|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 91 No. 9 (May 1), 1998:
pp. 3202-3209
Generation of a Primitive Erythroid Cell Line and Promotion of Its
Growth by Basic Fibroblast Growth Factor
By
David Yuen,
Leena Mittal,
Chu-Xia Deng, and
Kyunghee Choi
From the Department of Pathology, Molecular and Cell Biology Program,
University of Maryland at Baltimore, Baltimore, MD; and the Laboratory
of Biochemistry and Metabolism, National Institute of Digestive and
Kidney Diseases, National Institutes of Health, Bethesda, MD.
 |
ABSTRACT |
An immortalized cell line representing the primitive erythroid
(EryP) lineage was established from in vitro-differentiated progeny
(embryoid bodies [EBs]) of embryonic stem (ES) cells using a
retroviral insertional mutation, and has been termed EB-PE for embryoid
body-derived primitive erythroid. Even though EB-PE cells are
immortalized, they show characteristics of normal EryP cells, such as
gene expression and growth factor dependency. In addition, EB-PE cells
can differentiate further in culture. Investigation of growth factor
requirements of EB-PE cells showed that basic fibroblast growth factor
(bFGF) and erythropoietin (Epo) play unique roles in EB-PE
proliferation and differentiation. While bFGF was a strong mitogen, Epo
was required for both proliferation and differentiation. The unique
proliferative response to bFGF coincided with upregulation of its
receptor, fibroblast growth factor receptor (fgfr-1), and
downregulation of erythropoietin receptor (EpoR) gene expression.
Studies of primary EryP cells derived from early EBs, when tested in a
colony-formation assay, also provided evidence for the mitogenic role
of bFGF in concert with Epo.
| |
INTRODUCTION |
HEMATOPOIESIS IS ESTABLISHED very early
during mammalian embryogenesis. In mice, the first mature hematopoietic
cells can be detected in extraembryonic blood islands of the yolk sac
as early as day 7.5 of gestation.1,2 Mature blood cells
produced at this stage are large, nucleated erythroids, known as
primitive erythroid cells (EryP). These EryP cells produce embryonic
forms of globins. Although EryP cells are the predominant mature
lineage in the yolk sac, other hematopoietic progenitors can also be
detected.1-7 As the hematopoietic site is shifted to the
fetal liver and then to the bone marrow, newly produced erythroid cells
become smaller and nonnucleated (definitive erythroid [EryD]). The
shift from primitive to definitive erythropoiesis is accompanied by the
switching of embryonic globin gene expression to adult
forms.8,9
Several studies suggest that regulation of primitive and definitive
erythropoiesis is distinct. White spotting mutant (W) mice carry
natural mutations in the receptor tyrosine kinase c-kit gene
and are characterized by defects in melanocyte, germ cell, and
hematopoietic development.10 The severity of the mutant phenotype coincides with the degree of impairment of Kit kinase activity. The most severe forms of mutations are W and
W19H, which result in a complete lack of Kit kinase
activity. Mice homozygous for the W or W19H mutations are
not viable. They die either perinatally or in later stages of
embryogenesis. However, yolk sac hematopoiesis in these mice appears to
be normal, suggesting that Kit is not required for EryP
development.1 Similarly, gene knock-out experiments demonstrate that the c-myb, erythropoietin (Epo), or
erythropoietin receptor (EpoR) genes11-13 are essential for
EryD development. While these studies provide some insights into EryD
development, the mechanisms regulating primitive erythropoiesis are not
as well established.
EryP and endothelial cells constituting blood islands of the yolk sac
are the first mature progeny of mesoderm in developing mouse embryos.
Fibroblast growth factors (FGFs) and factors that belong to
transforming growth factor (TGF)- group play a central role in
mesoderm development in Xenopus and Drosophila.14-16 Mice carrying homozygous null mutations at the fgfr-1 locus die in utero due to the failure of embryonic cell proliferation and abnormal mesodermal patterning during gastrulation.17,18 Similarly, TGF-1 / mice die in utero due to defective
extraembryonic hematopoiesis and endothelial
differentiation.19 Even though these studies do not
directly demonstrate the role of FGFs and TGF- family growth factors
in the establishment of the hematopoietic system, they may well be
involved in the onset of hematopoietic development.
Here, we report the generation of a EryP cell line (EB-PE) using in
vitro-differentiated progeny (embryoid bodies [EBs]) of embryonic
stem (ES) cells20-22 and retroviral insertional
mutation.23,24 Even though immortalized, they still require
growth factors for their proliferation and differentiation. Among
factors tested, basic (b) FGF and Epo show unique roles in EB-PE
proliferation and differentiation depending on culture conditions.
Furthermore, we demonstrate that fgfr-1 is the corresponding receptor
for bFGF. Gene expression analysis indicates that primary EryP
progenitors from EBs also express the fgfr-1 gene and that bFGF
also stimulates these cells. These results demonstrate that bFGF is
important in early hematopoietic lineage development, and further
suggests for its possible role in the establishment of hematopoiesis.
| |
MATERIALS AND METHODS |
Cell culture.
