|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 91 No. 8 (April 15), 1998:
pp. 2998-3006
Role of p53 in Hematopoietic Recovery After Cytotoxic Treatment
By
Pawel Wlodarski,
Mariusz Wasik,
Mariusz Z. Ratajczak,
Cinzia Sevignani,
Grazyna Hoser,
Jerzy Kawiak,
Alan M. Gewirtz,
Bruno Calabretta, and
Thomas Skorski
From the Department of Microbiology and Immunology, Kimmel Cancer
Institute, Thomas Jefferson University, Philadelphia, PA; the
Department of Pathology and Laboratory Medicine, University of
Pennsylvania, Philadelphia, PA; and the Medical Center of Postgraduate
Education, Warsaw, Poland.
 |
ABSTRACT |
Prompt reconstitution of hematopoiesis after cytoreductive therapy
is essential for patient recovery and may have a positive impact on
long-term prognosis. We examined the role of the p53 tumor suppressor
gene in hematopoietic recovery in vivo after treatment with the
cytotoxic drug 5-fluorouracil (5-FU). We used p53 knock-out
(p53 / ) and wild-type (p53+/+) mice injected with 5-FU as the
experimental model. Analysis of the repopulation ability and clonogenic
activity of hematopoietic stem cells (HSCs) and their lineage-committed
descendants showed a greater number of HSCs responsible for
reconstitution of lethally irradiated recipients in p53 / bone
marrow cells (BMCs) recovering after 5-FU treatment than in the
corresponding p53+/+ BMCs. In post-5-FU recovering BMCs, the
percentage of HSC-enriched Lin Sca-1+
c-Kit+ cells was about threefold higher in p53 /
than in p53+/+ cells. Although the percentage of the most primitive
HSCs (Lin Sca-1+ c-Kit+
CD34low/ ) did not depend on p53, the percentage of
multipotential HSCs and committed progenitors (Lin
Sca-1+ c-Kit+ CD34high/+) was
almost fourfold higher in post-5-FU recovering p53 / BMCs than in
their p53+/+ counterparts. The pool of HSCs from 5-FU-treated p53 / BMCs was exhausted more slowly than that from the p53+/+ population as shown in vivo using pre-spleen colony-forming unit (CFU-S) assay and in vitro using long-term
culture-initiating cells (LTC-ICs) and methylcellulose replating
assays. Clonogenic activity of various lineage-specific descendants was
significantly higher in post-5-FU regenerating p53 / BMCs than in
p53+/+ BMCs, probably because of their increased sensitivity to
growth factors. Despite all these changes and the dramatic difference
in sensitivity of p53 / and p53+/+ BMCs to 5-FU-induced
apoptosis, lineage commitment and differentiation of hematopoietic
progenitors appeared to be independent of p53 status. These studies
suggest that suppression of p53 function facilitates hematopoietic
reconstitution after cytoreductive therapy by: (1) delaying the
exhaustion of the most primitive HSC pool, (2) stimulating the
production of multipotential HSCs, (3) increasing the sensitivity of
hematopoietic cells to growth factors, and (4) decreasing the
sensitivity to apoptosis.
 |
INTRODUCTION |
HEMATOPOIESIS IS regulated by numerous
growth factors, which act in concert to regulate proliferation
(including self-renewal), differentiation, and apoptosis, thus
generating a relatively constant pool of functionally mature blood
cells. However, normal hematopoiesis can be perturbed by a variety of
factors such as infection, reduced oxygen concentration, irradiation,
and drugs. Cytostatics, which are routinely used as antineoplastic
drugs, are toxic to bone marrow cells. In light of the importance of
prompt bone marrow repopulation for patient outcome, analyses of the
mechanisms regulating this process hold promise in leading to novel
therapies that facilitate hematopoietic repopulation after cytostatic
treatment or bone marrow transplantation.
The p53 tumor suppressor gene may be one of the key genes involved in
regulating hematopoietic repopulation. Although hematopoiesis in p53
knock-out (p53 / ) mice appears to proceed
normally,1 numerous in vitro studies indicate that p53 is
involved in proliferation, differentiation, and apoptosis of the
hematopoietic cells.2-7 Moreover, p53 deletions and
mutations have been found at high frequency in acute leukemias and in
chronic myelogenous leukemia in blast crisis.8 The p53
phosphoprotein acts not only as a transcriptional activator of genes
containing p53 binding sites,9 but also as a potent
inhibitor of transcription from many genes containing TATA boxes and
lacking p53-binding sites.10 p53 plays a critical role in
cell proliferation by modulating the expression of genes such as WAF-1,
which are required for progression through the cell
cycle.11 Furthermore, p53 is involved in the induction of
apoptosis after DNA damage,12 possibly by transactivating bax, a proapoptotic member of the bcl-2 family.13
In the present study, we examined the role of p53 in the in vivo
recovery of hematopoiesis after treatment with cytostatic agents. Bone
marrow cells obtained from p53 knock-out (p53 / ) and p53
wild-type (p53+/+) mice treated with 5-fluorouracil (5-FU) were tested
for their in vivo repopulation ability and the clonogenic activity of
hematopoietic stem cells (HSCs) and lineage-committed progenitors.
 |
MATERIALS AND METHODS |
Mice.
p53 knock-out inbred mice (C57 BL/6TacfBR-[KO]p53N4) and
p53 wild-type mice were purchased from Taconic Farms (Germantown, NY).
Mice were 6 to 10 weeks old in all experiments.
Isolation of bone marrow cells (BMCs).
Mice were injected intraperitoneally (IP) with 150 mg/kg 5-FU (SoloPak
Laboratories Inc, Elk Grove Village, IL) or physiological saline on day
0 and sacrificed by cervical dislocation 2, 4, and 6 days later. BMCs
were obtained from one femur, two tibias, and two brachial bones and
suspended in Iscove's modified Dulbecco medium (IMDM) supplemented
with 10% heat-inactivated fetal bovine serum (FBS), L-glutamine, and
penicillin/streptomycin (complete IMDM). Red blood cells were removed
by lysis in hypotonic solution (0.85% NH4Cl, 17 mmol/L
Tris-HCl, pH 7.4) for 5 minutes on ice. The number of cells obtained
from femur was multiplied by two because the contralateral femur was
used for microscopy after fixation. Bone marrow stromal cells were
removed by 2-hour incubation in complete IMDM at a concentration of
106 cells/mL in a petri dish. Nonadherent cells were
collected after gentle agitation and used for experiments.
