|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 91 No. 9 (May 1), 1998:
pp. 3323-3332
High CD30 Ligand Expression by Epithelial Cells and Hassal's
Corpuscles in the Medulla of Human Thymus
By
Paola Romagnani,
Francesco Annunziato,
Roberto Manetti,
Carmelo Mavilia,
Laura Lasagni,
Cinzia Manuelli,
Gabriella B. Vannelli,
Vittorio Vanini,
Enrico Maggi,
Cinzia Pupilli, and
Sergio Romagnani
From the Department of Clinical Physiopathology, Endocrinology Unit;
the Institute of Internal Medicine and Immunoallergology; and the
Department of Anatomy, University of Florence; and Apuano Pediatric
Hospital, Massa-Carrara, Italy.
 |
ABSTRACT |
CD30 is a member of tumor necrosis factor (TNF) receptor superfamily
that is expressed by activated T cells in the presence of interleukin-4
(IL-4). Although CD30 can mediate a variety of signals, CD30-deficient
mice have impaired negative selection of T cells, suggesting that at
least in the context of murine thymus, CD30 is a cell death-mediating
molecule. The ligand for CD30 (CD30L) is a membrane-associated
glycoprotein related to TNF, which is known to be expressed mainly by
activated T cells and other leukocytes. However, the nature of
CD30L-expressing cells involved in the interaction with CD30+
thymocytes is unclear. We report here that in postnatal human thymus
the great majority of CD30+ cells are double positive (CD4+CD8+),
activated, IL-4 receptor-expressing T cells which selectively localize
in the medullary areas. Moreover, many medullary epithelial cells and Hassal's corpuscles in the same thymus specimens showed unusually high
expression of CD30L in comparison with other lymphoid or nonlymphoid
tissues. These findings provide additional information on the nature
and localization of CD30+ thymocytes and show that epithelial cells
are the major holder of CD30L in the thymic medulla.
 |
INTRODUCTION |
CD30 IS A MEMBER of the tumor necrosis
factor (TNF) receptor family1 that was originally
identified as a surface antigen on Reed-Sternberg cells in Hodgkin's
disease (HD).2,3 CD30 was subsequently found to be
preferentially expressed by human activated T cells producing type 2 cytokines (Th2 cells) both in vitro4,5 and in
vivo.6,7 The reason for this association has recently been
clarified in mice, where CD30 expression seems to reflect the ability
of CD4+ T cells to respond to interleukin-4 (IL-4).8
The ligand for CD30 (CD30L) is a membrane-associated glycoprotein
related to TNF,9 which is known to be expressed mainly by
activated T cells, as well as other leukocytes.9-11
However, the physiological meaning of CD30/CD30L interactions is still unclear. In vitro studies have shown that CD30 can mediate a variety of
activation and differentiation signals, a capacity that varies with
cell type and origin. Engagement of CD30 on cell lines has been shown
to induce immunoglobulin secretion in Epstein-Barr virus-transformed
lymphoblastoid cells, proliferation in T-cell-like HD-derived cells,
or cell death in anaplastic large-cell lymphoma cells.12
Recently, it has been shown that the CD30-deficient mice contain
elevated numbers of thymocytes and show a gross defect in negative but
not positive selection, suggesting an important role for CD30/CD30L
interactions in the deletion of autoreactive T cells.13
However, the nature of CD30L-expressing cells in the thymus is unknown.
Here we show that CD30 is expressed on remarkable numbers of CD4+CD8+
(or more rarely CD4+CD8 ), CD45RO+, IL-4 receptor (IL-4R)-expressing human medullary thymocytes. More importantly, both thymic epithelial cells (TEC) and Hassal's corpuscles in the medulla showed high CD30L
expression. These data define the nature and localization of CD30+
thymocytes and identify the cells expressing CD30L in human thymus,
thus providing indirect morphological support to the concept that
negative selection might occur as a result of CD30/CD30L interactions
in the thymic medulla.
 |
MATERIALS AND METHODS |
Antibodies.
Fluorescein isothiocyanate (FITC)- phyeoerythrin (PE)- and peridinin
chlorophyll protein (PerCP)-conjugated anti-CD3 (Leu 4),
anti-CD4 (Leu 3a), anti-CD8 (Leu 2a), and anti-CD45RO monoclonal antibodies (MoAbs) were purchased from Becton Dickinson (Mountain View,
CA). FITC-conjugated anti-CD30 (Ber-H2) MoAb was purchased from Dako
(Gastrup, Denmark). Anti-IL-4R MoAb was purchased from R & D Systems
(Minneapolis, MN) and conjugated with Sulfo-NHS-LC-Biotin from Pierce
(Rockford, USA). PE-conjugated streptavidin was purchased from Sigma
Chemical Co (St Louis, MO). Anti-CD4 (Ancell Co, Bayport, MN),
anti-CD30 (HRS4; Immunotech, Marseille, France), anti-CD30L (M81;
Genzyme Diagnostics, Cambridge, MA), anti-pan-cytokeratin (C11; Sigma
Immunochemicals, Milan, Italy), anti-IL-4R (25463.11; R & D Systems),
and anti-TE4 (a generous gift of Dr B.F. Haynes (Duke University,
Durham, NC) MoAbs were used for immunohistochemical studies. The mouse
IgG2b used as isotype-matched control for CD30L MoAb was purchased from
Southern Biotechnology Associated Inc (Birmingham, AL).
