|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 91 No. 9 (May 1), 1998:
pp. 3182-3192
Interleukin-3-Induced Activation of the JAK/STAT Pathway Is
Prolonged by Proteasome Inhibitors
By
Bernard A. Callus and
Bernard Mathey-Prevot
From the Department of Pediatric Oncology, Dana-Farber Cancer
Institute, Boston, MA.
 |
ABSTRACT |
One facet of cytokine receptor signaling involves the activation of
signal transducers and activators of transcription (STATs). STATs are
rapidly activated via tyrosine phosphorylation by Janus kinase (JAK)
family members and subsequently inactivated within a short period. We
investigated the effect of proteasome inhibition on interleukin-3
(IL-3) activation of the JAK/STAT pathway following stimulation of
Ba/F3 cells. Treatment of Ba/F3 cells with the proteasome inhibitor,
N-acetyl-L-leucinyl-L-leucinyl-norleucinal (LLnL), led to stable tyrosine phosphorylation of the IL-3 receptor, beta common ( c), and STAT5 following stimulation. The effects of
LLnL were not restricted to the JAK/STAT pathway, as Shc and mitogen-activated protein kinase (MAPK) phosphorylation were also prolonged in LLnL-treated cells. Further investigation showed these
stable phosphorylation events were the result of prolonged activation
of JAK2 and JAK1. These observations were confirmed using pharmacologic
inhibitors. In the presence of LLnL, stable phosphorylation of STAT5
and c was abrogated if the tyrosine kinase inhibitor, staurosporine,
was added. The effect of staurosporine on STAT5 phosphorylation could
be overcome if the phosphatase inhibitor, vanadate, was also added,
suggesting phosphorylated STAT5 could be stabilized by phosphatase, but
not by proteasome inhibition per se. These observations are consistent
with the hypothesis that proteasome-mediated protein degradation can
modulate the activity of the JAK/STAT pathway by regulating the
deactivation of JAK.
| |
INTRODUCTION |
THE ROLE(S) OF UBIQUITINATION
and/or proteolytic degradation of proteins by the 20S and 26S
proteasomes have received increased attention during recent years, and
it is now apparent these two processes provide an additional point of
regulation for many fundamental biologic functions.1,2
Ubiquitin-dependent proteolysis has been shown to be integral in the
following: the degradation of cyclins and cell-cycle
progression3-7; the generation of peptides presented on the
cell surface by major histocompatability complex (MHC) class I
molecules8; and the modulation of several transcriptional
regulators, including c-Jun9 and
I B,10-14 as well as the processing and activation of the Rel family member, NF-B.14 Recently,
ubiquitination has also been shown to signal receptor-mediated
endocytosis of the yeast G-protein receptor, Ste2p,15 and
has been implicated in downmodulating c-kit receptor
expression.16 Consequently, it is conceivable to expect
many biochemical pathways to be affected by ubiquitin-dependent proteolysis, including the signaling cascades of cytokine receptors.
Interleukin-3 (IL-3) signaling pathways have been well characterized
and constitute a useful model for growth factor signaling. One of the
first signaling events, following IL-3 stimulation, is the increased
tyrosine phosphorylation of and subsequent activation of the
receptor-associated protein tyrosine kinase, Janus kinase-2 (JAK2).17-22 The newly activated JAK2 mediates the
subsequent phosphorylation of tyrosine residues within the beta-chain
of the IL-3 receptor.19,20,23-25 Activation of JAK1 by IL-3
has also been reported albeit to a lesser extent when compared with
JAK2 activation.17 The phosphotyrosine residues of the beta
subunit provide docking sites for signal transducers and activators of
transcription (STATs).26,27 STATs bind to the activated
receptors, via their SH2 domains, upon which they are phosphorylated on
a single tyrosine residue C-terminal to its SH2 domain by
JAK.28,29 Phosphorylated STATs dissociate from the
receptor, homodimerize or heterodimerize, and translocate to the
nucleus, where they bind specific DNA elements to activate transcription of target genes.30 IL-3 stimulation
predominantly leads to the activation of STAT531-34 and
induces the expression of several genes, including cytokine-inducible
SH2-containing protein (CIS), pim-1, osm, and
c-fos.32 Although the activation of STATs is well
understood, this is not so for their inactivation. The most likely
model is that STATs are negatively regulated by dephosphorylation, a
process that probably occurs within the nucleus.35 The
identification of the phosphatase(s) that catalyze this reaction has
been actively pursued, but to date has remained elusive.
Recently, however, another model for the negative regulation of STATs
has been proposed. Using specific inhibitors of the proteasome, active
or phosphorylated STAT1 has been shown to be stabilized following
interferon-gamma (IFN- ) stimulation.36 Furthermore, this
study identified ubiquitinated forms of phospho-STAT1, suggesting that
active STAT1 was inactivated by ubiquitin-mediated proteolysis within
the 26S proteasome. The proteasome has been shown to degrade several
phosphorylated proteins, including IB,10-13 cyclin
G1,6,7 and SHP-1,37 via a
ubiquitination-dependent pathway, and provides an attractive alternate
mechanism by which the cell could downregulate STAT activity.
To determine which of these models play a role in STAT5 regulation, we
investigated STAT5 inactivation in the IL-3-dependent hematopoietic
progenitor cell line, Ba/F3.38 STAT5 is rapidly activated by IL-3 and accumulation of the activated protein reaches a
maximum within 30 minutes of stimulation and then declines to baseline
levels within 1 to 2 hours.31-34 The relatively short half-life of activated STAT5 indicates that the transcription factor's
activity is tightly regulated and reduces the likelihood of the cell
accumulating harmful levels of gene products. To examine the effect on
IL-3-induced activation of the JAK/STAT5 pathway and whether STAT5
might also be proteolytically degraded, we treated Ba/F3
cells with the proteasome-specific inhibitor,
N-acetyl-L-leucinyl-L-leucinyl-norleucinal (LLnL),8 and investigated the effect of proteasome
inhibition on JAK/STAT5 activation, as well as tyrosine phosphorylation
of beta common (c) following IL-3 stimulation. The results presented here show treatment of Ba/F3 cells with LLnL resulted in
prolonged activation of the JAK/STAT5 pathway as a consequence of
prolonged JAK phosphorylation/activation.
| |
MATERIALS AND METHODS |
Chemicals and antibodies.
Recombinant murine IL-3 was purchased from R&D (Minneapolis, MN). LLnL,
staurosporine, and sodium orthovanadate were obtained from Sigma (St
Louis, MO). LLnL and staurosporine were dissolved in dimethylsulfoxide
(DMSO) and used at final concentrations of 50 µmol/L and 500 nMol/L,
respectively. Sodium orthovanadate was prepared in phosphate-buffered
saline (PBS) and used at a final concentration of 1 mmol/L.
Sulfo-NHS-LC-Biotin was purchased from Pierce (Rockford, IL).
Antiphosphotyrosine-STAT5 sera was a generous gift from David Frank
(Dana-Farber Cancer Institute, Boston, MA). Anti-STAT5b (sc-835)
antibody was purchased from Santa Cruz (Santa Cruz, CA). The
horseradish peroxidase (HRP)-conjugated antiphosphotyrosine (anti-ptyr)
antibody, RC20, and anti-Shc polyclonal antibody were obtained from
Transduction Laboratories (Lexington, KY). For immunoprecipitations of
c, an anti-c C-terminal monoclonal antibody was obtained from
Jan Tavernier (Flanders Interuniversity Institute of Biotechnology, Ghent, Belgium), while a different anti-c C-terminal polyclonal antibody (sc-678; Santa Cruz) was used for Western blotting.
Immunoprecipitations of JAK1 and JAK2 were performed with antibodies
from UBI (Lake Placid, NY), while Western blotting was performed with
antibodies from UBI and Santa Cruz (HR-758), respectively. p44/42 MAPK
(#9102) and phosphospecific-p44/42 MAPK (#9101) were purchased from New England Biolabs (Beverly, MA).
Cell culture.