Bone marrow transplantation.
p53+/+ mice underwent total body irradiation (TBI) with a lethal dose
of 875 cGy from a 137Cs source and 48 hours later were
injected intravenously (IV) with bone marrow cells as specified for
each assay.
Competitive long-term reconstitution assay.
TBI-treated p53+/+ mice were injected with a mixture of 5 × 104 p53+/+ and 5 × 104 p53 /
BMCs. After 16 weeks, mice were sacrificed and genomic DNA was isolated
from BMCs. The ratio of p53+/+ to p53 / cells repopulating
the host bone marrow was evaluated by quantitative polymerase chain
reaction (PCR). Two sets of primers, 1-2 and 1-3, were used
simultaneously to detect p53 wild-type and p53 knock-out alleles,
respectively14: primer 1 (5 ):
GGGACAGCCAAGTCTGTTATGTGC, located upstream from the deleted region of
the p53 gene and therefore common for both mutated and wild-type
alleles; primer 2 (3 ): CTGTCTTCCAGATACTCGGGATAC, located in the
fragment deleted in the knock-out p53 allele and specific for the
wild-type allele; and primer 3 (3 ): TTTACGGAGCCCTGGCGCTCGATGT, located in the PolII promoter region of the NEO
cassette and present only in the knock-out allele. PCR was performed
using 2 µg of genomic DNA and the products were separated by
electrophoresis, transferred to a Zetabind membrane (Cuno Inc, Meriden,
CT), and hybridized with an internal probe (5
TTCCTCTTCAGCCTGTAGACTGTG 3 ) specific for intron 1 in the p53
gene, thus recognizing PCR products from both the wild-type and the
knock-out alleles. The ratio of these PCR products was compared with
that in the calibration blot prepared using a mixture of p53+/+ and
p53 / cells in predetermined proportions.
Flow cytometry.
The following antibodies were used: fluorescein isothiocyanate
(FITC)-Sca-1, FITC-c-Kit, FITC-Gr-1, FITC-Mac-1, FITC-CD3, phycoerythrin (PE)-Ter-119, PE-B220, CD34 (all from Pharmingen, San
Diego, CA), PE-CD4, PE-CD8 (both from Boehringer-Mannheim, Indianapolis, IN), and biotin-F4/80 (Serotec Ltd, Oxford, UK). Cells
(105 per 100 µL of phosphate-buffered saline [PBS] + 2% FBS + 0.1% NaN3) were incubated with Fc block
(Pharmingen) for 10 minutes at room temperature followed by 45-minute
incubation with the indicated antibodies at 4°C and, when
appropriate, incubated with secondary antibody coupled to FITC or with
streptavidin linked to PE. Flow cytometry was performed with EPICS
Profile analyzer (Coulter Corp, Hialeah, FL).
Cell sorting.
Lineage-positive (Lin+) cells were removed with a magnet
(MPC-1; Dynal Inc, Oslo, Norway) after staining with a mixture of biotinylated antibodies (Gr-1, Mac-1, B220, CD4, CD8, and Ter-119) and
incubation with Dynabeads (Dynal Inc, Great Neck, NY),
according to the manufacturer's protocol. Cells in suspension were
then incubated with streptavidin-Red 670 (SV-R670; GIBCO-BRL, Grand Island, NY) and sorted on Coulter cell sorter to remove remaining Lin+ cells. Lin cells were subsequently
incubated with the cocktail of PE-Sca-1, FITC-c-Kit, and biotin-CD34
antibodies, washed extensively, and further incubated with SV-R670,
washed again and sorted using 3-color fluorescence-activated cell
sorting (Epics Elite; Coulter Corp). Lin
Sca-1+ c-Kit+ CD34high/+ and
Lin Sca-1+ c-Kit+
CD34low/ populations were selected according to
Osawa et al15 and used for further experiments.
Colony formation assay in methylcellulose.
Cells (5 × 104) were resuspended in methylcellulose
semisolid medium (HCC-4320, StemCell Technologies Inc,
Vancouver, Canada) and plated in 35-mm wells in the presence of the
following recombinant murine growth factors: 10 U/mL of interleukin-3
(IL-3; Genetics Institute Inc, Cambridge, MA), 50 U/mL of IL-2
(Genetics Institute Inc), 30 U/mL of IL-7 (Genetics Institute Inc), 10 ng/mL of kit ligand (KL; R&D System Inc, Minneapolis, MN), and 10 U/mL
of erythropoietin (Epo; Amgen Inc, Thousand Oaks, CA). After 7 to 10 days, colonies and clusters were counted under an inverted microscope
as described.16
To determine long-term clonogenic efficiency, cells were plated in
methylcellulose in the presence of KL, IL-3, and Epo; the colonies were
counted; and the cells were harvested 10 days later, washed in medium,
counted, and replated (104 cells/plate) in the presence of
the indicated growth factors.
Megakaryocytic colony-forming unit (CFU-Meg) assay.
4A5 hybridoma cells producing antimouse megakaryocyte
antibodies17 were obtained from Dr Paul Friese (University
of Oklahoma Health Sciences Center, Oklahoma City, OK). Ascites were
harvested from pristane-pretreated SCID mice injected IP with 4A5
cells. The IgG fraction was purified on a protein A affinity column
(Oncogene Science, Uniondale, NY) and used for staining. Megakaryocytic colonies were grown in plasma cloth in the presence of recombinant IL-6, IL-3, and Epo as described.18 CFU-Meg colonies were
detected by staining the plasma cloths with antimouse megakaryocyte
antibody (IgG) followed by FITC-conjugated antirat IgG. Colonies were
counted under a fluorescence microscope.