CCE ES cells, obtained from Dr E. Robertson (Harvard University), were
maintained on feeder cells, STO fibroblasts, in Dulbecco's modified
Eagle's medium (DMEM) supplemented with fetal calf serum ([FCS] Gemini, Calabasas, CA; 15%), monothioglycerol ([MTG]
Sigma, St Louis, MO; 1.5 × 104 mol/L), and leukemia
inhibitory factor ([LIF] Genetics Institute, Boston, MA; 1.5%
conditioned medium). ES cells were differentiated as
described.20-22 Briefly, 2 days before
initiating differentiation, ES cells were passaged in Iscove's
modified Dulbecco's medium (IMDM) supplemented with FCS (15%), MTG
(1.5 × 104 mol/L), and LIF (1.5% conditioned
medium) without STO cells. For differentiation, cells were dissociated
with trypsin, washed once, and plated in IMDM with FCS (15%; Hyclone,
Logan, UT), L-glutamine (2 mmol/L), ascorbic acid
(50 ng/mL; Sigma), and MTG (4.5 × 104
mol/L). Cells were plated in a final volume of 10 mL at 5,000 cells/mL
(day 2.5 to 3.5 EBs) or 3,000 to 4,000 cells/mL (day 3.5 to 5 EBs) in
100-mm bacterial-grade dishes. These cultures were maintained in a
humidified chamber at 37°C containing 5% CO2.
EB cells were replated as described.20-22 Briefly,
EBs were collected at different time points, dissociated with trypsin,
and replated into methylcellulose cultures containing
plasma-derived serum ([PDS] Antech, Tyler, TX; 10%),
ascorbic acid (12.5 ng/mL), L-glutamine (2 mmol/L),
transferrin (300 µg/mL; Boehringer, Indianapolis, IN), protein-free
hybridoma media ([PFHM2] GIBCO-BRL, Gaithersburg, MD; 5%), and MTG
(4.5 × 104 mol/L) with factors. bFGF was used at 30 pg to 1 ng/mL and Epo was used at 2 U/mL. One-milliliter quantities of
methylcellulose cultures containing 3 × 104
cells were put in 30-mm bacterial-grade petridishes. EryP colonies were
counted 4 to 6 days after replating.
EB-PE cells were maintained in IMDM containing 10% FCS with
various factor combinations at the following concentrations: bFGF (10 ng/mL), c-kit ligand ([KL] 1% conditioned medium),
interleukin (IL)-3 (1% conditioned medium), insulin-like growth-factor
(IGF)-1 (10 ng/mL), IL-11 (10 ng/mL), IL-6 (10 ng/mL), and Epo (2 U/mL). For colony assay, EB-PE cells were washed, replated into
methylcellulose cultures containing PDS (10%), ascorbic acid (12.5 ng/mL), L-glutamine (2 mmol/L), transferrin (300 µg/mL),
PFHM2 (5%), and MTG (4.5 × 104 mol/L) with factors.
The factors used were Kit ligand (10 ng/mL), IL-3 (10 ng/mL),
granulocyte/macrophage colony-stimulating factor ([GM-CSF] 5 ng/mL),
M-CSF (5 ng/mL), Epo (2 U/mL), vascular endothelial growth factor
([VEGF] 5 ng/mL), bFGF (30 pg to 30 ng/mL), IGF-1 (10 ng/mL), and
activin A (0.1 to 10 ng/mL). Colonies were counted 4 to 6 days after
replating.
Retroviral infection of EB cells.
Plasmid DNA provided by Dr A. Gudkov (University of Illinois at
Chicago) was transfected into an ecotropic retroviral packaging cell
line, BOSC 23,25 and the virus released was collected 24 hours after transfection and used for infection. Day 4 EBs were dissociated with trypsin and were infected with retroviruses in the
presence of polybrene (5 µg/mL), VEGF (5 ng/mL), IGF-1 (10 ng/mL),
and Epo (2 U/mL). After infection, cells were selected in
methylcellulose culture containing VEGF (5 ng/mL), IGF-1 (10 ng/mL),
Epo (2 U/mL), and G418 (500 µg/mL). The resulting colonies were
picked and transferred to liquid culture after 7 to 10 days.
DNA and RNA analysis.
Southern, Northern, and reverse-transcription polymerase chain reaction
(RT-PCR) analyses were performed as described.26-28 EryP
colonies were obtained by replating day 4 EB cells into methylcellulose cultures with Epo. The resulting EryP colonies were pooled and RNA was
extracted. Specific primers used for RT-PCR are as
follows20,29-32: -actin: sense 5 ATGAAGATCCTGACCGAGCG3,
antisense, 5TACTTGCGCTCAGGAGGAGC3; -H1: sense
5AGTCCCCATGGAGTCAAAGA3, antisense 5CTCAAGGAGACCTTTGCTCA3; SCL:
sense 5ATTGCACACACGGGATTCTG3, antisense 5CATACAGTACGACACTGACG3; GATA-1: sense 5ATGCCTGTAATCCCAGCACT3, antisense
5TCATGGTGGTAGCTGGTAGC3; c-kit: sense
5TGTCTCTCCAGTTTCCCTGC3, antisense 5TTCAGGGACTCATGGGCTCA3; fgfr-1: sense 5AGCCTGACCACCGAATTGGAG3, antisense
5CATCAACTCCACATTGCTGC3; flk-1: sense 5CACCTGGCACTCTCCAC3,
antisense 5ATTTCATCCCACTACCG3; flt-1: sense
5CTCTGATGGTGATCGTGG3, antisense 5CATGCGTCTGGCCACTTG3; and EpoR:
sense 5GGACACCTACTTGGTATTGG3, antisense 5GACGTTGTAGGCTGGAGTCC3.
