOI 100; 
, MOI 500).
) No anti-VnR
antibody.
Possible role of CD44 and integrins.
Adv Exp Med Biol
378:413,
1995