Fibroblast-like colony-forming unit (CFU-F) assay.
BMCs (104 from each mouse) were plated into 35-mm
Petri dish in complete IMDM. After 2-hour incubation, floating cells
were removed and adherent cells were cultured in Dulbecco's
modified Eagle's medium + 10% FBS for 5 to 7 days. Colonies of
fibroblasts were fixed in methanol, washed in PBS, stained with Giemsa
and counted under a light microscope.
Assay for LTC-ICs.
BMCs isolated from six p53+/+ and six p53 / mice were
evaluated for LTC-IC content in two sets of independent experiments as
described.19 Briefly, 5 × 104 BMCs
recovered from 5-FU-treated mice were plated on irradiated (1,500 cGy)
syngeneic murine stromal monolayers in 24-well plates (Corning,
Cambridge, MA) containing 1 mL of IMDM (GIBCO BRL) supplemented with
12.5% calf serum (Hyclone, Logan, UT) and 12.5% horse serum (Hyclone). Cells isolated from every mouse were cultured in 16 independent wells. Half of the population of floating cells was collected every 2 weeks and fresh medium was added to the remaining cells. Collected cells derived from the same animal were pooled, washed, and analyzed for colony formation in methylcellulose containing 10 ng/mL recombinant murine KL as described.16
CFU-S and pre-CFU-S assay.
BMCs (105) were injected IV into TBI-treated p53+/+ mice
and after 12 days, spleens were removed and fixed in Teleyesnizky solution (70% ethanol, 5% acetic acid, and 2% formaldehyde), and CFU-S were counted. At the same time, 105 BMCs were
isolated and injected into secondary TBI-treated recipients. After 12 days, recipient mice were sacrificed, spleens were fixed in
Teleyesnizky solution, and pre-CFU-S were counted.
Western blotting.
BMCs (106) were lysed in RIPA buffer (PBS
supplemented with 1% NP40, 0.5% sodium deoxycholate, and 0.1% sodium
dodecyl sulfate) with proteinase inhibitors (1 mmol/L phenylmethyl
sulfonyl fluoride, 10 µg/mL aprotinin, 10 µg/mL leupeptin, 1 mmol/L
sodium orthovanadate, and 0.5 mmol/L EDTA). Lysates were analyzed by
sodium dodecyl sulfate-polyacrylamide gel electrophoresis followed by
Western blotting with antibodies against: PCNA WAF-1, bak, bcl-2, p53, actin (all from Oncogene Science, Cambridge, MA), bcl-xLS,
p16, and bax (all from Biotechnology Inc, Santa Cruz, CA). Secondary antibodies were from Amersham Life Science Inc (Arlington Heights, IL).
Bands were detected with ECL kit (Amersham).
Apoptosis assay.
Femurs were fixed in 4% paraformaldehyde, decalcified, and embedded in
paraffin. Sections were immobilized on slides and rehydrated. Apoptotic
cells were detected using the TACS 2 TdT in situ apoptosis detection
kit (Trevigen Inc, Gaithersburg, MD) according to the manufacturer's
protocol.
Histological and cytological analysis.
Bone marrow tissue sections were fixed in phosphate-buffered formalin
and embedded in paraffin. Slides were stained with hematoxylin/eosin. Cytospin preparations were stained with Wright-Giemsa.
 |
RESULTS |
Role of p53 in 5-FU-induced toxicity to BMCs.
The number of BMCs in p53+/+ mice decreased dramatically after
injection of 5-FU, whereas the drug was markedly less potent in
p53 / mice (Fig 1). On day 6 after 5-FU administration, p53 / mice contained fivefold
to eightfold more BMCs than their wild-type counterparts. This
phenomenon probably reflects the diminished apoptosis in
p53 / cells, because injection of 5-FU into the p53+/+
mice resulted in massive apoptosis of BMCs on days 2 and 4, whereas
BMCs from p53 / mice became apoptotic only sporadically (Fig 2).

View larger version (50K):
[in this window]
[in a new window]
| Fig 1.
Number of BMCs in p53+/+ (black bars) and p53 /
(shadowed bars) mice after injection of 5-FU. Results represent mean
(standard deviation) from five mice/groups.
|
|

View larger version (109K):
[in this window]
[in a new window]
| Fig 2.
Induction of apoptosis by p53 after 5-FU treatment.
Apoptotic cells were detected by TACS apoptosis assay in femoral bone marrows of p53+/+ (left panel) and p53 / (right panel) mice on days 0, 2, 4, and 6 after 5-FU injection. Results are representative of
three independent experiments.
|
|
Analysis of growth factor requirements of colony-forming units
indicated that post-5-FU repopulating p53 / BMCs, as
compared with their p53+/+ counterparts, formed more colonies in
threshold (0.1 U/mL), suboptimal (1 U/mL) and saturating (10 U/mL)
concentrations of recombinant murine IL-3
(Fig 3). Thus, the absence of p53 in regenerating cells underlies their increased sensitivity to stimulation by growth factors, consistent with previous studies showing the importance of the p53 status in the response of hematopoietic cells to
growth factor
stimulation.4

View larger version (37K):
[in this window]
[in a new window]
| Fig 3.
Increased sensitivity of p53 / BMCs to stimulation
by IL-3. p53+/+ (black bars) and p53 / (shadowed bars) cells
collected on day 6 after 5-FU administration were incubated in
methylcellulose in the presence of the indicated concentrations of
IL-3. Colonies and clusters were scored 10 days later. Results are mean
(standard deviation) of three experiments.
|
|

View larger version (26K):
[in this window]
[in a new window]
| Fig 4.