Growth factors.
bFGF and Epo were purchased from Upstate Biotechnology (Lake Placid,
NY) and Amgen (Thousand Oaks, CA), respectively. IL-11, IL-6, IGF-1,
GM-CSF, M-CSF, and VEGF were purchased from R&D Systems. LIF was obtained from medium conditioned by CHO cells transfected with
a LIF expression vector (kindly provided by Genetics Institute). KL was
obtained either from medium conditioned by CHO cells transfected with a
KL expression vectors (Genetics Institute) or from R&D Systems. IL-3
was obtained either from R&D Systems or from medium conditioned by X63
Ag8-653 myeloma cells transfected with a vector expressing
IL-3.33 Recombinant human Activin A was kindly provided by
National Hormone and Pituitary Program (NHPP), National Institute of
Digestive & Kidney Diseases.
| |
RESULTS |
Generation of growth factor-dependent EryP cell line.
In an effort to understand how primitive hematopoietic development is
regulated, we used retroviruses to mark individual EB cells to monitor
their cell fate. Day 4 EBs were used since they contain a large number
of hematopoietic progenitors.20,22 The retroviruses used in
this study carry random cDNA fragments (200 to 400 bp), which serve as
a unique tag and a neomycin-resistance gene for selection (Fig
1A).34 A majority of the cDNAs
in these retroviruses were shown to be biologically
inactive.34 To optimally target early hematopoietic progenitors, factors known to support immature progenitors such as
VEGF, IGF-1, and Epo22 were included during retroviral
infection and G418 selection. After G418 selection, several colonies
developed in methylcellulose cultures, and when transferred to liquid
culture media with the same growth factors, cells from one colony grew continuously. We did not obtain any continuously growing cells without
retroviral infection. Southern blot analysis of the newly established
line with multiple enzymes that cut only once within the retroviral
genome indicated that a single retroviral genome was present within
these cells (Fig 1B). To determine if the piece of cDNA present within
the retroviral genome contributed to the immortalization, cDNA within
the retroviral genome was amplified by PCR and sequenced. The cDNA
sequence, which was oriented in an antisense configuration within the
retroviral genome, showed 100% homology to mouse 18S rRNA when
compared with those in the available data bases (Fig 1A). Since
inhibition of 18S rRNA function should lead to the general inhibition
of protein synthesis, it is highly unlikely that the rRNA gene fragment
contributed to the immortalization phenotype. This result is consistent
with the notion that a cellular gene near the retroviral integration has been activated and that this newly activated protein most likely
contributed to the cell immortalization.
View larger version (10K):
[in this window]
[in a new window]
View larger version (62K):
[in this window]
[in a new window]
| Fig 1.
Characterization of retroviral insertion. (A) Top shows
structure of an integrated provirus containing a cDNA fragment in LNCX
vector. LTR, long terminal repeat; neo, neomycin-resistant gene; CMV, cytomegalo viral promoter. Restriction enzymes that cut once
in the genome are indicated. Bottom shows sequence comparison of cDNA
fragment to mouse 18S rRNA gene. (B) Southern blot analysis. DNA was
prepared from CCE ES cells (lanes 1) and EB-PE cells (lanes 2) and
digested with BamHI, HindIII and BglII,
BamHI and BglII, or Sph I. Digested DNA was run
on an agarose gel and transferred to a nylon membrane and probed with
either CMV promoter or neo.
|
|
May-Grünwald/Giemsa staining of the immortalized cells
demonstrated that they contained large nuclei with little cytoplasmic content (Fig 2A). As shown in
Fig 2B, they expressed both  and H1 globin genes (lanes 1 and 3).
A low level of -major globin gene expression (lane 2) was also
observed. The observed cell morphology and gene-expression pattern
suggested that they were EryP cells. To further investigate whether
these immortalized cells were of erythroid origin, we tested several
growth factors in semisolid media (methylcellulose cultures). As shown
in Fig 2C, no colonies developed in the absence of growth factors,
indicating that they were growth factor-dependent. Further, colonies
developed only in cultures containing Epo, but not in IL-3, GM-CSF, or
M-CSF. Two types of colonies were apparent: one that consisted of 20 to
40 cells and the other of 100 to 300 cells. Cells within both types of
colonies showed strong hemoglobinization (Fig 2D). This observation was
consistent with the idea that cells differentiated spontaneously in
culture. Therefore, cells forming larger colonies would represent more
immature progenitors. We have designated the immortalized cell line as
EB-PE (embryoid body-derived primitive erythroid cells).
View larger version (65K):
[in this window]
[in a new window]
| Fig 2.
Characterization of EB-PE cells. (A) EB-PE cells after
Giemsa staining. (B) Northern blot analysis. RNA was prepared from EB-PE cells and used for globin gene expression analysis. Each lane
contains 10 µg of total RNA. Probes used are as follows: lane 1, globin; lane 2, -major; lane 3, H1. GAPDH is shown as a loading
control. (C) EB-PE colony assay in various growth factor combination.
EB-PE cells (5 × 103 cells/mL) were plated in
methylcellulose culture containing different combinations of growth
factors (Epo [2 U/mL]; KL [10 ng/mL]/Epo; KL [100 ng/mL]/Epo;
IL-3 [10 ng/mL]/IL-11 [10 ng/mL]/Epo; and IL-3 (10 ng/mL)/GM-CSF
[5 ng/mL]/M-CSF [5 ng/mL]). Error bars indicate standard deviation
of numbers obtained from 3 different plates. (D) Two types of colonies
that develop in cultures containing Epo are shown. One consists of 20 to 40 cells per colony and the other 100 to 300 cells per colony.
|
|
To further characterize EB-PE cells, the expression of several genes
known to be expressed in erythroid cells,35 such as the
transcription factors SCL, GATA-1, and a receptor tyrosine kinase,
c-kit, was compared with that of primary EryP, obtained from EB
cells, using semiquantitative RT-PCR. As shown in Fig 3, H1, SCL, and GATA-1 were expressed in
both cell populations, although the levels of H1 and SCL gene
expression were much higher in primary EryP cells. c-kit
expression was barely detectable in EB-PE cells compared with that of
EryP cells. Primary EryP cells obtained from day 4 EBs still expressed
the fgfr-1 gene at low levels, even though they did not respond
to bFGF at this stage (see below). Both EB-PE and primary EryP cells
expressed flk-1 and flt-1, genes shown to be expressed
in erythroid cells.36 These results indicated that EB-PE
cells expressed genes characteristic of erythroid cells.