Ba/F3 cells were grown continuously in suspension culture
in RPMI 1640 medium supplemented with 10% (vol/vol) fetal bovine serum
(Hyclone, Logan, UT), penicillin G (50 U/mL), streptomycin (50 µg/mL), L-glutamine (2 mmol/L), and murine IL-3 (0.5 ng/mL) in a humidified atmosphere of 5% CO2 at 37°C.
Cell extracts, immunoprecipitations, and sodium dodecyl sulfate
polyacrylamide electrophoresis.
Cells were washed three times with PBS and cultured for 11 hours in the
absence of IL-3. Where appropriate, LLnL was added and the culture
continued for a further 1 hour, unless otherwise indicated, before
stimulation with IL-3 (0.5 ng/mL) for 0 to 2 hours. Cells were washed
with PBS and both cytosolic and nuclear extracts were prepared as
described previously.39
For c immunoprecipitations, cells were resuspended in lysis buffer
(1% Nonidet P-40 [NP-40], 50 mmol/L Tris.HCl, pH 7.5, 150 mmol/L
NaCl, 0.5% sodium deoxycholate, 50 mmol/L NaF, 0.2 mmol/L
phenylmethylsulfonyl fluoride, 1 mmol/L Na3
VO4, 2 µg/mL aprotinin C, and 0.5 µg/mL leupeptin) and
incubated on ice for 30 minutes. Extracts were centrifuged (4°C) for
15 minutes at 13,000 rpm and resulting supernatants were used for
subsequent immunoprecipitations. Anti-c C-terminal sera (1:300) was
incubated overnight at 4°C in the presence of protein G-agarose
(Santa Cruz).40 Immune complexes were washed twice with
NP-40 lysis buffer and once with Tris-buffered saline
(TBS) before addition of 2× Laemmli sample buffer. Bound
proteins were eluted by boiling for 10 minutes and separated by sodium
dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). JAK1,
JAK2, and Shc immunoprecipitations were performed as described earlier
using protein A-Sepharose (Pharmacia, Piscataway, NJ) and the
manufacturer's recommended dilution of JAK1 or JAK2 antisera and 1 µg of anti-Shc antibody per immunoprecipitation, respectively. For
Western blots of STAT5 or phospho-STAT5, extracts were mixed with 2×
sample buffer and resolved by SDS-PAGE.
Western blotting.
Electrophoresed proteins were transferred to Immobilon-P PVDF membrane
(Millipore, Bedford, MA) and blocked with 3% bovine serum albumin
(BSA) in TBST (TBS plus 0.05% Tween 20). Antiphospho-STAT5 or
anti-STAT5b antisera were diluted 1:10,000 in 1% BSA/TBST and incubated for 1 hour at room temperature. Membranes were washed four
times with TBST and incubated with a 1:5,000 dilution of HRP-conjugated
protein A (Amersham, Arlington Heights, IL) in 1%
BSA/TBST for 30 minutes at room temperature. After four washes with
TBST, proteins were detected using enhanced chemiluminescence (ECL)
reagent (Amersham, Arlington Heights, IL). Anti-c, anti-Shc, antiphospho MAPK, and anti-MAPK blotting were similarly performed using
1:1,000 dilutions of antisera, while anti-JAK1 and anti-JAK2 blotting
were performed with 1:5,000 dilutions of antisera. For RC20 blotting,
membranes were incubated with a 1:5,000 dilution of antibody in 1%
BSA/TBST, washed four times with TBST, and developed as described
earlier. Where appropriate, membranes were stripped with a solution
containing 2% SDS, 62.5 mmol/L Tris, and 0.7% -mercaptoethanol for
30 minutes at 55°C, washed extensively with H2O and twice
with TBST, and reblocked with 3% BSA/TBST before addition of primary
antibody.
Surface biotinylation.
A total of 5 × 107 cells were washed three times in
ice-cold PBS (pH 8.0) and resuspended in 1 mL of freshly prepared
biotin/PBS (1 mg/mL). Cells were covered with foil and rotated for 40 minutes at 4°C. To stop biotinylation, cells were washed six times
with ice-cold PBS (pH 8.0) supplemented with 0.15% (wt/vol) glycine. Cells were lysed in NP-40 lysis buffer and immunoprecipitations of c
performed as described earlier. Detection of biotinylated protein was
achieved by Western blotting with streptavidin:HRP (Amersham) diluted
1:25,000 in 1% BSA/TBST.
Electrophoretic mobility shift assay.
Samples (5 µg) of nuclear extracts (described earlier) were used for
electrophoretic mobility shift assay (EMSA). EMSA was performed with a
STAT5 oligonucleotide probe from the -casein promoter element (top
strand 5 GTAGATTTCTAGGAATTCAAA3) as described
previously.34 After a 20-minute incubation on ice with
32P-labeled probe, samples were electrophoresed on 6%
nondenaturing polyacrylamide gels in 0.5× Tris/borate/EDTA (TBE)
buffer. Gels were dried and subjected to autoradiography.
Phosphatase assay.
Nonradioactive tyrosine phosphatase assay kit, Cat. No. 1 534 513, was
purchased from Mannheim Boehringer (Indianapolis, IN). Cells were
washed once with PBS before NP-40 lysis (1% NP-40, 50 mmol/L Tris.HCl,
pH 7.5, 150 mmol/L NaCl, 0.5% sodium deoxycholate, 50 mmol/L NaF, 0.2 mmol/L phenylmethylsulfonyl fluoride, 2 µg/mL aprotinin C, and 0.5 µg/mL leupeptin). After 30 minutes, extracts were centrifuged (4°C)
for 15 minutes at 13,000 rpm. Supernatants were diluted with lysis
buffer to the equivalent of 105 cells in a 20-µL volume.
Preliminary experiments determined this dilution to be optimal. Total
phosphatase activity in 20-µL aliquots was assayed according to the
manufacturer's protocol over 15-minute intervals at 37°C.
| |
RESULTS |
To examine the effect of proteasome inhibition on IL-3 signaling, the
tyrosine phosphorylation pattern of the IL-3 receptor beta-subunit,
c, was determined following IL-3 stimulation of IL-3-depleted
Ba/F3 cultures in both the presence and absence of LLnL. In
the absence of LLnL, immunoprecipitations from unstimulated cells
resulted in the detection of a single tyrosine-phosphorylated band,
suggesting that c was phosphorylated in the basal state (Fig
1A). The addition of IL-3 induced the
appearance of an upper band, indicating that c was being converted
into a highly phosphorylated form. This upper band was transiently
induced by IL-3 and was maximal within 30 minutes of stimulation. In
contrast, the presence of LLnL stabilized the transient nature of this
upper band of phosphorylated c. After stimulation with IL-3, the
slower migrating species of c was strongly induced and over the
course of the experiment did not lose signal intensity. Furthermore,
the results from several experiments showed that pretreatment with LLnL
consistently resulted in a higher degree of tyrosine phosphorylation
following IL-3 stimulation compared with untreated cells. Reblotting
with an anti-c antibody showed an equivalent amount of
immunoreactive protein in all samples, ruling out the possibility that
LLnL had affected the stability of c (data not shown). Thus, one
effect of LLnL is to stabilize the tyrosine phosphorylation of c.
View larger version (50K):
[in this window]
[in a new window]
| Fig 1.
LLnL stabilizes tyrosine phosphorylation of c and
STAT5. IL-3-depleted Ba/F3 cells were treated with or
without LLnL for 3 hours as indicated, then stimulated with IL-3 for 0 to 2 hours. (A) c immune complexes (5 × 107 cells)
were separated by SDS-PAGE (7% gel), transferred, and immunoblotted
with RC20 (anti-ptyr) antibody. (B) Nuclear extracts from a separate
experiment were prepared and the binding to 32P-labeled
oligonucleotide STAT5 probe determined. (C) The same extracts as in B
(75 µg) were separated by SDS-PAGE (7.5% gel), transferred, and
immunoblotted with a specific anti-phosphotyrosine-STAT5 antisera. (D)
NP-40 extracts (50 µg) from a similar experiment were separated by
SDS-PAGE (6% gel), transferred, and immunoblotted with anti-STAT5b
antibody. In panels A through D, the position of relevant bands are
indicated.
|
|
Because IL-3 is known to activate STAT5,31-34 we then
examined the effect of LLnL on STAT5 activity. In the absence of
proteasome inhibitor, IL-3 induced a rapid nuclear accumulation of
STAT5 DNA-binding activity, which was maximal within 30 minutes of
stimulation (Fig 1B). DNA-binding activity then declined to near
baseline levels over the next 90 minutes. We have previously shown that the complex bound to this probe can be specifically competed with excess unlabeled oligonucleotide and supershifted with an anti-STAT5 antisera.34 In the presence of LLnL, IL-3 still induced a
rapid accumulation in STAT5 DNA-binding activity. However, the
subsequent decrease in DNA-binding activity was not observed and, if
anything, DNA binding tended to increase over the 2-hour period (Fig
1B).