Western blot analysis of cell-cycle related and
apoptosis-related proteins in p53+/+ and p53 / BMCs
repopulating after 5-FU treatment.
|
|
The differences between p53+/+ and p53 / BMCs in
proliferation potential and sensitivity to apoptosis were confirmed by
Western blotting analysis of proteins involved in cell cycle activity (PCNA, WAF-1, and p16INK4a) and in apoptosis
(bcl-2, bax, bcl-xL, and bak) on days 0, 2, 4, and 6 after
5-FU injection (Fig 4). p53 expression was not detectable on day 0, but increased significantly on days 2, 4, and 6 in
p53+/+ samples, in accord with previous findings.20 As
expected, p53 was not detectable in p53 / samples. High
levels of PCNA were detected in each sample of p53 / BMCs
after 5-FU treatment, whereas in p53+/+ BMCs, PCNA expression was
decreased on day 2, undetectable on day 4, but again detectable on day
6 after injection of the drug. p16INK4a levels
decreased slightly in p53+/+ BMCs on days 2, 4, and 6. In contrast,
p16INK4a expression was low on days 0, 2, and 4, but markedly increased on day 6 in p53 / BMCs. WAF-1
levels increased in both p53+/+ and p53 / BMCs after 5-FU
treatment, but the increase was detectable earlier and was more
pronounced in the p53+/+ population. Together, these data confirmed
that p53 / BMCs regenerating after 5-FU had higher
proliferative potential than their p53+/+ counterparts. Analysis of
apoptosis-related proteins showed markedly enhanced bcl-2 levels in
p53 / BMCs on days 2 and 4, but low level expression at
all other time points as in p53+/+ samples. Expression of
bcl-xL was similar in both p53+/+ and p53 /
populations. Both bax and bak proteins were highly expressed on days 2 and 4 in p53+/+ BMCs, but undetectable in other samples including those
from p53 / cells. Thus, expression of proapoptotic
effectors (bax, bak) relative to antiapoptotic (bcl-2,
bcl-xL) effectors was high in p53+/+ cells on days 2 and 4 after 5-FU treatment, whereas the reverse was observed in
p53 / cells.
Role of p53 in repopulation of HSCs after 5-FU treatment in vivo.
To compare the ability of p53+/+ and p53 / BMCs obtained
from 5-FU-treated mice to rescue animals exposed to a lethal dose of
TBI, decreasing numbers of p53+/+ and p53 / BMCs were
injected into recipient mice, and long-term survival was scored at 16 weeks postinjection. Lower numbers of p53 / BMCs than
p53+/+ BMCs were required to rescue TBI-treated recipient mice
(Table 1), suggesting that post-5-FU repopulating
p53 / BMCs contain more HSCs capable of reconstituting
hematopoiesis in vivo. BMCs from the p53+/+ and p53 / mice
not treated with 5-FU showed no difference in their ability to
repopulate in TBI-treated recipients (data not shown). PCR analysis to
assess the presence of the p53 knock-out and wild-type alleles in the
mononuclear fraction of BMCs obtained from mice transplanted with
p53 / BMCs showed only the knock-out allele (not shown).
Thus, long-term hematopoiesis in the transplanted hosts was caused by
p53 / marrow cells and not by normal marrow cells that may
have escaped lethal irradiation. Analysis of blood smears and bone
marrow sections showed normal hematopoiesis in mice transplanted with
either p53+/+ or p53 / BMCs (data not shown). Quantitative
PCR followed by Southern blotting to assess the proportion of
p53 / to p53+/+ BMCs in TBI-treated recipient mice
injected IV with a 1:1 mixture of both indicated a ratio of 10:1 to
100:1 in bone marrow obtained 16 weeks after transplantation (Fig 5).
Mice were free of leukemia at the time of BMC collection as confirmed
by histological analysis of bone marrow and other organs (blood,
spleen, and thymus). These results suggest that the absence of p53 gene
expression has a positive impact on the repopulation ability of BMCs
after treatment with 5-FU.

View larger version (34K):
[in this window]
[in a new window]
| Fig 5.
Competitive long-term reconstitution assay. Detection of
the p53 knock-out and the wild-type allele in BMCs of TBI-treated mice
injected 16 weeks earlier with a 1:1 mixture of p53+/+ and p53 / BMCs by PCR followed by Southern blotting (left panel: 1, 2, 3, and 4 individual mice). Known mixtures of p53+/+ and p53 /
cells (percentages indicated on the top or bottom of the blot) were
analyzed to generate a calibration blot (right panel).
|
|
Role of p53 in regulation of HSCs after 5-FU treatment.
To determine whether the more vigorous repopulation ability of
p53 / BMCs reflected an increased number of HSCs,
immunostaining followed by flow cytometry was used to quantitate HSCs.
p53 / BMCs that repopulated after 5-FU treatment contained
about threefold more HSCs with the phenotype Lin
Sca-1+ c-Kit+ 21 than their p53+/+
counterparts (Table 2). Staining with anti-CD34 antibody
discriminated two HSC subpopulations: Lin
Sca-1+ c-Kit+ CD34low/
(CD34low/ , primitive HSCs) and
Lin Sca-1+ c-Kit+
CD34high/+ (CD34high/+, multipotential
HSCs).15 There was no difference in the percentage of
CD34low/ cells between p53 / and p53+/+
BMCs regenerating after 5-FU. However, the percentage of
CD34high/+ cells was threefold to fourfold higher in the
p53 / population. No difference in the content of
CD34high/+ and CD34low/ populations was
observed in BMCs obtained from p53 / and p53+/+ mice not
treated with 5-FU (data not shown).
To examine the role of p53 in the exhaustion of the HSC pool,
104 CD34low/ and CD34high/+
cells with the p53+/+ or p53 / genotype were plated in
methylcellulose in the presence of KL, IL-3, and Epo. Colonies were
counted every 10 days and cells were collected and replated.
Colony-forming ability of both CD34low/ and
CD34high/+ populations isolated from BMCs of 5-FU-treated
p53 / mice persisted after more replatings as compared
with that from p53+/+ BMCs (Fig 6A). p53 did not have
any influence on lineage commitment and differentiation status of these
cells, as indicated by morphological analysis of Wright-Giemsa-stained
cytospin preparations of cells used for each replating (data not
shown). All types of colonies showed predominantly cells of myeloid
origin. Whereas the early 10-day cultures showed mainly myeloid
precursors, the later 20- and 30-day cultures showed a preponderance of
more mature myeloid cells, including neutrophils and macrophages,
regardless of the origin and phenotype of the cells used to establish
the cultures. Consistent with the methylcellulose replating
experiments, LTC-IC assay showed that 5-FU-treated p53 /
BMCs retained the ability to generate hematopoietic colonies for a
longer time than the p53+/+ counterparts (Fig 6B).