View larger version (25K):
[in this window]
[in a new window]
| Fig 3.
Gene expression analysis using RT-PCR. Lanes 1, negative
control; lanes 2, RNA from EB-PE cells grown in bFGF and Epo; lanes 3, RNA from EryP cells. EryP colonies were obtained by replating day 4 EB
cells into methylcellulose cultures with Epo. The resulting EryP
colonies were pooled and RNA was extracted. The amplified DNA sizes are
indicated on the right. -actin is shown as a control.
|
|
bFGF is a growth factor for EB-PE and EryP cell progenitors.
To determine how the EB-PE proliferation is regulated, we first
analyzed their growth factor requirements. Factors known to act on
early hematopoietic progenitors, such as activin A, bFGF, VEGF, IL-3,
IL-6, IL-11, IGF-1, KL, and Epo were tested.22,37 The
proliferation of EB-PE cells was determined either in liquid or
methylcellulose cultures. As shown in Fig
4A, EB-PE cells failed to grow and
subsequently died in the absence of any growth factors. Activin A,
bFGF, VEGF, IL-3, IL-6, IL-11, IGF-1, and KL all failed to support
EB-PE cell proliferation when tested as the only exogenously provided
growth factor. This suggested that Epo was absolutely required.
Consistent with this notion, EB-PE cells proliferated in cultures
containing Epo alone. Among factors tested in combination with Epo,
only bFGF was able to support EB-PE proliferation significantly better
than Epo alone (Fig 4A, data not shown). The response to bFGF was
dose-dependent such that bFGF was growth stimulatory at levels as low
as 30 pg/mL, even though cells proliferated better at higher bFGF
concentrations (Fig 4B). From the growth curve, it appeared that EB-PE
cells divided every 8 hours in the optimum growth-stimulatory
conditions (bFGF at 10 ng/mL). The bFGF mitogenic effect on EB-PE was
unique, such that cells failed to respond to other mitogenic signals,
including Epo, when they were maintained in bFGF and Epo. Consistent
with this, cells failed to form large colonies in methylcellulose
cultures (Fig 4C). Large colonies that developed in the presence of
bFGF and Epo (Fig 4C) were less hemoglobinized, suggesting that cells
remained undifferentiated. To confirm if this was the case, cells grown
in the presence or absence of bFGF were subjected to benzidine
staining, an assay for hemoglobinization. As shown in Fig
5, a higher portion of cells (~60%)
stained positive when cells were maintained in cultures in the absence
of bFGF, while a smaller portion of cells (~10% to 15%) were
benzidine-positive in the presence of bFGF. When cells were transferred
from bFGF/Epo to Epo alone, they started to differentiate such that
approximately 40% of cells (after 24 hours) and approximately 80% of
cells (after 48 hours) became benzidine-positive and subsequently died.
These observations are consistent with the notion that while bFGF is a
strong mitogen for EB-PE, Epo is required for EB-PE terminal
differentiation.
View larger version (22K):
[in this window]
[in a new window]
| Fig 4.
Determination of growth factor requirement of EB-PE
cells. (A) EB-PE cells grown with VEGF, IGF-1, and Epo were washed and plated at a density of 5 × 104 cells/mL with various
growth factors. The number of cells was counted daily for 4 days. Epo
was used at 2 U/mL, KL at 10 ng/mL, bFGF at 10 ng/mL, VEGF at 5 ng/mL,
and IGF-1 at 10 ng/mL. (B) EB-PE growth in various concentrations of
bFGF. Cells grown with bFGF and Epo were washed and replated at 5 × 104 cells/mL in different concentrations of bFGF and Epo.
The number of cells were counted daily for 4 days. (C) EB-PE cells
grown with bFGF and Epo were washed and replated at 3,000 cells/mL in various combinations of factors. Colonies were counted 5 days after the
replating.
|
|
View larger version (122K):
[in this window]
[in a new window]
| Fig 5.
Benzidine staining of EB-PE cells grown with different
growth factors. (A) EB-PE cells grown with bFGF and Epo. (B) EB-PE cells grown with IGF-1, IL-3, IL-6, IL-11, KL, and Epo.