The effects of LLnL on STAT5 regulation were confirmed by Western
analysis of nuclear extracts using a specific antibody raised against
the phosphotyrosine of STAT5.41,42 As seen in Fig 1C, the
pattern of phospho-STAT5 immunoreactivity was consistent with that of
DNA-binding activity. We also observed a slightly smaller immunoreactive protein that was coordinately regulated with the wild-type STAT5 protein and likewise was stabilized in the presence of
LLnL. This smaller protein was not always observed in phospho-STAT5 blots and may represent the activation of a C-terminally truncated isoform of STAT5, as it was not immunoreactive with a C-terminal anti-STAT5 antibody (data not shown).
The pattern of total STAT5 immunoreactivity from NP-40 cellular
extracts was also consistent with STAT5 DNA-binding activity and
phosphotyrosine-STAT5 immunoreactivity (Fig 1D). In the absence of
stimulation, both LLnL-treated and control cells gave rise to a single
immunoreactive band, which represents nonphosphorylated STAT5 (data not
shown).43 Upon stimulation with IL-3, there was induction
of slower migrating band(s), most likely composed of both the tyrosine-
and serine-phosphorylated forms of STAT5.43 In the absence
of LLnL, the total STAT5 signal was split between the two bands. The
upper band, representing phosphorylated STAT5, was maximally induced
with IL-3 by 15 minutes. This band was then titrated back into the
faster migrating species over the next 105 minutes. In the presence of
LLnL, the accumulation of the upper band was not transient, but
persisted over the entire time course. Importantly, under both
conditions, the total STAT5 immunoreactivity remained constant over the
time course of the experiment. Together, these results show that LLnL
treatment also results in stabilization of IL-3 downstream signaling
events, namely, STAT5 activation. Furthermore, these results argue in
favor of a specific phosphatase inactivating STAT5, and suggest that
dephosphorylation of STAT5 in the absence of LLnL is not the result of
indiscriminate dephosphorylation upon cell lysis.
We considered the possibility that the influence of LLnL on IL-3
signaling could have been the result of an indirect effect due to the
relatively long preincubation period or to the presence of carrier
(DMSO) used in the previous experiments. The use of a shorter, 1-hour
pretreatment with LLnL proved to be as effective as the longer 3-hour
period in stabilizing the tyrosine phosphorylation of both c and
STAT5 (Fig 2) and had negligible effects on cell viability.
Pretreatment with carrier alone resulted in normal phosphorylation
kinetics (compare Figs 1 and 2). That LLnL
is relatively fast-acting suggests its mechanism of action is specific and not due to general cell toxic effects.
View larger version (27K):
[in this window]
[in a new window]
| Fig 2.
Stable tyrosine phosphorylation of c and STAT5
requires only a short treatment with LLnL. IL-3-depleted
Ba/F3 cells were treated with LLnL or carrier (DMSO) for 1 or 3 hours as indicated, then stimulated with IL-3 for 0 to 2 hours.
c immune complexes (107 cells) were separated by
SDS-PAGE (7% gel), transferred, and immunoblotted with RC20 antibody.
Whole-cell extracts were also prepared by lysis in 0.1% SDS and
25-µg samples were separated by SDS-PAGE (6% gel), transferred, and
immunoblotted with anti-STAT5b antibody. The position of phospho-c,
pSTAT5, and nonphosphorylated STAT5 is indicated.
|
|
In yeast, the role of ubiquitination in the internalization of Ste2p
following  -factor stimulation has been demonstrated.15 Therefore, since ubiquitinated forms of growth hormone
receptor44 and c-kit16 have been
detected and postulated to be important in modulating signaling, we
hypothesized that c might also be ubiquitinated following IL-3
stimulation and that LLnL treatment may somehow prevent this
modification or the subsequent internalization of c, leading to a
prolonged signal. We failed to detect laddering or smearing typical of
multiubiquitinated proteins. However, close inspection of c
immunoblots following stimulation shows that in highly phosphorylated
lanes, the slower migrating species has a shadow band, which might
represent a further modified, possibly monoubiquitinated, receptor
(Figs 1A and 3). The lack of a
good anti-ubiquitin antibody prevented us from examining this
possibility more directly. Nevertheless, we attempted cell-surface
biotinylation experiments to see whether LLnL prevented c
internalization. Initial experiments failed to provide any evidence of
receptor internalization in untreated cells. This may have been a
consequence of using low concentrations of IL-3, which might only
activate a small fraction of the surface receptor pool, thereby making it difficult to detect receptor internalization. An IL-3 dose-response experiment was performed and showed that maximal surface receptor activation, as evident by c phosphorylation, was obtained at a
concentration of 5 ng/mL (Fig 3A). Using this concentration of IL-3, we
performed cell-surface biotinylation experiments. As shown in Fig 3B,
the effect of LLnL on the stabilization of c phosphorylation is more
pronounced at a stimulating IL-3 concentration of 5 ng/mL (lanes 1 to
6) compared with 0.5 ng/mL (lanes 7 to 10). After stripping and
reblotting with streptavidin, the biotinylation pattern of surface c
receptors did not appear to be significantly altered by LLnL treatment
(Fig 3B). Furthermore, this result suggests that the receptor is not
being degraded following stimulation, since under IL-3 concentrations
that maximally activate the cell-surface receptor pool, no significant
loss in signal was detected.
View larger version (18K):
[in this window]
[in a new window]
View larger version (30K):
[in this window]
[in a new window]
| Fig 3.
The effect of LLnL on surface biotinylation of c. (A)
Ba/F3 cells were depleted of IL-3 for 12 hours then
stimulated with IL-3 (0.5 to 15 ng/mL) for 0 to 2 hours as indicated.
c immune complexes (107 cells) were separated by
SDS-PAGE (7% gel), transferred, and immunoblotted with RC20 antibody.
(B) IL-3-depleted Ba/F3 cells were treated with LLnL or
carrier for 1 hour and stimulated with IL-3 for 0 to 2 hours before
cell-surface biotinylation was performed. c immune complexes
(5 × 107 cells) were separated by SDS-PAGE (7% gel),
transferred, and immunoblotted with RC20 antibody. After stripping, the
membrane was reblotted with streptavidin:HRP. The position of
phospho-c and biotinylated-c is indicated.
|
|
At this point, we turned our attention to the activity of JAKs. Using
the pharmacologic inhibitors, staurosporine and orthovanadate, we tried
to determine whether JAK was a target of LLnL. To this end,
Ba/F3 cells were stimulated with IL-3 in the presence of LLnL. After 30 and 60 minutes of stimulation, either staurosporine, vanadate, or both were added to the culture and incubation continued for a further 60 minutes. Again, addition of LLnL stabilized the DNA-binding activity of STAT5 at both 90 and 120 minutes (Fig 4A; data not shown). When staurosporine was
added, it abolished the LLnL-induced stabilization of STAT5 DNA-binding
activity at both 90 and 120 minutes. The addition of vanadate to the
cells gave rise to an enhanced level of STAT5 DNA-binding activity
compared with LLnL alone, while the addition of both vanadate and
staurosporine gave rise to intermediate levels of DNA-binding activity
compared with either agent alone. Identical results were obtained by
Western analysis using an antiphosphotyrosine-STAT5 antibody (Fig 4B).
View larger version (29K):
[in this window]
[in a new window]
View larger version (26K):
[in this window]
[in a new window]
| Fig 4.