View larger version (29K):
[in this window]
[in a new window]
| Fig 6.
Role of p53 in HSC exhaustion. (A) Number of colonies
arising from 104 Lin Sca-1+
c-Kit+ CD34low/ (upper panel) or
Lin Sca-1+ c-Kit+
CD34high/+ (lower panel) cells passaged every 10 days in
methylcellulose semisolid medium containing KL, IL-3, and Epo. Results
are mean (standard deviation) from three experiments. (B) BMCs were
cocultured on irradiated stromal layers and clonogenic activity was
measured every 2 weeks in the presence of KL. Results are mean
(standard deviation) from two independent experiments (3 mice per
experiment). (C) CFU-S and pre-CFU-S were counted on day 12 after BMC
transplantation. Mean (standard deviation) from six mice. * Only
microscopic colonies were present. Black and shadowed bars represent
results from p53+/+ and p53 / cells, respectively.
|
|
The effect of p53 on 5-FU-induced exhaustion of primitive HSCs was
also examined in spleen colony formation assays. Thus, 105
BMCs obtained from p53 / and p53+/+ mice 6 days after 5-FU
treatment were injected into TBI recipients and 12 days later CFU-S
were scored. A total of 105 BMCs harvested from the mice
used to examine CFU-S formation were retransplanted into secondary
TBI-treated recipients and pre-CFU-S were counted 12 days later. p53
had only a moderate effect on the number of CFU-S formed by post-5-FU
BMCs (Fig 6C). Morphological analysis of the colonies showed no major
differences. Numerous large pre-CFU-S were formed by post-5-FU
recovering p53 / BMCs in secondary recipients (Fig 6C),
whereas p53+/+ marrow cells did not form classical pre-CFU-S, although
numerous microscopic nodules of hematopoiesis were noted. At low power,
microscopy of p53 / pre-CFU-S showed large cellular
nodules obliterating normal splenic architecture. At high power,
colonies composed of both erythroid and myeloid cells, with the latter
showing partial inhibition of maturation, were evident. In contrast,
evaluation of the p53+/+ microscopic nodules showed an overall,
preserved architecture of the spleen with small, but numerous, cellular aggregates. High power view (×600) showed mixed hematopoietic cell populations with a preponderance of erythroid precursors and a
smaller number of myeloid cells. No difference in CFU-S- and
pre-CFU-S-forming ability was found in p53+/+ and p53 /
BMCs obtained from mice not treated with 5-FU (data not shown).
Together, the above results indicate that the absence of p53 is
responsible for the increased number of HSCs and the decreased rate of
exhaustion of the HSC pool after treatment with 5-FU.
Role of p53 in the recovery of lineage-specific progenitors after
5-FU treatment in vivo.
Morphological analysis of p53+/+ and p53 / BMCs recovering
after 5-FU treatment showed the presence of all major lineage-specific precursors for myelopoiesis, erythropoiesis, megakaryopoiesis, and
lymphopoiesis (data not shown). Consistent with those findings, immunophenotyping analysis of these cell populations showed no statistically significant differences in the percentage of the following single-stained cell populations: B220+ and
Ig+ cells (B lymphocytes and their precursors),
CD3+ cells (T cells), TER-119+ cells (erythroid
precursors), Mac-1 (myeloblasts and monocytes), F4/80+
(monocytes and macrophages), and Gr-1+ (granulocytes; data
not shown). These data suggest that the p53 status does not affect the
differentiation of post-5-FU regenerating marrow cells.
To analyze the effect of p53 on the proliferative potential of various
lineage-specific precursors in BMCs regenerating after 5-FU treatment,
in vitro clonogenic assays were performed in the presence of several
growth factors. The colony-forming ability of myeloid (CFU-GM with
IL-3), erythroid (BFU-E with KL + Epo), megakaryocytic (CFU-Meg with
IL-6 + Epo), B-lymphocytic (B-CFU with IL-7) and T-lymphocytic (T-CFU
with IL-2) precursors, as well as of stromal cells (CFU-F) was higher
in post-5-FU regenerating p53 / than in p53+/+ BMCs
(Fig 7).

View larger version (34K):
[in this window]
[in a new window]
| Fig 7.
Clonogenic activity of various hematopoietic progenitors
and stromal cells in bone marrows of p53+/+ (black bars) and
p53 / (shadowed bars) mice analyzed on days 0, 2, 4, and 6 after
5-FU treatment. Results are mean (standard deviation) from three
independent experiments. Y axis, number of colonies; X axis, days after
5-FU treatment.
|
|
 |
DISCUSSION |
The regeneration of mature blood cells after cytotoxic treatment
results from the proliferative activity of a small number of HSCs that
have a high, but limited, capacity for self-renewal.22,23 Despite much recent progress in identifying cytokines that regulate the
proliferation of HSCs and lineage-specific descendants after cytoreductive therapy, the genetic mechanism responsible for the intrinsic control of self-renewal and differentiation of these cells
remains largely undefined. Increasing evidence points to the importance
of the p53 tumor suppressor gene in regulating hematopoiesis.2-7 Using marrow cells from p53 knockout and
wild-type mice, we found that p53 can have a profound effect on the
proliferation and exhaustion of HSCs as well as on the proliferation of
lineage-specific precursors in bone marrow regenerating after 5-FU
treatment. However, p53 had no measurable effects on lineage
determination and differentiation of these cells. Nevertheless, this
5-FU-induced dysregulation of cell growth does not appear to lead to
leukemia and is not translated into any altered output of mature blood
cells or altered commitment to any specific blood cell lineage, at
least during our period of observation (5 months). Our data also
suggest that other regulatory mechanisms involving
p16INK4a and WAF-1 may compensate the loss of
function of p53. The changes that occur in the stem cell population
during the recovery from 5-FU treatment seem likely to reflect relevant
physiological processes that are important during bone marrow
transplantation and chemotherapy procedures.