Tissues.
Normal postnatal thymus specimens were obtained from five children
during corrective cardiac surgery at the Apuano Pediatric Hospital
(Massa-Carrara, Italy). The five children were 5 days old, 7 days old,
5 months old, 7 months old, and 3 years old, respectively. Fetal thymus
specimens were obtained from seven fetuses after voluntary or
therapeutic abortions, four between gestation week 11 and 12 and three
at gestation week 13. Tonsil fragments were obtained from two children
undergoing tonsillectomy because of chronic tonsillitis. Lymph node
fragments were obtained from biopsy specimens taken from two patients
with nonspecific lymphoadenitis. Skin biopsy specimens were obtained
from three patients suffering from atopic dermatitis. Kidney biopsy
specimens were obtained from two patients with localized kidney tumor.
Gut biopsy specimens were obtained from two patients suffering from Crohn's disease and one suffering from intestinal cancer. The procedures followed in the study were in accordance with the ethical standards of the responsible regional committee on human
experimentation.
Cytofluorimetric analysis of thymocyte suspensions and separation of
IL-4R+ and IL-4R thymocytes.
Thymic tissue fragments were gently passed through a
stainless-steel mesh to obtain single-cell suspensions from which
mononuclear cells (MNC) were separated by centrifugation on
Ficoll-Hypaque (Nycomed Pharma As., Oslo, Norway) gradient. Thymic MNC
were resuspended in phosphate-buffered saline (PBS) containing bovine
serum albumin (BSA) 0.5% and 0.02% sodium azide and then incubated
with FITC-, PE-, or PerCP-conjugated anti-CD3, anti-CD4, anti-CD8,
anti-CD30, and anti-CD45RO MoAbs and biotinylated anti-IL-4R MoAb,
followed by PE-conjugated streptavidin. Cell surface marker analysis
was performed on a FACScan cytofluorimeter (Becton Dickinson).
Separation of IL-4R+ and IL-4R thymocytes was performed by
high-gradient magnetic cell sorting.14 Briefly, MNC were
incubated for 20 minutes with biotinylated anti-IL-4R MoAb, washed,
and then incubated for an additional 20 minutes with MACS colloidal
super-paramagnetic microbeads conjugated with streptavidin (MACS;
Multifort, Milteny Biotec GmbH, Bergisch Gladbach,
Germany). After washing, the cells were then separated on
a MiniMACS column and inserted into a MiniMACS magnet. Negative and
positive fractions were collected as IL-4R and IL-4R+, respectively.
Establishment of TEC and kidney glomerular epithelial cell cultures.
Primary thymic stromal cell cultures were initiated by an explant
technique from one postnatal (age, 5 months) and one fetal (age, 11 weeks) thymic sample according to the technique described by Fernandez
et al.15 Briefly, small thymic fragments were anchored in
6-well plates (Costar, Cambridge, MA) and cultured in
D-valine-containing Eagle's Minimal Essential Medium (GIBCO BRL Life
Technologies, Ltd, Paisley, UK), supplemented with 10% inactivated
fetal calf serum (FCS; GIBCO) (TEC medium). D-valine-containing medium
was used to hinder the growth of fibroblasts. After 5 to 7 days at 37°C, the culture medium was replaced by fresh TEC medium. Explants were removed at day 14, the adherent cells detached by treatment with
Puck's-modified solution containing trypsin and EDTA
(GIBCO), and subcultured repeatedly in the TEC medium. After two
passages, the epithelial nature of growing cells was assessed by
immunostaining for pan-cytokeratin, as described below. Cloned TEC
lines were obtained by seeding TEC at 1 cell/well in 96-well culture
plates in TEC medium containing 25% culture supernatant from parental cells. At semiconfluency, growing clones were subcultured in standard TEC medium in 24-well plates, and subsequently transferred to 25-cm2 flasks.
Cultures of glomerular epithelial cells, obtained from macroscopically
normal kidneys of patients with localized renal tumors undergoing
nephrectomy, were also established.16 The cortex was
separated from the medulla, minced, and glomeruli were isolated by a
standard sieving technique through graded mesh size screens (60, 80, 150 mesh). The glomerular suspension was collected, washed, and
incubated with 750 U/mL collagenase type IV at 37°C for 30 minutes.
The glomeruli were then cultured in Dulbecco modified Eagle's medium
(Sigma Immunchemicals) supplemented with 10% FCS, 5 µg/mL insulin,
and 5 µg/mL transferrin. Glomeruli were maintained in culture with
three changes of medium every week. Growing glomerular epithelial cells
were characterized with the same anti-pan cytokeratin MoAb used to
characterize TEC.