|
|
Once we identified bFGF to be a growth factor for EB-PE cells, we
tested whether bFGF is also a growth factor for primary EryP cells. Our
initial experiments to determine if bFGF has a mitogenic effect on EryP
precursors were performed using day 4 EB cells, as they contain a large
number of EryP progenitors. bFGF was used at 10 to 30 ng/mL for initial
studies, since the highest growth-stimulatory effect on EB-PE cells was
observed at these concentrations. When day 4 EB cells were tested in a methylcellulose assay, the number of EryP colonies was similar in
cultures containing Epo or bFGF and Epo (Fig
6, data not shown). Since it was possible
that progenitors from later EBs contained more differentiated EryP
progenitors that might not respond to bFGF growth stimulation, EB cells
of an earlier stage of development were examined. However, the
replating of early EBs with bFGF at 10 to 30 ng/mL resulted in
increased secondary EB formation. Since bFGF was mitogenic for EB-PE
cells, even at 30 pg/mL, and the number of secondary EBs was not
increased from earlier EBs at these low bFGF concentrations (Fig 4B,
data not shown), lower bFGF concentrations were tested to determine if
bFGF stimulates primary EryP progenitor proliferation. One
representative result obtained from replating EBs at different stages,
with bFGF at various concentrations, on EryP progenitors is shown in
Fig 6A and the relative increase of EryP numbers from three experiments is shown in Fig 6B. As shown, the number of EryP colonies was consistently higher in cultures containing bFGF at 30 to 100 pg/mL compared with cultures containing Epo only when early EB cells (up to
day 3 to 3.5) were tested. The mitogenic effect of bFGF on EryP
progenitors was heparin-dependent, since no enhancement in colony
formation was observed in the absence of heparin (data not shown). The
bFGF growth-stimulatory effect, at low concentrations (30 to 100 pg/mL), on EryP cells was less obvious when later EB (>day 3.5) cells
were tested. Further, the effect of bFGF at higher concentrations (1 ng/mL) on EryP cells was not as consistent as that of lower
concentrations (30 to 100 pg/mL), regardless of EB ages tested (Fig 6B,
compare day 2.875 v 3). Taken together, it appeared that bFGF
was growth stimulatory for early-stage EryP progenitors only at low
concentrations and in the presence of heparin.
View larger version (31K):
[in this window]
[in a new window]
| Fig 6.
bFGF effect on EryP colony development. (A) EBs at
different days were replated in methylcellulose culture with bFGF at
various concentrations in the presence of heparin (10 µg/mL). Each
point represents an average number obtained from 3 different plates. Error bars indicate standard deviations of numbers obtained from 3 different plates. (B) EryP numbers obtained with bFGF and Epo were
shown as a relative percent of those obtained with Epo only. Results
obtained from 3 independent experiments with EBs at different time
points (day 2.625 to 4.75) are shown.
|
|
Gene expression analysis.
There are four different isoforms of FGF receptors currently
known.38 To determine which of these is responsible for
bFGF signaling, Northern blot analysis, as well as semiquantitative RT-PCR, was performed on RNA obtained from EB-PE cells grown in the
presence or absence of bFGF. As shown in Fig
7A and B, fgfr-1 was expressed at a
low level when cells were grown in the absence of bFGF and was
expressed at a much higher level when cells were grown in bFGF. This
result indicated that fgfr-1 gene expression was induced by
culturing cells with bFGF. flk-1 expression was also
upregulated, while EpoR expression was downregulated in cells cultured
with bFGF and Epo. The expression level of fgfr-2 was extremely
low (can be detected only after a 5-day exposure) and the expression of
fgfr-3 and fgfr-4 was undetectable in EB-PE cells (data
not shown). It is generally speculated that bFGF can upregulate its own
expression in an autocrine manner in cells cultured with bFGF. However,
bFGF gene expression in EB-PE cells grown in bFGF and Epo was not
detectable, suggesting that bFGF worked as a paracrine growth factor
for EB-PE cells (data not shown). Taken together, these data indicated
that fgfr-1 was the corresponding receptor for bFGF and that
fgfr-1, flk-1, and EpoR gene expression could be regulated
depending on culture conditions.
View larger version (27K):
[in this window]
[in a new window]
| Fig 7.
Gene expression analysis. (A) Northern blot analysis. RNA
was prepared from EB-PE cells grown with IGF-1, KL, and Epo (lanes 1)
and with bFGF and Epo (lanes 2). After electrophoresis, RNA was
transferred to a nylon membrane and hybridized with fgfr-1, flk-1, or EpoR probe. GAPDH is shown as a loading control. (B) RT-PCR analysis. RNA was prepared from EB-PE cells grown with IGF-1,
KL, and Epo (lanes 1) or with bFGF and Epo (lanes 2), and subjected to
RT-PCR. -actin is shown as a control. The amplified DNA sizes are as
follows: fgfr-1, 236 bp; EpoR, 452 bp; -actin, 443 bp.
|
|
| |
DISCUSSION |
The study of EryP development has been limited by the transient nature
of EryP cells and the lack of a representative cell line for ex vivo
studies. We have generated an immortalized EryP cell line, EB-PE. The
EB-PE cell line is important for the following reasons. First, these
cells maintain EryP cell characteristics. They require growth factor(s)
for survival and/or proliferation, yet can undergo
differentiation. Therefore, these cells should be useful to investigate
cellular and molecular events regulating EryP lineage development.
Second, the generation of a EryP cell line from differentiated ES cells
emphasizes the utility of the ES model system. In fact, EB-PE is, to
our knowledge, the first EryP line to be generated. The manipulation of
this in vitro ES system may enable us to access other primitive
hematopoietic cells.
We demonstrated that Epo was absolutely required for EB-PE
proliferation and differentiation and that bFGF is a mitogenic factor
for EB-PE cells. Further, cells remained undifferentiated when bFGF was
present in the culture medium. The response of EB-PE to a bFGF
mitogenic signal correlated with the upregulation of fgfr-1 and
the downregulation of EpoR gene expression. It is possible that the
level of EpoR gene expression is directly related to the state of the
cell, ie, proliferation versus differentiation. Further studies are
required to resolve this issue.
Several other studies have demonstrated that bFGF is a hematopoietic
growth factor.39-43 bFGF has been shown to directly
stimulate myeloid progenitors when either low-density
adherence-depleted bone marrow mononuclear cells or CD34+
cell population were tested in a methylcellulose colony
assay.40 The direct mitogenic effect has also been observed
on the growth of megakaryocyte progenitors.41,42 Our
finding that bFGF is a potent, novel growth factor for EryP cells
suggests that bFGF may have a broader role in hematopoiesis. The fact
that EryP are the first mature blood cells to develop further argues
that bFGF may even have a role in the establishment of hematopoiesis.