Randall and Weissman24 reported that after 5-FU treatment,
the number of HSCs (Lin Sca-1+
c-Kit+ Thy1.1low) in p53+/+ mice begins to
increase on day 2, and approximately 50% of these cells are in
S/G2/M phase on day 6. Thus, BMCs for most of our studies
were collected on day 6 after 5-FU injection. The finding that fewer
p53 / BMCs regenerating after 5-FU treatment are required
to rescue long-term hematopoiesis in TBI-treated recipient mice
suggests that these cells contain more HSCs than their p53+/+
counterparts. Indeed, the percentage of Lin
Sca-1+ c-Kit+ cells, which are highly enriched
with HSCs,21 was almost threefold higher in
p53 / than in p53+/+ BMCs recovering after 5-FU treatment. No differences were observed in untreated mice. However, the pool of
HSCs can be subdivided into long-term reconstituting primitive HSCs
(p-HSCs), with extensive self-renewal capacity, and transiently repopulating HSCs (t-HSCs) that only self-renew in mice for 3 to 6 weeks.25 Both populations are essential, at different
times, for the rescue of hematopoiesis in TBI-treated animals.
Recently, the immunophenotype of both populations have been
determined15 as Lin Sca-1+
c-Kit+ CD34low/ (p-HSCs) and
Lin Sca-1+ c-Kit+
CD34high/+ (t-HSCs). We found that the percentage of p-HSCs
in p53 / and p53+/+ BMC populations is similar after 5-FU
administration and also in untreated mice (data not shown). However,
5-FU was responsible for an almost fourfold increase in the percentage
of t-HSCs in p53 / BMCs as compared with p53+/+ BMCs.
Thus, it seems likely that the long-term repopulating capacity of
5-FU-treated p53 / BMCs results from the increased
content of t-HSCs, which are essential for hematopoietic recovery
during the critical initial weeks after transplantation until the p-HSC
descendants become the major source of long-term hematopoiesis.
Moreover, p53 / mice contained five to eight times more
BMCs than did p53+/+ mice, so that at 6 days after 5-FU treatment the
number of p-HSCs and t-HSCs were five to eight times and 20 to 32 times
higher, respectively, in the p53 / mice. Bone marrows in
long-term reconstituted animals transplanted with a 1:1 mixture of
p53 / and p53+/+ BMCs regenerating after 5-FU contained
90% to 99% of p53 / cells. Thus, even if the percentage of p-HSCs is similar in 5-FU-treated p53 / and p53+/+
mice, the long-term repopulating activity of the former cells is much
higher, possibly because of the increased production of t-HSCs.
Apparently, p53 plays an important role in BMC regeneration after 5-FU
treatment by controlling not only the total number of p-HSCs in the
organism, but also the production of their early descendants, t-HSCs,
which represent the "functional" subpopulation responsible for
the actual repopulation.
Because the increased production of t-HSCs may reduce the pool of
p-HSCs, we investigated the role of p53 in the exhaustion of the HSC
pool after 5-FU treatment. Unfortunately, we could not use the in vivo
BMC serial retransplantation assay, because most of the mice
transplanted with p53 / BMCs developed lymphomas after 5 to 6 months, consistent with previous observations.1,26 Therefore, we used an in vivo pre-CFU-S assay and in vitro LTC-IC and
methylcellulose replating assays. Although p53 / and
p53+/+ BMCs after 5-FU treatment developed similar numbers of CFU-S
only p53 / BMCs regenerated cells forming pre-CFU-S.
Thus, p53 expression facilitates the exhaustion of cells forming
pre-CFU-S, which are believed to belong to the p-HSC
pool.27 LTC-IC assay and methylcellulose replating assay
confirmed the longer duration of colony-forming ability in
p53 / than in p53+/+ HSCs regenerating after 5-FU. In
summary, both in vivo and in vitro assays showed that the absence of
p53 in BMCs regenerating after 5-FU treatment not only increases the
pool of HSCs, but also delays their exhaustion. The increase of the
total number of p-HSCs in p53 / mice after 5-FU treatment may reflect the reduced sensitivity to apoptosis and increased proliferative capacity of p53 / BMCs. The quiescent state
of most p-HSC28 may explain the absence of any difference
in the percentage of these cells after 5-FU treatment.
In contrast, most t-HSCs may represent
cycling cells and, because p53 / cells have a
proliferative advantage, the total number as well as the percentage of
those cells in BMCs regenerating after 5-FU treatment is increased in p53 / mice as compared with p53+/+ mice. In accord with
this hypothesis, p53 / BMCs recovering after 5-FU
treatment displayed a much higher multilineage clonogenic activity in
the presence of growth factors. This effect appeared to rest in the
proliferative advantage of p53 / cells rather than the
different number of precursor cells, because immunophenotypic analysis
showed no significant differences in the content of lineage-specific
precursors in p53 / and p53+/+ BMCs. It is also possible
that in the absence of p53, the production of t-HSCs from p-HSCs is
increased by a different unknown mechanism.
Our results suggest that p53 is a key regulator of the proliferation of
hematopoietic progenitor cells responsible for long- and short-term
repopulation, whereas it does not affect lineage determination and
differentiation of committed progenitor/precursor cells. These findings
raise the possibility that the manipulation of p53 expression might
delay the decline of HSCs that occurs after chemotherapy and/or
bone marrow transplantation.
 |
FOOTNOTES |
Submitted July 7, 1997;
accepted November 29, 1997.
Supported in part by NIH grants to A.M.G. and B.C. and by R29 CA70815
grant and Elisa U. Pardee grant to T.S.
Address reprint requests to Thomas Skorski, MD, PhD,
Department of Microbiology and Immunology, Kimmel Cancer Institute,
Thomas Jefferson University, 372 JAH, 1020 Locust St, Philadelphia, PA 19107.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. section 1734 solely to indicate this fact.
 |
ACKNOWLEDGMENT |
We thank David Dicker for technical assistance in cell sorting.
 |
REFERENCES |
1.