Staurosporine prevents LLnL-induced stabilization of
STAT5 and c phosphorylation. IL-3-depleted Ba/F3 cells
were treated with LLnL for 3 hours then stimulated with IL-3 for 0 to 2 hours. (A) After 30 and 60 minutes stimulation, staurosporine and
vanadate were added as indicated and the incubation continued for a
further 60 minutes. Nuclear extracts were prepared and the binding to 32P-labeled oligonucleotide STAT5 probe determined. (B)
Nuclear extracts from A (25 µg) were separated by SDS-PAGE (6% gel),
transferred, and immunoblotted with antiphosphotyrosine-STAT5
antibody. (C) In a separate experiment, after 30 and 60 minutes
stimulation, staurosporine was added and the incubation continued for a
further 60 minutes. c immune complexes (107 cells) were
separated by SDS-PAGE (7% gel), transferred, and immunoblotted with
RC20 antibody. Whole-cell extracts were also prepared by lysis in 0.1%
SDS and 50 µg samples were separated by SDS-PAGE (6% gel),
transferred, and immunoblotted with anti-STAT5b antibody. In panels A
through C, the position of relevant bands are indicated.
|
|
To eliminate the possibility that staurosporine was toxic, cytosolic
extracts from the previous experiment were separated by SDS-PAGE and
anti-ptyr and total STAT5 immunoreactivity determined. Total anti-ptyr
immunoreactivity was considerably reduced in the staurosporine-treated
sample, whereas the amount of immunoreactive STAT5 was comparable with
untreated samples (data not shown). This result demonstrated that, over
the indicated time course, the effect of staurosporine was due to the
inhibition of tyrosine kinase activity and not to the accelerated loss
of protein from the cell arising from toxic effects.
Since JAK also phosphorylates c, we examined whether staurosporine
could prevent the LLnL-induced stable phosphorylation of c. As seen
in Fig 4C, the presence of staurosporine diminished the phosphorylation
signal compared with LLnL alone (compare lanes 4 with 5 and 6 with 7).
Together, these experiments indicate that the stable phosphorylation of
both c and STAT5 in the presence of LLnL requires persistent kinase
activity, suggesting the effect of LLnL is to prolong JAK activity. It
is noteworthy that staurosporine only partially decreased c
phosphorylation, while it almost completely abolished the
phosphorylation of STAT5 (Fig 4C), suggesting that the stabilization of
c phosphorylation by LLnL may not entirely be due to prolonged JAK
activity.
Both JAK1 and JAK2 have been reported to be activated by
IL-3.17-22 In our hands, preliminary experiments showed
that JAK2 was the principal kinase activated by IL-3, but some tyrosine phosphorylation of JAK1 was detected (data not shown; Fig
5). The phosphorylation of both JAK2 and
JAK1 was transient with both being induced within 30 minutes of
stimulation and declining to basal levels by 120 minutes. In contrast,
the treatment of cells with LLnL prevented the dephosphorylation of
both JAK1 and JAK2. It was possible that LLnL affected the stability of
JAK1 and JAK2; however, JAK1 and JAK2 immunoblots showed a similar
amount of protein in all samples (Fig 5). The increased total JAK1
level at 120 minutes in the presence of LLnL (Fig 5B, lane 6) is due to
an increased loading compared with other samples (data not shown).
Together, these results show that the effect of LLnL on IL-3 signaling
is to prolong the activity of JAK2 and JAK1, presumably through its
stabilizing effect on JAK tyrosine phosphorylation.
View larger version (35K):
[in this window]
[in a new window]
View larger version (33K):
[in this window]
[in a new window]
| Fig 5.
LLnL stabilizes tyrosine phosphorylation of JAK2.
IL-3-depleted Ba/F3 cells were treated with or without
LLnL as indicated, and stimulated with IL-3 (1 ng/mL) for 0 to 2 hours.
Extracts from 5 × 107 cells were immunoprecipitated with
either anti-JAK2 (A) or anti-JAK1 (B) antibodies. JAK2 immune complexes
were divided and electrophoresed on duplicate 7% SDS-PAGE gels,
transferred, and immunoblotted with either anti-JAK2 or RC20 antibodies
as indicated. JAK1 immune complexes were separated by SDS-PAGE (7%
gel), transferred, and immunoblotted with RC20 antibody, stripped, and
reblotted with anti-JAK1 antibody as indicated. The positions of JAK1,
phosphorylated JAK1 (pJAK1), JAK2, and phosphorylated JAK2 (pJAK2) are
indicated by solid arrows. The open arrow in A indicates the migration
of hemagglutinin-tagged JAK2 (HA-JAK2) expressed in COS-7 cells.
|
|
Since JAK activation is the initial event in activation of the
Ras/Raf-1/MAPK pathway, a prolonged activation of JAK should also affect components of this pathway. The adaptor molecule, Shc,
which serves as a link between receptor phosphorylation and activation
of Ras, can be phosphorylated by JAK2 in vitro45 and is phosphorylated on tyrosine in response to IL-3
stimulation.46 Therefore, we examined the effect of LLnL
treatment on Shc, as well as MAPK phosphorylation. As seen in Fig
6, treatment of cells with LLnL resulted in
a prolonged phosphorylation of both the 46- and 52-kD forms of Shc, as
well as MAPK, compared with untreated cells. The differences in
tyrosine phosphorylation were not attributable to differences in total
Shc or MAPK levels (Fig 6). Together, these data support the conclusion
that LLnL prolongs JAK activation.
View larger version (33K):
[in this window]
[in a new window]
View larger version (32K):
[in this window]
[in a new window]
| Fig 6.
LLnL stabilizes the phosphorylation of Shc and MAPK.
IL-3-depleted Ba/F3 cells were treated with or without
LLnL as indicated, and stimulated with IL-3 (1 ng/mL) for 0 to 2 hours.
(A) Extracts from 107 cells were immunoprecipitated with an
anti-Shc antibody and immune complexes were separated by SDS-PAGE (10%
gel), transferred, and immunoblotted with RC20 antibody, stripped, and
reblotted with anti-Shc antibody as indicated. (B) Whole-cell extracts
from the same experiment were also prepared by lysis in 0.5% SDS and
50-µg samples were separated by SDS-PAGE (8% gel), transferred, and immunoblotted with phosphospecific MAPK antibody, stripped, and reblotted with MAPK antibody as indicated. The position of
phosphorylated Shc (pShc), Shc, phosphorylated MAPK (pMAPK), and MAPK
are indicated.
|
|
To rule out the possibility that LLnL can directly inhibit overall
tyrosine phosphatase activity, the following experiment was performed.
Tyrosine phosphatase assays were performed in vitro on NP-40 extracts
from untreated Ba/F3 cells. As illustrated in Fig
7, neither DMSO nor LLnL affected total
tyrosine phosphatase activity in NP-40 extracts. When orthovanadate was
added to the lysate, only background levels of activity were detected.
This result demonstrates that LLnL is not functioning directly as a tyrosine phosphatase inhibitor.
View larger version (26K):
[in this window]
[in a new window]
| Fig 7.
LLnL does not inhibit tyrosine phosphatase activity.
Growing Ba/F3 cells were washed and lysed with NP-40 buffer
in the absence of vanadate. Lysate from 105 cells was
assayed for total tyrosine phosphatase activity. LLnL ( ) (50 µmol/L) or DMSO ( ) as carrier were added to the reaction at a
final concentration identical to that used when added to cell cultures.
As a positive control, orthovanadate ( ) (1 mmol/L) was also added to
inhibit phosphatase activity. Data were normalized to activity obtained
from control reactions (no additions [ ]) and each bar represents
the average of duplicate samples taken from a single experiment.
Identical results were obtained from several experiments using
different dilutions of lysate.
|
|
| |
DISCUSSION |
The results presented in this study revealed that pretreatment of
Ba/F3 cells with the proteasome inhibitor, LLnL, resulted in the sustained tyrosine phosphorylation of both the IL-3 receptor subunit, c, and STAT5 as opposed to their normal transient nature of
induced phosphorylation following stimulation. Both JAK2 and to a
lesser extent JAK1 were found to be activated by IL-3, and in the
presence of LLnL resulted in persistent tyrosine phosphorylation. Because both c and STAT5 are phosphorylated by JAK, we believe the
sustained phosphorylation of both is most likely due to the prolonged
activation of JAK (see later). LLnL required a relatively short
preincubation period to elicit its full effects on c and STAT5
phosphorylation, suggesting its effect is specific and unlikely to be
due to general effects on cell viability.