Contrary to our observation that bFGF is a mitogen for EryP
progenitors, studies by Beradi et al,40 using bone
marrow-derived cells, did not show any growth-stimulatory effect of
bFGF on erythroid cells. Given that bone marrow cells contain only EryD
progenitors, it is difficult to compare our results with theirs.
However, it is possible that bFGF confers a mitogenic effect only on
early-stage EryP progenitors. In fact, the ability to respond to a bFGF
mitogenic effect could reflect the different regulation mechanism(s)
involved in primitive versus definitive erythropoiesis.
The bFGF mitogenic effect on primary EryP progenitors appears to be
dependent on concentration and differentiation stage of the progenitor,
as the bFGF mitogenic effect was observed only when early EBs were
replated (<day 3 to 3.5) at lower bFGF concentrations (30 to 100 pg/mL). Further, heparin was required for the bFGF mitogenic effect on
primary EryP cells, while the response of EB-PE cells to bFGF was
independent of heparin. Since heparin, upon binding to bFGF, augments
the fgfr-1 activation, it is possible that cells expressing
high levels of fgfr-1 may not require heparin. It is not clear
why bFGF at higher concentrations failed to confer a mitogenic signal
for early EryP progenitors, especially since the bFGF mitogenic effect
on EB-PE cells was dose-dependent (Fig 4B). Factors including activin A
and TGF-1 exhibit their mitogenic effects in a
concentration-dependent manner.44,45 Therefore, it is
possible that bFGF also exerts its mitogenic effect in a similar
manner. Further studies are required to resolve this issue.
Gene expression analysis indicated that H1, SCL, and c-kit
expression is much higher in primary EryP cells. The difference in
H1 and c-kit gene expression levels in these two cell
populations could reflect immortalized versus primary cells.
Alternatively, this gene expression difference could be due to culture
conditions. While EB-PE cells were maintained in FCS, primary EryP
cells were generated with PDS. Both fgfr-1 and flk-1
gene expression were induced when EB-PE cells were grown in bFGF. The
fgfr-1 gene induction clearly conferred a further mitogenic
stimulus on EB-PE cells. However, the significance of the flk-1
induction by bFGF in EB-PE cells is less clear, since VEGF did not
confer any growth stimulus on these cells. The similar observation that
flk-1 gene expression is induced by bFGF was also made by
Flamme et al.46 In this study, flk-1 expression was
induced within 24 hours when bFGF was added to the in vitro quail
blastodiscs culture system, which gives rise to blood islands and
vascular structure formation. Further studies are required to determine
whether VEGF/Flk-1/Flt-1 interaction is necessary for primitive
erythropoiesis.
The finding that bFGF is a growth factor for EB-PE and that
fgfr-1 expression is induced when cells were grown in bFGF and Epo is intriguing, since bFGF has been shown to be a growth factor for
a number of different leukemic cells.47,48 Receptors for various isoforms of FGFs have also been shown to be expressed in many
different leukemic cells.47,48 Based on our observation, it
will be interesting to see whether bFGF/Fgfr-1 interaction plays a role
in erythroleukemic cell proliferation. Our data indicate that a single
retroviral genome is present in EB-PE cells. Since the retroviral
genome does not carry an oncogene, it is speculated that the EB-PE
immortalization was a result of the deregulation of the expression of a
cellular gene. We are currently characterizing the insertion site to
investigate the nature of the interrupted cellular sequence.
| |
FOOTNOTES |
Submitted April 10, 1997;
accepted December 16, 1997.
Supported in part by National Institutes of Health (NIH) Grant No.
R29HL55337.
Address reprint requests to Kyunghee Choi, PhD, Washington University,
Department of Pathology, 660 S Euclid Ave, Campus Box 8118, St Louis,
MO 63110.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
| |
ACKNOWLEDGMENT |
We are grateful to G. Keller, G. Longmore, and D.M. Pardoll for helpful
discussions and advice throughout this work. We thank P. Faloon, A. Gudkov, D. Kalvakolanu, A. Kazarov, and M. Shin for critically reading
the manuscript. We thank A. Kazarov for help with figure preparation.
We also thank D.H. Fremont for encouragement throughout this work.
| |
REFERENCES |
1.
Russell ES:
Hereditary anemias of the mouse: A review for geneticists.
Adv Genet
20:357,
1979[Medline]
[Order article via Infotrieve]
2.
Zon L:
Developmental biology of hematopoiesis.
Blood
86:2876,
1995[Abstract/Free Full Text]
3.
Huang H,
Auerbach R:
Identification and characterization of hematopoietic stem cells from the yolk sac of the early mouse embryo.
Proc Natl Acad Sci USA
90:10110,
1993[Abstract/Free Full Text]
4.
Wong PMC,
Chung SW,
Chui DHK,
Eaves CJ:
Properties of the earliest clonogenic hematopoietic precursors to appear in the developing murine yolk sac.
Proc Natl Acad Sci USA
83:3851,
1986[Abstract/Free Full Text]
5.
Cumano A,
Curlonger C,
Paige CJ:
Differentiation and characterization of B-cell precursors detected in the yolk sac and embryo body of embryos beginning at the 10-12 somite stage.
Proc Natl Acad Sci USA
90:6429,
1993[Abstract/Free Full Text]
6.
Huang H,
Zettergren LD,
Auerbach R:
In vitro differentiation of B cells and myeloid cells from the early mouse embryo and in extraembryonic yolk sac.