Donehower LA,
Harvey M,
Slagle BL,
McArthur MJ,
Montgomery Jr CA,
Butel JS,
Bradley A:
Mice deficient for p53 are developmentally normal but susceptible to spontaneous tumours.
Nature
356:215,
1992[Medline]
[Order article via Infotrieve]
2.
Kastan MB,
Radin AI,
Kuerbitz SJ,
Onyekwere O,
Wolkow CA,
Civin CI,
Stone KD,
Woo T,
Ravindranath Y,
Craig RW:
Levels of p53 protein increase with maturation in human hematopoietic cells.
Cancer Res
51:4279,
1991[Abstract/Free Full Text]
3.
Schalusky G,
Goldfinger N,
Peled A,
Rotter V:
Involvement of wild-type p53 in pre-B-cell differentiation in vitro.
Proc Natl Acad Sci USA
88:8982,
1991[Abstract/Free Full Text]
4.
Shounan Y,
Dolnikov A,
MacKenzie KL,
Miller M,
Chan YY,
Symonds G:
Retroviral transduction of hematopoietic progenitor cells with mutant p53 promotes survival and proliferation, modifies differentiation potential and inhibits apoptosis.
Leukemia
10:1619,
1996[Medline]
[Order article via Infotrieve]
5.
Lotem J,
Sachs L:
Hematopoietic cells from mice deficient in wild-type p53 are more resistant to induction of apoptosis by some agents.
Blood
82:1092,
1993[Abstract/Free Full Text]
6.
Banerjee D,
Lenz HJ,
Schnieders B,
Manno DJ,
Ju JF,
Spears CP,
Hochhauser D,
Danenberg K,
Danenberg P,
Bertino JR:
Transfection of wild-type but not mutant p53 induces early monocytic differentiation in HL60 cells and increases their sensitivity to stress.
Cell Growth Differ
6:1405,
1995[Abstract]
7.
Jiang D,
Lenardo MJ,
Zuniga-Pflucker C:
p53 prevents maturation to the CD4+CD8+ stage of thymocyte differentiation in the absence of T cell receptor rearrangement.
J Exp Med
183:1923,
1996[Abstract/Free Full Text]
8.
Prokocimer M,
Rotter V:
Structure and function of p53 in normal cells and their aberrations in cancer cells: Projection on the hematologic cell lineages.
Blood
84:2391,
1994[Free Full Text]
9.
el-Deiry WS,
Tokino T,
Velculescu VE,
Levy DB,
Parsons R,
Trent JM,
Lin D,
Mercer WE,
Kinzler KW,
Vogelstein B:
WAF1, a potential mediator of p53 tumor suppression.
Cell
75:817,
1993[Medline]
[Order article via Infotrieve]
10.
Seto E,
Usheva A,
Zambetti GP,
Momand J,
Horikoshi N,
Weinmann R,
Levine AJ,
Shenk T:
Wild-type p53 binds to the TATA-binding protein and represses transcription.
Proc Natl Acad Sci USA
89:12028,
1992[Abstract/Free Full Text]
11.
el-Deiry WS,
Harper JW,
O'Connor PM,
Velculescu VE,
Canman CE,
Jackman J,
Pietenpol JA,
Burrell M,
Hill DE,
Wang Y,
Wiman KG,
Mercer WE,
Kastan MB,
Kohn KW,
Elledge SJ,
Kinzler KW,
Vogelstein B:
WAF1/CIP1 is induced in p53-mediated G1 arrest and apoptosis.
Cancer Res
54:1169,
1994[Abstract/Free Full Text]
12.
Lowe SW,
Schmitt EM,
Smith SW,
Osborne BA,
Jacks T:
p53 is required for radiation-induced apoptosis in mouse thymocytes.
Nature
362:847,
1993[Medline]
[Order article via Infotrieve]
13.
Miyashita T,
Reed JC:
Tumor suppressor p53 is a direct transcriptional activator of the human bax gene.
Cell
80:293,
1995[Medline]
[Order article via Infotrieve]
14.
Weinberg WC,
Azzoli CG,
Kadiwar N,
Yuspa SH:
p53 gene dosage modifies growth and malignant progression of keratinocytes expressing the v-rasHa oncogene.
Cancer Res
54:5584,
1994[Abstract/Free Full Text]
15.
Osawa M,
Hanada K,
Hamada H,
Nakauchi H:
Long-term lymphohematopoietic reconstitution by a single CD34-low/negative hematopoietic stem cell.
Science
273:242,
1996[Abstract]
16.
Skorski T,
Szczylik C,
Ratajczak MZ,
Malaguarnera L,
Gewirtz AM,
Calabretta B:
Growth factor-dependent inhibition of normal hematopoiesis by N-ras antisense oligodeoxynucleotides.
J Exp Med
175:743,
1992[Abstract/Free Full Text]
17.
Burstein S,
Friese P,
Downs T,
Mei R:
Characteristics of a novel rat anti-mouse platelet monoclonal antibody: Application to studies of megakaryocytes.
Exp Hematol
20:1170,
1992[Medline]
[Order article via Infotrieve]
18.
Skorski T,
Kanakaraj P,
Nieborowska-Skorska M,
Ratajczak MZ,
Wen SC,
Zon G,
Gewirtz AM,
Perussia B,
Calabretta B:
Phosphatidylinositol-3 kinase activity is regulated by BCR/ABL and is required for the growth of Philadelphia chromosome-positive cells.
Blood
86:726,
1995[Abstract/Free Full Text]
19.
Ratajczak MZ,
Gerwitz AM,
Civin CI:
STK-1, the human homologue of Flk2/Flt-3, is selectively expressed in CD34+ human bone marrow cells and is involved in proliferation of early progenitor/stem cells.
Proc Natl Acad Sci USA
91:459,
1994[Abstract/Free Full Text]
20.
Kastan MB,
Onyekwere O,
Sidransky D,
Vogelstein B,
Craig RW:
Participation of p53 protein in the cellular response to DNA damage.