Treatment of Ba/F3 cells with LLnL also resulted in a more
prolonged activation of the Ras/Raf-1/MAPK pathway. This was
evident by the prolonged tyrosine phosphorylation of the adaptor
molecule, Shc, as well as MAPK. The effects of LLnL treatment were not
as dramatic on components of the MAPK pathway compared with those of
the JAK/STAT pathway. Despite the prolonged phosphorylation of Shc and
MAPK compared with untreated cells, both were dephosphorylated to some
extent in the presence of LLnL. This difference can be explained by the
possibility that the rates of phosphorylation and dephosphorylation may
be sufficiently different for components of the MAPK pathway such that
a sustained activation loop is not as easily established and dramatic
as it is for the JAK/STAT pathway. Nevertheless, the results obtained
with Shc and MAPK are consistent with and support the conclusion that
LLnL treatment results in prolonged activation of JAK.
It is worth noting that in the absence of LLnL, both c and STAT5
appeared to have different rates of tyrosine dephosphorylation (Figs 1
and 2). This was also evident when staurosporine was used to inhibit
JAK activity (Fig 4C). The addition of staurosporine in the presence of
LLnL almost completely abrogated the stabilizing effect of LLnL on
STAT5 phosphorylation, while the effect on c phosphorylation
resulted in only an approximate 50% reduction in signal (Fig 4C).
These observations suggest two possibilities. First, although JAK
mediates both these events, it may be that the prolonged activation of
JAK, in the presence of LLnL, accounts for the sustained
phosphorylation of STAT5, but may not be entirely responsible for
sustaining that of c, suggesting that LLnL may induce other effects
that contribute to prolonged receptor phosphorylation. In yeast,
ubiquitination of the Ste2p receptor signals its
endocytosis,15 and a recent study has demonstrated a
similar role for ubiquitin in growth hormone receptor
internalization.47 Although we found no significant effect
of LLnL on c surface biotinylation, it is possible that LLnL could
also affect receptor internalization of c and thus help prevent
signal downmodulation. Future pulse-chase experiments using
radiolabeled ligand will help to confirm or reject this possibility.
Second, the phosphatase responsible for inactivating STAT5 has yet to
be identified, whereas SHP-1 has been implicated to bind to and
dephosphorylate c.23 However, the different rates of
dephosphorylation of STAT5 and c suggest the two are likely
substrates of different phosphatases.
It has been proposed that STATs may be inactivated by proteolytic
degradation by the 26S proteasome and furthermore, ubiquitinated forms
of phosphorylated STAT1 have been identified in response to IFN
stimulation.36 However, we found no evidence to indicate that STAT5 may be inactivated via a degradative pathway involving the
26S proteasome. Preliminary experiments using an ectopically expressed
tagged ubiquitin have failed to detect ubiquitinated STAT5 (C. Hilton,
personal communication, March 1997). Although we and
others35,36,48 have shown stabilization of activated STATs
using proteasome inhibitors, this is the result of prolonged JAK
activation. This conclusion was supported by data obtained using
pharmacologic inhibitors.
LLnL failed to stabilize STAT5 activity in the presence of
staurosporine. If, as proposed, LLnL was truly stabilizing
phosphotyrosine-STAT5 by preventing its degradation, then inhibiting
further tyrosine phosphorylation of STAT5 should not affect the ability
of LLnL to stabilize that fraction of STAT5 already activated. Clearly, this was not the case (Fig 4). Rather, it appeared that LLnL induced its effects by preventing the signal for STAT5 phosphorylation from
being downmodulated. As expected, the presence of orthovanadate alone
resulted in an enhanced stabilization of STAT5 activity. Several points
in the JAK/STAT pathway could be affected by phosphatase inhibition,
leading to increased STAT5 activity, including the dephosphorylation of
either the IL-3 receptor, JAK or STAT5. The presence of vanadate offset
the effect of staurosporine, resulting in the persistence of STAT5
activity, albeit to a lesser extent than for vanadate alone (Fig 4 and
data not shown). Thus, phosphorylated STAT5 could be stabilized by
phosphatase inhibition, but not by proteasome inhibition per se. These
results support the conclusion that the accumulation of active STAT5 in
the presence of LLnL requires the persistent phosphorylation of STAT5
by JAK. By a similar argument, the LLnL-induced sustained
phosphorylation of c also requires persistent JAK activity, since
staurosporine offset LLnL's effect on c phosphorylation. The
persistent phosphorylation of c would allow STAT5 to continually
dock onto the receptor and be phosphorylated by JAK and thus establish
a persistent activation loop.
The transient nature of STAT5 activity observed in this study supports
the model that its activity is upregulated by phosphorylation and
downregulated principally by dephosphorylation (Fig 1D). Consistent with this model is the observation that naturally occurring dominant negative isoforms of STAT5 and C-terminally truncated mutants of STAT5
are stably phosphorylated in response to cytokine
stimulation,49,50 implying that the C-terminus of STAT5 is
crucial for dephosphorylation. Furthermore, the loss of
tyrosine-phosphorylated STAT5 in the combined presence of staurosporine
and LLnL suggests that the activity of the STAT5-specific phosphatase
is unaffected by proteasome inhibitors. The identification of
STAT-specific phosphatases still remains one of the outstanding
questions in the field.
The normal inactivation of JAKs could be mediated by at least two
possible mechanisms. First, dephosphorylation of JAK could lead to loss
in activity. The SH2-containing protein tyrosine phosphatases, SHP-1
and SHP-2, have been implicated in the dephosphorylation of both JAK2
and JAK1.51-55 An attractive possibility could be that
these candidate phosphatases may require proteasomal processing for
activation or at least their activity may be modulated by proteasome
function, perhaps by degrading an inhibitor complex akin to the
degradation of IB and subsequent activation of
NF-B.10-14 In support of this, SHP-1 has been shown to
be degraded by ubiquitin-dependent proteolysis in mast cells expressing
oncogenic c-kit,37 suggesting the proteasome
regulates SHP-1 function. It is possible that LLnL could
nonspecifically inhibit phosphatase activity, including that of SHP-1
and SHP-2; however, this is unlikely to be a general effect of LLnL,
since STAT5 was still dephosphorylated in the combined presence of LLnL
and staurosporine (Fig 4). Furthermore, the data presented in Fig 7
argue against the possibility that LLnL functions as a tyrosine
phosphatase inhibitor.
A second possibility involves the cytokine-induced expression of the
newly identified, CIS-related, STAT-induced STAT-inhibitor (SSI) family
of proteins.56-58 These proteins, once expressed, could
negatively feedback and inhibit JAK activity by binding to and
inactivating the kinase domain. Therefore, it is possible that LLnL's
effect on JAK activity could be a combined result of modulation of
SHP-1 or SHP-2 activity and inhibited expression of or function of SSI
family proteins.
IL-3 has also been shown to induce the deubiquitinating enzyme,
DUB-1.59 As we have shown that the proteasome can modulate JAK activity, it is possible that a deubiquitinating enzyme, such as
DUB-1, might affect JAK activity. In view of our current lack of
knowledge about DUB-1 substrate specificity, it is hard to evaluate its
role in this process. Future studies on this family of proteins should
help to address this question.
Recently, it has been shown that both JAK1 and JAK3 activities are
stabilized by proteasome inhibition following IL-2 induction of T
cells.48 The authors of that study attributed the effect on
JAK to modulation of phosphatase activity by proteasome-mediated protein degradation. Similarly, we believe that the effect on JAK by
LLnL is mediated by a similar mechanism in murine progenitor cells. In
addition, the growing body of evidence derived from multiple cell lines
activated by various cytokines suggests that the normal downregulation
of the JAK/STAT pathway following cytokine activation requires
functional proteasomes. How the proteasome modulates the deactivation
of JAK is unknown and remains the focus of future studies.
| |
FOOTNOTES |
Submitted August 28, 1997;
accepted December 15, 1997.