Exp Hematol
22:19,
1994[Medline]
[Order article via Infotrieve]
7.
Liu C,
Auerbach R:
In vitro development of murine T cells from prethymic and preliver embryonic yolk sac hematopoietic stem cells.
Development
113:1315,
1991[Abstract]
8.
Enver T,
Greaves DR:
Globin gene switching: A paradigm or what?
Curr Opin Biotechnol
2:787,
1991[Medline]
[Order article via Infotrieve]
9.
Liebhaber SA,
Wang Z,
Cash FE,
Monks B,
Russell JE:
Developmental silencing of the embryonic zeta-globin gene: Concerted action of the promoter and the 3-flanking region combined with stage-specific silencing by the transcribed segment.
Mol Cell Biol
16:2637,
1996[Abstract]
10.
Fleischman RA:
From white spots to stem cells: The role of the kit receptor in mammalian development.
Trends Genet
9:285,
1993[Medline]
[Order article via Infotrieve]
11.
Mucenski ML,
McLain K,
Kier AB,
Swerdlow SH,
Schreiner CM,
Miller TA,
Pietryga DW,
Scott WJ,
Potter SS:
A functional c-myb gene is required for normal murine fetal hepatic hematopoiesis.
Cell
65:677,
1991[Medline]
[Order article via Infotrieve]
12.
Wu H,
Liu X,
Jaenisch R,
Lodish HF:
Generation of committed erythroid BFU-E and CFU-E progenitors does not require erythropoietin or the erythropoietin receptor.
Cell
83:59,
1995[Medline]
[Order article via Infotrieve]
13.
Lin CS,
Lim SK,
D'Agati V,
Costantini F:
Differential effects of an erythropoietin receptor gene disruption on primitive and definitive erythropoiesis.
Genes Dev
10:154,
1996[Abstract/Free Full Text]
14.
Kimelman D,
Maas A:
Induction of dorsal and ventral mesoderm by ectopically expressed Xenopus basic fibroblast growth factor.
Development
114:261,
1992[Abstract]
15.
Dyson S,
Gurdon JB:
Activin signalling has a necessary function in Xenopus early development.
Curr Biol
7:81,
1997[Medline]
[Order article via Infotrieve]
16. Hogan BLM, Blessing M, Winnier GE, Suzuki N, Jones CM: Growth
factors in development: The role of TGF- related polypeptide signalling molecules in embryogenesis. Development suppl:53,
1994
17.
Yamaguchi TP,
Harpal K,
Henkemeyer M,
Rossant J:
Fgfr-1 is required for embryonic growth and mesodermal patterning during mouse gastrulation.
Genes Dev
8:3032,
1994[Abstract/Free Full Text]
18.
Deng C-X,
Wynshaw-Boris A,
Shen MM,
Daugherty C,
Ornitz DM,
Leder P:
Murine fgfr-1 is required for early postimplantation growth and axial organization.
Genes Dev
8:3045,
1994[Abstract/Free Full Text]
19.
Dickson MC,
Martin JS,
Cousins FM,
Kulkarni AB,
Karlsson S,
Akhurst RJ:
Defective hematopoiesis and vasculogenesis in transforming growth factor-b1 knock out mice.
Development
121:1845,
1995[Abstract]
20.
Keller G,
Kennedy M,
Papayannopoulou T,
Wiles M:
Hematopoietic commitment during embryonic stem cell differentiation in culture.
Mol Cell Biol
13:473,
1993[Abstract/Free Full Text]
21.
Keller G:
In vitro differentiation of embryonic stem cells.
Curr Opin Cell Biol
7:862,
1995[Medline]
[Order article via Infotrieve]
22.
Kennedy M,
Firpo M,
Choi K,
Wall C,
Robertson S,
Kabrun N,
Keller G:
A common precursor for primitive erythropoiesis and definitive hematopoiesis.
Nature
386:488,
1997[Medline]
[Order article via Infotrieve]
23.
Steffen D,
Weinberg RA:
The integrated genome of murine leukemia virus.
Cell
15:1003,
1978[Medline]
[Order article via Infotrieve]
24.
Barker DD,
Wu H,
Hartung S,
Breindl M,
Jaenisch R:
Retrovirus-induced insertional mutagenesis: Mechanism of collagen mutation in Mov13 mice.
Mol Cell Biol
11:5154,
1991[Abstract/Free Full Text]
25.
Pear WS,
Nolan GP,
Scott ML,
Baltimore D:
Production of high-titer helper-free retroviruses by transient transfection.
Proc Natl Acad Sci USA
90:8392,
1993[Abstract/Free Full Text]
26.
Chomczynski P,
Sacchi N:
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal Biochem
162:156,
1987[Medline]
[Order article via Infotrieve]
27.
Chelly J,
Kaplan JC,
Maire P,
Gautron S,
Kahn A:
Transcription of the dystrophin gene in human muscle and non-muscle tissue.
Nature
333:858,
1988[Medline]
[Order article via Infotrieve]
28. Sambrook J, Fritsch EF, Maniatis T: Molecular Cloning: A
Laboratory Manual. Cold Spring Harbor, NY, Cold Spring Harbor Laboratory, 1989
29.
Weiss MJ,
Keller G,
Orkin S:
Novel insights into erythroid development revealed through in vitro differentiation of GATA-1-embryonic stem cells.
Genes Dev
8:1184,
1994[Abstract/Free Full Text]
30.
Jin Y,
Pasumarthi KB,
Bock ME,
Lytras A,
Kardami E,
Cattini PA:
Cloning and expression of fibroblast growth factor receptor-1 isoforms in the mouse heart: Evidence for isoform switching during heart development.