Cancer Res
51:6304,
1991[Abstract/Free Full Text]
21.
Moore KA,
Ema H,
Lemischka R:
In vitro maintenance of highly purified, transplantable hematopoietic stem cells.
Blood
89:4337,
1997[Abstract/Free Full Text]
22.
Harrison DE,
Astle CM:
Loss of stem cell repopulating ability upon transplantation. Effects of donor age, cell number, and transplantation procedure.
J Exp Med
156:1767,
1982[Abstract/Free Full Text]
23.
Mauch P,
Hellman S:
Loss of hematopoietic stem cell self-renewal after bone marrow transplantation.
Blood
74:872,
1989[Abstract/Free Full Text]
24.
Randall T,
Weissman IL:
Phenotypic and functional changes induced at the clonal level in hematopoietic stem cells after 5-fluorouracil treatment.
Blood
89:3596,
1997[Abstract/Free Full Text]
25.
Morrison SJ,
Weissman IL:
The long-term repopulating subset of hematopoietic stem cells is deterministic and isolatable by phenotype.
Immunity
1:661,
1994[Medline]
[Order article via Infotrieve]
26.
Jacks T,
Remington L,
Williams BO,
Schmitt EM,
Halachmi S,
Bronson RT,
Weinberg RA:
Tumor spectrum analysis in p53-mutant mice.
Current Biology
4:1,
1994 [Medline]
[Order article via Infotrieve]
27.
Down JD,
Ploemacher RE:
Transient and permanent engraftment potential of murine hematopoietic stem cell subsets: Differential effects of host conditioning with gamma radiation and cytotoxic drugs.
Exp Hematol
21:913,
1993[Medline]
[Order article via Infotrieve]
28.
Lerner C,
Harrison DE:
5-Fluorouracil spares hemopoietic stem cells responsible for long-term repopulation.
Exp Hematol
18:114,
1990[Medline]
[Order article via Infotrieve]

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
P. G. Fuhrken, P. A. Apostolidis, S. Lindsey, W. M. Miller, and E. T. Papoutsakis
Tumor Suppressor Protein p53 Regulates Megakaryocytic Polyploidization and Apoptosis
J. Biol. Chem.,
June 6, 2008;
283(23):
15589 - 15600.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Grinstein, Y. Du, S. Santourlidis, J. Christ, M. Uhrberg, and P. Wernet
Nucleolin Regulates Gene Expression in CD34-positive Hematopoietic Cells
J. Biol. Chem.,
April 27, 2007;
282(17):
12439 - 12449.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Faiola, E. S. Fuller, V. A. Wong, L. Pluta, D. J. Abernethy, J. Rose, and L. Recio
Exposure of Hematopoietic Stem Cells to Benzene or 1,4-Benzoquinone Induces Gender-Specific Gene Expression
Stem Cells,
September 1, 2004;
22(5):
750 - 758.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Calabretta and D. Perrotti
The biology of CML blast crisis
Blood,
June 1, 2004;
103(11):
4010 - 4022.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R Okazaki, A Sakai, A Ootsuyama, T Sakata, T Nakamura, and T Norimura
Trabecular bone mass and bone formation are preserved after limb immobilisation in p53 null mice
Ann Rheum Dis,
April 1, 2004;
63(4):
453 - 456.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Vadhan-Raj, S. Patel, C. Bueso-Ramos, J. Folloder, N. Papadopolous, A. Burgess, L. D. Broemeling, H. E. Broxmeyer, and R. S. Benjamin
Importance of Predosing of Recombinant Human Thrombopoietin to Reduce Chemotherapy-Induced Early Thrombocytopenia
J. Clin. Oncol.,
August 15, 2003;
21(16):
3158 - 3167.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Dainiak, J. K. Waselenko, J. O. Armitage, T. J. MacVittie, and A. M. Farese
The Hematologist and Radiation Casualties
Hematology,
January 1, 2003;
2003(1):
473 - 496.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Stahnke, S. Fulda, C. Friesen, G. Strau{beta}, and K.-M. Debatin
Activation of apoptosis pathways in peripheral blood lymphocytes by in vivo chemotherapy
Blood,
November 15, 2001;
98(10):
3066 - 3073.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. I. Pestina, J. L. Cleveland, C. Yang, G. P. Zambetti, and C. W. Jackson
Mpl ligand prevents lethal myelosuppression by inhibiting p53-dependent apoptosis
Blood,
October 1, 2001;
98(7):
2084 - 2090.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. M. Farese, W. G. Smith, J. G. Giri, N. Siegel, J. P. McKearn, and T. J. MacVittie
Promegapoietin-1a, an Engineered Chimeric IL-3 and Mpl-L Receptor Agonist, Stimulates Hematopoietic Recovery in Conventional and Abbreviated Schedules Following Radiation-Induced Myelosuppression in Nonhuman Primates
Stem Cells,
July 1, 2001;
19(4):
329 - 338.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-J. CHOI, L. MENDOZA, S.-J. RHA, D. SHEIKH-HAMAD, E. BARANOWSKA-DACA, V. NGUYEN, C. W. SMITH, G. NASSAR, W. N. SUKI, and L. D. TRUONG
Role of p53-Dependent Activation of Caspases in Chronic Obstructive Uropathy: Evidence from p53 Null Mutant Mice
J. Am. Soc. Nephrol.,
May 1, 2001;
12(5):
983 - 992.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
R. V. Iozzo, F. Chakrani, D. Perrotti, D. J. McQuillan, T. Skorski, B. Calabretta, and I. Eichstetter
Cooperative action of germ-line mutations in decorin and p53 accelerates lymphoma tumorigenesis
PNAS,
March 16, 1999;
96(6):
3092 - 3097.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Teofili, S. Rutella, R. Putzulu, C. Rumi, G. Leone, L. M. Larocca, and N. Maggiano
Expression of p53, Bcl-2, and Bax in CD34+ Cells Recovering After Chemotherapy
Blood,
December 15, 1998;
92(12):
4880 - 4881.
[Full Text]
[PDF]
|
 |
|
|
|