Supported in part by National Institutes of Health Grant No. P50
DK49216 (to B.M.-P.) and by the Genetics Institute, Cambridge, Boston,
MA (B.M.-P.).
Address reprint requests to Bernard A. Callus, PhD, Dana-Farber Cancer
Institute, Department of Pediatric Oncology, 44 Binney St,
Boston, MA, 02115.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.
| |
ACKNOWLEDGMENT |
We thank David Frank and Jan Tavernier for generously providing
antibodies. We also thank Craig Hilton for his advice and for
performing STAT5-ubiquitination studies, and Alan D. D'Andrea and
Yongjui Jin for helpful discussion.
| |
REFERENCES |
1.
Coux O,
Tanaka K,
Goldberg AL:
Structure and functions of the 20S and 26S proteasomes.
Annu Rev Biochem
65:801,
1996[Medline]
[Order article via Infotrieve]
2.
Hochstrasser M:
Ubiquitin-dependent protein degradation.
Annu Rev Genet
30:405,
1996[Medline]
[Order article via Infotrieve]
3.
King RW,
Peters JM,
Tugendreich S,
Rolfe M,
Hieter P,
Kirschner MW:
A 20S complex containing CDC27 and CDC16 catalyzes the mitosis-specific conjugation of ubiquitin to cyclin B.
Cell
81:279,
1995[Medline]
[Order article via Infotrieve]
4.
Seufert W,
Futcher B,
Jentsch S:
Role of a ubiquitin-conjugating enzyme in degradation of S- and M-phase cyclins.
Nature
373:78,
1995[Medline]
[Order article via Infotrieve]
5.
Amon A,
Irniger S,
Nasmyth K:
Closing the cell cycle circle in yeast: G2 cyclin proteolysis initiated at mitosis persists until the activation of G1 cyclins in the next cycle.
Cell
77:1037,
1994[Medline]
[Order article via Infotrieve]
6.
Deshaies RJ,
Chau V,
Kirschner M:
Ubiquitination of the G1 cyclin Cln2p by a Cdc34p-dependent pathway.
EMBO J
14:303,
1995[Medline]
[Order article via Infotrieve]
7.
Yaglom J,
Linskens MH,
Sadis S,
Rubin DM,
Futcher B,
Finley D:
p34Cdc28-mediated control of Cln3 cyclin degradation.
Mol Cell Biol
15:731,
1995[Abstract]
8.
Rock KL,
Gramm C,
Rothstein L,
Clark K,
Stein R,
Dick L,
Hwang D,
Goldberg AL:
Inhibitors of the proteasome block the degradation of most cell proteins and the generation of peptides presented on MHC class I molecules.
Cell
78:761,
1994[Medline]
[Order article via Infotrieve]
9.
Treier M,
Staszewski LM,
Bohmann D:
Ubiquitin-dependent c-Jun degradation in vivo is mediated by the delta domain.
Cell
78:787,
1994[Medline]
[Order article via Infotrieve]
10.
Miyamoto S,
Maki M,
Schmitt MJ,
Hatanaka M,
Verma IM:
Tumor necrosis factor alpha-induced phosphorylation of I kappa B alpha is a signal for its degradation but not dissociation from NF-kappa B.
Proc Natl Acad Sci USA
91:12740,
1994[Abstract/Free Full Text]
11.
Brown K,
Gerstberger S,
Carlson L,
Franzoso G,
Siebenlist U:
Control of I kappa B-alpha proteolysis by site-specific, signal-induced phosphorylation.
Science
267:1485,
1995[Abstract/Free Full Text]
12.
Traenckner EB,
Pahl HL,
Henkel T,
Schmidt KN,
Wilk S,
Baeuerle PA:
Phosphorylation of human I kappa B-alpha on serines 32 and 36 controls I kappa B-alpha proteolysis and NF-kappa B activation in response to diverse stimuli.
EMBO J
14:2876,
1995[Medline]
[Order article via Infotrieve]
13.
Chen Z,
Hagler J,
Palombella VJ,
Melandri F,
Scherer D,
Ballard D,
Maniatis T:
Signal-induced site-specific phosphorylation targets I kappa B alpha to the ubiquitin-proteasome pathway.
Genes Dev
9:1586,
1995[Abstract/Free Full Text]
14.
Palombella VJ,
Rando OJ,
Goldberg AL,
Maniatis T:
The ubiquitin-proteasome pathway is required for processing the NF-kappa B1 precursor protein and the activation of NF-kappa B.
Cell
78:773,
1994[Medline]
[Order article via Infotrieve]
15.
Hicke L,
Reizman H:
Ubiquitination of a yeast plasma membrane receptor signals its ligand-stimulated endocytosis.
Cell
84:277,
1996[Medline]
[Order article via Infotrieve]
16.
Miyazawa K,
Toyama K,
Gotoh A,
Hendrie PC,
Mante C,
Broxmeyer HE:
Ligand-dependent polyubiquitination of c-kit gene product: a possible mechanism of receptor down modulation in M07e cells.
Blood
83:137,
1994[Abstract/Free Full Text]
17.
Kouro T,
Kikuchi Y,
Kanazawa H,
Hirokawa K,
Harada N,
Shiiba M,
Wakao H,
Takaki S,
Takatsu K:
Critical proline residues of the cytoplasmic domain of the IL-5 receptor alpha chain and its function in IL-5-mediated activation of JAK kinase and STAT5.
Int Immunol
8:237,
1996[Abstract/Free Full Text]
18.
O'Farrell AM,
Ichihara M,
Mui AL,
Miyajima A:
Signaling pathways activated in a unique mast cell line where interleukin-3 supports survival and stem cell factor is required for a proliferative response.
Blood
87:3655,
1996[Abstract/Free Full Text]
19.
Leslie KB,
Jalbert S,
Orban P,
Welham M,
Duronio V,
Schrader JW:
Genetic basis of hypo-responsiveness of A/J mice to interleukin-3.
Blood
87:3186,
1996[Abstract/Free Full Text]
20.
Cornelis S,
Fache I,
Van der Heyden J,
Guisez Y,
Tavernier J,
Devos R,
Fiers W,
Plaetinck G:
Characterization of critical residues in the cytoplasmic domain of the human interleukin-5 receptor alpha chain required for growth signal transduction.
Eur J Immunol
25:1857,
1995[Medline]
[Order article via Infotrieve]
21.
McCloskey P,
Pierce J,
Koski RA,
Varnum B,
Liu ET:
Activation of the Axl receptor tyrosine kinase induces mitogenesis and transformation in 32D cells.
Cell Growth Differ
5:1105,
1994[Abstract]
22.
Silvennoinen O,
Witthuhn BA,
Quelle FW,
Cleveland JL,
Yi T,
Ihle JN:
Structure of the murine Jak2 protein-tyrosine kinase and its role in interleukin 3 signal transduction.
Proc Natl Acad Sci USA
90:8429,
1993[Abstract/Free Full Text]
23.
Yi T,
Mui AL-F,
Krystal G,
Ihle JN:
Hematopoietic cell phosphatase associates with the interleukin-3 (IL-3) receptor chain and down-regulates IL-3-induced tyrosine phosphorylation and mitogenesis.
Mol Cell Biol
13:7577,
1993[Abstract/Free Full Text]
24.
Pan CX,
Fukunaga R,
Yonehara S,
Nagata S:
Unidirectional cross-phosphorylation between the granulocyte colony-stimulating factor and interleukin 3 receptors.
J Biol Chem
268:25818,
1993[Abstract/Free Full Text]
25.
Duronio V,
Clark-Lewis I,
Federsppiel B,
Wieler JS,
Schrader JW:
Tyrosine phosphorylation of receptor beta subunits and common substrates in response to interleukin-3 and granulocyte-macrophage colony stimulating factor.
J Biol Chem
267:21856,
1992[Abstract/Free Full Text]
26.
Schindler C,
Darnell JE Jr:
Transcriptional responses to polypeptide ligands: The JAK-STAT pathway.
Annu Rev Biochem
64:621,
1995[Medline]
[Order article via Infotrieve]
27.
Briscoe J,
Kohlhuber F,
Müller M:
JAKs and STATs branch out.