J Mol Cell Cardiol
26:1449,
1994[Medline]
[Order article via Infotrieve]
31.
Matthews W,
Jordan CT,
Gavin M,
Jenkins NA,
Copeland NG,
Lemischka IR:
A receptor tyrosine kinase cDNA isolated from a population of enriched primitive hematopoietic cells and exhibiting close genetic linkage to c-kit.
Proc Natl Acad Sci USA
8:9026,
1991
32.
Choi K,
Wall C,
Hanratty R,
Keller G:
Isolation of a gene encoding a novel receptor tyrosine kinase from differentiated embryonic stem cells.
Oncogene
9:1261,
1994[Medline]
[Order article via Infotrieve]
33.
Karasuyama H,
Melchers F:
Establishment of mouse cell lines which constitutively secrete large quantities of interleukin 2, 3, 4, or 5 using modified cDNA expression vectors.
Eur J Immunol
18:97,
1988[Medline]
[Order article via Infotrieve]
34.
Gudkov AV,
Kazarov AR,
Thimmapaya R,
Axenovich SA,
Mazo IA,
Roninson IB:
Cloning mammalian genes by expression selection of genetic suppressor elements: Association of kinesin with drug resistance and cell immortalization.
Proc Natl Acad Sci USA
91:3744,
1994[Abstract/Free Full Text]
35.
Orkin SH:
Cell-specific transcription and cell differentiation in the erythroid lineage.
Curr Opin Cell Biol
2:1003,
1990[Medline]
[Order article via Infotrieve]
36.
Kabrun N,
Buhring HJ,
Choi K,
Ullrich A,
Risau W,
Keller G:
FLK-1 expression defines a unique population of embryonic hematopoietic precursors.
Development
124:2039,
1997[Abstract]
37.
Ogawa M:
Differentiation and proliferation of hematopoietic stem cells.
Blood
81:2844,
1993[Abstract/Free Full Text]
38.
Coutts JC,
Gallagher JT:
Receptors for fibroblast growth factors.
Immunol Cell Biol
73:584,
1995[Medline]
[Order article via Infotrieve]
39.
Allouche M:
Basic fibroblast growth factor and hematopoiesis.
Leukemia
9:937,
1995[Medline]
[Order article via Infotrieve]
40.
Berardi AC,
Wang A,
Abraham J,
Scadden DT:
Basic fibroblast growth factor mediates its effects on committed myeloid progenitors by direct action and has no effect on hematopoietic stem cells.
Blood
86:2123,
1995[Abstract/Free Full Text]
41.
Bruno E,
Cooper RJ,
Wilson EL,
Gabrilove JL,
Hoffman R:
Basic fibroblast growth factor promotes the proliferation of human megakaryocyte progenitor cells.
Blood
82:430,
1993[Abstract/Free Full Text]
42.
Avraham H,
Banu N,
Scadden DT,
Abraham J,
Groopman JE:
Modulation of megakaryocytopoiesis by human basic fibroblast growth factor.
Blood
83:2126,
1994[Abstract/Free Full Text]
43.
Gabbianelli M,
Sargiacomo M,
Pelosi E,
Testa U,
Isacchi G,
Peschile C:
Pure human hematopoietic progenitors: Permissive action of basic fibroblast growth factor.
Science
249:1561,
1990[Abstract/Free Full Text]
44.
Ohga E,
Matsuse T,
Teramoto S,
Katayama H,
Nagase T,
Fukuchi Y,
Ouchi Y:
Effects of activin A on proliferation and differentiation of human lung fibroblasts.
Biochem Biophys Res Commun
228:391,
1996[Medline]
[Order article via Infotrieve]
45.
Pepper MS,
Vassalli JD,
Orci L,
Montesano R:
Other formats: Biphasic effect of transforming growth factor-beta 1 on in vitro angiogenesis.
Exp Cell Res
204:356,
1993[Medline]
[Order article via Infotrieve]
46.
Flamme I,
Breier G,
Risau W:
Vascular endothelial growth factor (VEGF) and VEGF receptor 2 (flk-1) are expressed during vasculogenesis and vascular differentiation in the quail embryo.
Dev Biol
169:699,
1995[Medline]
[Order article via Infotrieve]
47.
Allouche M,
Bayard F,
Clamens S,
Fillola G,
Sie P,
Amalric F:
Expression of basic fibroblast growth factor (bFGF) and FGF-receptors in human leukemic cells.
Leukemia
9:77,
1995[Medline]
[Order article via Infotrieve]
48.
Nara N,
Kurokawa H,
Tohda S,
Tomiyama J,
Nagata K,
Tanikawa S:
The effect of basic and acidic fibroblast growth factors (bFGF and aFGF) on the growth of leukemic blast progenitors in acute myelogenous leukemia.
Exp Hematol
23:1030,
1995[Medline]
[Order article via Infotrieve]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
S. Carotta, S. Pilat, A. Mairhofer, U. Schmidt, H. Dolznig, P. Steinlein, and H. Beug
Directed differentiation and mass cultivation of pure erythroid progenitors from mouse embryonic stem cells
Blood,
September 15, 2004;
104(6):
1873 - 1880.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. E. Burger, S. Coetzee, W. L. McKeehan, M. Kan, P. Cook, Y. Fan, T. Suda, R. P. Hebbel, N. Novitzky, W. A. Muller, et al.
Fibroblast growth factor receptor-1 is expressed by endothelial progenitor cells
Blood,
November 15, 2002;
100(10):
3527 - 3535.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Abstract
Introduction
Abstract