TICB
6:336,
1996
28.
Chin H,
Nakamura N,
Kamiyama R,
Miyasaka N,
Ihle JN,
Miura O:
Physical and functional interactions between Stat5 and the tyrosine-phosphorylated receptors for erythropoietin and interleukin-3.
Blood
88:4415,
1996[Abstract/Free Full Text]
29.
Gouilleux F,
Wakao H,
Mundt M,
Groner B:
Prolactin induces phosphorylation of Tyr694 of STAT5 (MGF), a prerequisite for DNA binding and induction of transcription.
EMBO J
13:4361,
1994[Medline]
[Order article via Infotrieve]
30.
Ihle JN:
STATs: Signal transducers and activators of transcription.
Cell
84:331,
1996[Medline]
[Order article via Infotrieve]
31.
Azam M,
Erdjument-Bromage H,
Kreider BL,
Xia M,
Quelle F,
Basu R,
Saris C,
Tempst P,
Ihle JN,
Schindler C:
Interleukin-3 signals through multiple isoforms of Stat5.
EMBO J
14:1402,
1995[Medline]
[Order article via Infotrieve]
32.
Mui AL-F,
Wakao H,
Kinoshita T,
Kitamura T,
Miyajima A:
Suppression of interleukin-3-induced gene expression by a C-terminal truncated Stat5Role of Stat5 in proliferation.
EMBO J
15:2425,
1996[Medline]
[Order article via Infotrieve]
33.
Mui AL-F,
Wakao H,
O'Farrell A-M,
Harada N,
Miyajima A:
Interleukin-3, granulocyte-macrophage colony stimulating factor and interleukin-5 transduce signals through two STAT5 homologs.
EMBO J
14:1166,
1995[Medline]
[Order article via Infotrieve]
34.
Pless M,
Norga K,
Carroll M,
Heim MH,
D'Andrea AD,
Mathey-Prevot B:
Receptors that induce erythroid differentiation of BaF3 cells: Structural requirements and effect on STAT5 binding.
Blood
89:3175,
1997[Abstract/Free Full Text]
35.
Haspel RL,
Salditt-Georgieff M,
Darnell JE Jr:
The rapid inactivation of nuclear tyrosine phosphorylated Stat1 depends upon a protein tyrosine phosphatase.
EMBO J
15:6262,
1996[Medline]
[Order article via Infotrieve]
36.
Kim TK,
Maniatis T:
Regulation of interferon-gamma-activated STAT1 by the ubiquitin-proteasome pathway.
Science
273:1717,
1996[Abstract/Free Full Text]
37.
Piao XH,
Paulson R,
Vandergeer P,
Pawson T,
Bernstein A:
Oncogenic mutation in the kit receptor tyrosine kinase alters substrate specificity and induces degradation of the protein tyrosine phosphatase Shp-1.
Proc Natl Acad USA
93:14665,
1996[Abstract/Free Full Text]
38.
Palacios R,
Steinmetz M:
IL-3-dependent mouse clones that express B-220 antigen, contain Ig genes in germ-line configuration and generate B lymphocytes in vivo.
Cell
41:727,
1985[Medline]
[Order article via Infotrieve]
39.
Andrews NC,
Faller DV:
A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells.
Nucl Acids Res
19:11,
1991[Abstract/Free Full Text]
40.
Van der Heyden J,
Devos R,
Plaetinck G,
Fache I,
Fiers W,
Tavernier J:
Characterization of the murine IL-5 receptor complex with the use of a panel of monoclonal antibodies. Relationship to the murine IL-3 receptor.
J Immunol
147:3413,
1991[Abstract]
41. (abstr, suppl 1)
Barber DL,
Beattie BK,
D'Andrea DA,
Frank DA:
An activation-specific STAT5 antibody selectively recognizes the tyrosine phosphorylated forms of the erythropoietin receptor and STAT5.
Blood
88:53a,
1996
42.
Luo H,
Rose P,
Barber D,
Hanratty WP,
Lee S,
Roberts TM,
D'Andrea AD,
Dearolf CR:
Mutation in the Jak kinase Jh2 domain hyperactivates Drosophila and mammalian Jak-Stat pathways.
Mol Cell Biol
17:1562,
1997[Abstract]
43.
Beadling C,
Ng J,
Babbage JW,
Cantrell DA:
Interleukin-2 activation of STAT5 requires the convergent action of tyrosine kinases and a serine/threonine kinase pathway distinct from the Raf1/Erk2 MAP kinase pathway.
EMBO J
15:1902,
1996[Medline]
[Order article via Infotrieve]
44.
Strous GJ,
Vankerhof P,
Govers R,
Rotwein P,
Schwartz AL:
Growth hormone-induced signal transduction depends on an intact ubiquitin system.
J Biol Chem
272:40,
1997[Abstract/Free Full Text]
45.
He T-C,
Jiang N,
Zhuang H,
Wojchowski DM:
Erythropoietin-induced recruitment of Shc via a receptor phosphotyrosine-independent, Jak2-associated pathway.
J Biol Chem
270:11055,
1995[Abstract/Free Full Text]
46.
Barber DL,
Corless CN,
Xia K,
Roberts TM,
D'Andrea AD:
Erythropoietin activates Raf1 by an Shc-independent pathway in Ctll-Epo-R cells.
Blood
89:55,
1997[Abstract/Free Full Text]
47.
Govers R,
van Kerkhof P,
Schwartz AL,
Strous GJ:
Linkage of the ubiquitin-conjugating system and the endocytic pathway in ligand-induced internalization of the growth hormone receptor.
EMBO J
16:4851,
1997[Medline]
[Order article via Infotrieve]
48.
Yu C-L,
Burakoff SJ:
Involvement of proteasomes in regulating JAK-STAT pathways upon interleukin-2 stimulation.
J Biol Chem
272:14017,
1997[Abstract/Free Full Text]
49.
Wang D,
Stravopodis D,
Teglund S,
Kitazawa J,
Ihle JN:
Naturally occurring dominant negative variants of Stat5.
Mol Cell Biol
16:6141,
1996[Abstract]
50.
Moriggl R,
Gouilleux-Gruart V,
Jahne R,
Berchtold S,
Gartmann C,
Liu X,
Hennighausen L,
Sotiropoulos A,
Groner B,
Gouilleux F:
Deletion of the carboxyl-terminal transactivation domain of MGF-Stat5 results in sustained DNA binding and a dominant negative phenotype.
Mol Cell Biol
16:5691,
1996[Abstract]
51.
Jiao H,
Berrada K,
Yang W,
Tabrizi M,
Plantanias LC,
Yi T:
Direct association with and dephosphorylation of JAK2 kinase by the SH2-domain-containing protein tyrosine phosphatase SHP-1.
Mol Cell Biol
16:6985,
1996[Abstract]
52.
Yin T,
Shen R,
Feng GS,
Yang YC:
Molecular characterization of specific interactions between SHP-2 phosphatase and JAK tyrosine kinases.
J Biol Chem
272:1032,
1997[Abstract/Free Full Text]
53.
Maegawa H,
Kashiwagi A,
Fujita T,
Ugi S,
Hasegawa M,
Obata T,
Nishio Y,
Kojima H,
Hidaka H,
Kikkawa R:
SHPTP2 serves adapter protein linking between Janus kinase 2 and insulin receptor substrates.
Biochem Biophys Res Commun
228:122,
1996[Medline]
[Order article via Infotrieve]
54.
Sengupta TK,
Schmitt EM,
Ivashkiv LB:
Inhibition of cytokines and JAK-STAT activation by distinct signaling pathways.
Proc Natl Acad Sci USA
93:9499,
1996[Abstract/Free Full Text]
55.
David M,
Chen HE,
Goelz S,
Larner AC,
Neel BG:
Differential regulation of the alpha/beta interferon-stimulated Jak/Stat pathway by the SH2 domain-containing tyrosine phosphatase SHPTP1.
Mol Cell Biol
15:7050,
1995[Abstract]
56.
Starr R,
Willson TA,
Viney EM,
Murray LJL,
Rayner JR,
Jenkins BJ,
Gonda TJ,
Alexander WS,
Metcalf D,
Nicola NA,
Hilton DJ:
A family of cytokine-inducible inhibitors of signalling.
Nature
387:917,
1997[Medline]
[Order article via Infotrieve]
57.
Naka T,
Narazaki M,
Hirata M,
Matsumoto T,
Minamoto S,
Aono A,
Nishimoto N,
Kajita T,
Taga T,
Yoshizaki K,
Akira S,
Kishimoto T:
Structure and function of a new Stat-induced Stat inhibitor.
Nature
387:924,
1997[Medline]
[Order article via Infotrieve]
58.
Endo TA,
Masuhara M,
Yokouchi M,
Suzuki R,
Sakamoto H,
Mitsui K,
Matsumoto A,
Tanimura S,
Ohtsubo M,
Misawa H,
Miyazaki T,
Leonor N,
Taniguchi T,
Fujita T,
Kanakura Y,
Komiya S,
Yoshimura A:
A new protein containing an Sh2 domain that inhibits Jak kinases.
Nature
387:921,
1997[Medline]
[Order article via Infotrieve]
59.
Zhu Y,
Carroll M,
Papa FR,
Hochstrasser M,
D'Andrea AD:
DUB-1, a deubiquitinating enzyme with growth-suppressing activity.
Proc Natl Acad Sci USA
93:3275,
1996[Abstract/Free Full Text]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
J. Staerk, A. Kallin, J.-B. Demoulin, W. Vainchenker, and S. N. Constantinescu
JAK1 and Tyk2 Activation by the Homologous Polycythemia Vera JAK2 V617F Mutation: CROSS-TALK WITH IGF1 RECEPTOR
J. Biol. Chem.,
December 23, 2005;
280(51):
41893 - 41899.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G. Forget, D. J. Gregory, and M. Olivier
Proteasome-mediated Degradation of STAT1{alpha} following Infection of Macrophages with Leishmania donovani
J. Biol. Chem.,
August 26, 2005;
280(34):
30542 - 30549.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Olivier, D. J. Gregory, and G. Forget
Subversion Mechanisms by Which Leishmania Parasites Can Escape the Host Immune Response: a Signaling Point of View
Clin. Microbiol. Rev.,
April 1, 2005;
18(2):
293 - 305.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. ten Hoeve, M. de Jesus Ibarra-Sanchez, Y. Fu, W. Zhu, M. Tremblay, M. David, and K. Shuai
Identification of a Nuclear Stat1 Protein Tyrosine Phosphatase
Mol. Cell. Biol.,
August 15, 2002;
22(16):
5662 - 5668.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. Ungureanu, P. Saharinen, I. Junttila, D. J. Hilton, and O. Silvennoinen
Regulation of Jak2 through the Ubiquitin-Proteasome Pathway Involves Phosphorylation of Jak2 on Y1007 and Interaction with SOCS-1
Mol. Cell. Biol.,
May 15, 2002;
22(10):
3316 - 3326.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T.-S. Migone, M. Humbert, A. Rascle, D. Sanden, A. D'Andrea, and J. A. Johnston
The deubiquitinating enzyme DUB-2 prolongs cytokine-induced signal transducers and activators of transcription activation and suppresses apoptosis following cytokine withdrawal
Blood,
September 15, 2001;
98(6):
1935 - 1941.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K.-H. Baek, M. A. Mondoux, R. Jaster, E. Fire-Levin, and A. D. D'Andrea
DUB-2A, a new member of the DUB subfamily of hematopoietic deubiquitinating enzymes
Blood,
August 1, 2001;
98(3):
636 - 642.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. S. Boosalis, R. Bandyopadhyay, E. H. Bresnick, B. S. Pace, K. Van DeMark, B. Zhang, D. V. Faller, and S. P. Perrine
Short-chain fatty acid derivatives stimulate cell proliferation and induce STAT-5 activation
Blood,
May 15, 2001;
97(10):
3259 - 3267.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. B. Lilly, M. Zemskova, A. E. Frankel, J. Salo, and A. S. Kraft
Distinct domains of the human granulocyte-macrophage colony-stimulating factor receptor {alpha} subunit mediate activation of Jak/Stat signaling and differentiation
Blood,
March 15, 2001;
97(6):
1662 - 1670.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Zhang, S. Fukuda, Y. Lee, G. Hangoc, S. Cooper, R. Spolski, W. J. Leonard, and H. E. Broxmeyer
Essential Role of Signal Transducer and Activator of Transcription (Stat)5a but Not Stat5b for Flt3-Dependent Signaling
J. Exp. Med.,
September 5, 2000;
192(5):
719 - 728.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Begitt, T. Meyer, M. van Rossum, and U. Vinkemeier
Nucleocytoplasmic translocation of Stat1 is regulated by a leucine-rich export signal in the coiled-coil domain
PNAS,
September 5, 2000;
(2000)
190318397.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
C.-L. Yu, Y.-J. Jin, and S. J. Burakoff
Cytosolic Tyrosine Dephosphorylation of STAT5. POTENTIAL ROLE OF SHP-2 IN STAT5 REGULATION
J. Biol. Chem.,
January 7, 2000;
275(1):
599 - 604.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. D. Wilkinson
Ubiquitin-Dependent Signaling: The Role of Ubiquitination in the Response of Cells to Their Environment.
J. Nutr.,
November 1, 1999;
129(11):
1933 - 1936.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
R. L. Haspel and J. E. Darnell Jr.
A nuclear protein tyrosine phosphatase is required for the inactivation of Stat1
PNAS,
August 31, 1999;
96(18):
10188 - 10193.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. J. Cohney, D. Sanden, N. A. Cacalano, A. Yoshimura, A. Mui, T. S. Migone, and J. A. Johnston
SOCS-3 Is Tyrosine Phosphorylated in Response to Interleukin-2 and Suppresses STAT5 Phosphorylation and Lymphocyte Proliferation
Mol. Cell. Biol.,
July 1, 1999;
19(7):
4980 - 4988.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. C. Ward, Y. M. van Aesch, A. M. Schelen, and I. P. Touw
Defective Internalization and Sustained Activation of Truncated Granulocyte Colony-Stimulating Factor Receptor Found in Severe Congenital Neutropenia/Acute Myeloid Leukemia
Blood,
January 15, 1999;
93(2):
447 - 458.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. M. A. dos Santos, P. van Kerkhof, and G. J. Strous
The Signal Transduction of the Growth Hormone Receptor Is Regulated by the Ubiquitin/Proteasome System and Continues After Endocytosis
J. Biol. Chem.,
March 30, 2001;
276(14):
10839 - 10846.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
N. Aoki and T. Matsuda
A Cytosolic Protein-tyrosine Phosphatase PTP1B Specifically Dephosphorylates and Deactivates Prolactin-activated STAT5a and STAT5b
J. Biol. Chem.,
December 8, 2000;
275(50):
39718 - 39726.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Kamizono, T. Hanada, H. Yasukawa, S. Minoguchi, R. Kato, M. Minoguchi, K. Hattori, S. Hatakeyama, M. Yada, S. Morita, et al.
The SOCS Box of SOCS-1 Accelerates Ubiquitin-dependent Proteolysis of TEL-JAK2
J. Biol. Chem.,
April 13, 2001;
276(16):
12530 - 12538.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F. Verdier, P. Walrafen, N. Hubert, S. Chretien, S. Gisselbrecht, C. Lacombe, and P. Mayeux
Proteasomes Regulate the Duration of Erythropoietin Receptor Activation by Controlling Down-regulation of Cell Surface Receptors
J. Biol. Chem.,
June 9, 2000;
275(24):
18375 - 18381.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. A. Callus and B. Mathey-Prevot
Hydrophobic Residues Phe751 and Leu753 Are Essential for STAT5 Transcriptional Activity
J. Biol. Chem.,
May 26, 2000;
275(22):
16954 - 16962.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Begitt, T. Meyer, M. van Rossum, and U. Vinkemeier
Nucleocytoplasmic translocation of Stat1 is regulated by a leucine-rich export signal in the coiled-coil domain
PNAS,
September 12, 2000;
97(19):
10418 - 10423.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Abstract
Introduction
Abstract