Cloning and sequencing of the CD30 probe.
mRNA was extracted from activated peripheral blood MNC and reversed to
first-strand cDNA by oligo dT primer, using a first-strand synthesis
kit (Stratagene Ltd, Cambridge, MA). Amplification of the first-strand
products was performed in a Thermal cycler (Idaho Technology, Idaho
Falls, ID). The samples were subjected to 30 cycles of amplification
using 10 pmol of each primer (5 GGAAGCGAATTCGGCAGAAGCTCCAC and 5
CCACGATCACGGTGTCAGCCTTCATG) and 0.5 U of Taq DNA polymerase in 10-µL
volume. The DNA fragment of 347 bp amplified by polymerase chain
reaction was subcloned in pGEM-7 (Promega Co, Madison, WI) according to
manufacturer's instructions. Sequencing of the amplified product was
performed by the dideoxynucleotide chain-termination method,17 by using 35S dATP and sequenase
enzyme (USB, Cleveland, OH).
In situ hybridization.
In situ hybridization was performed on frozen thymus sections by using
CD30 probes. To do this, the plasmid containing the CD30 cDNA was
linearized with SalI or SphI restriction
enzymes, followed by phenol-chloroform extraction and ethanol
precipitation. Thereafter, sense and antisense RNA probes were
synthesized using SP6 or T7 RNA polymerases (Riboprobe Gemini System;
Promega) in the presence of 35S alpha-thio-UTP (1,300 mCi/mmol; NEN Dupont, Paris, France). Frozen thymus sections were
mounted onto gelatin-coated slides and fixed with 4% paraformaldehyde
for 20 minutes at room temperature. Sections were subsequently treated
with 0.2 N HCl for 20 minutes, pronase (0.125 mg/mL) for 10 minutes,
0.1 mol/L glycine for 30 seconds, and 4% paraformaldehyde for 20 minutes. Then, sections were rinsed with PBS, acetylated, and
dehydrated in increasing ethanol concentrations. Thirty microliters of
the hybridization solution (40% formamide, 4 × SSC, 10 mmol/L
dithiothreitol, 1 × Denhardt's solution [Sigma], 10% dextran
sulphate, 0.1 mg/mL sheared herring sperm DNA, and 1 mg/mL yeast tRNA),
containing 8 × 105 cpm of 35S-labeled human
CD30 RNA antisense probe, were applied to each section and covered with
parafilm. Hybridization was performed at 52°C for 16 hours. Removal
of the nonspecifically bound probe by RNAase digestion and
autoradiography were performed, as detailed elsewhere.18
Sections were subsequently counterstained with Mayer's hematoxylin and
mounted with Kaiser's glycerol gelatin (Merck, Darmastadt, Germany).
An average of five sections were analyzed for each tissue sample.
Negative controls consisted of hybridization to a sense RNA probe. In
same samples hybridized with anti-sense CD30 probe, immunostaining for
CD30L was also performed. To do this, after hybridization with CD30
probe, RNA-ase digestion, and appropriate washings, sections were
stained with the anti-CD30L MoAb and then subjected to autoradiography,
as described above.
Immunohistochemistry.
Immunohistochemical staining was performed on 10-µm cryostat sections
or cultured cells fixed in 4% paraformaldehyde for 20 minutes or in
acetone for 10 minutes. Sections were subsequently exposed to 0.3%
hydrogen peroxide-methanol solution to quench endogenous peroxidase
activity. After a 30-minute preincubation with normal horse serum
(Vectastain ABC kit; Vector Laboratories, DBA, Milan, Italy), sections
were layered for 30 minutes with anti-CD4 (5 µg/mL), anti-CD30 (4 µg/mL), anti-CD30L (10 µg/mL), anti-cytokeratin (25 µg/mL), or
anti-IL-4R (25 µg/mL) MoAbs, followed by biotinylated anti-mouse IgG
horse Ab, and the avidin-biotin-peroxidase complex (Vectastain ABC
kit), as described.19 As a peroxidase substrate,
3-amino-9-ethylcarbazole (AEC; Sigma) was used. Finally, sections were
counterstained with Gill's hematoxylin (Merck) and mounted with Kaiser's glycerol gelatin. All incubations were performed at room temperature. As negative control, primary MoAb was replaced with an isotype-matched antibody with irrelevant specificity or mouse
ascites fluid.
Double immunostaining.
Double immunostaining was performed by using the
avidin-biotin-peroxidase system with two different substrates, as
described.19 To identify CD30 and CD30L on the same
specimen, the AEC (red color) and the Vector SG (bluish-grey)
substrates were used, respectively. To identify CD30L and cytokeratin
or CD30L and TE4 on the same specimen, the AEC and the Vector SG
substrates were used, respectively. After double immunostaining,
sections were counterstained with methyl green and mounted with
Kaiser's glycerol gelatin.
Detection of apoptotic cells.
Apoptosis (DNA fragmentation) was detected by the terminal
deoxynucleotidyl transferase (TdT)-mediated dUTP-biotin nick
end-labeling (TUNEL) method, which has been shown to identify cells
with DNA strand breaks in cryostat sections of normal lymphoid tissues, including murine thymus.20 In brief, after 10% formalin
fixation and removal of endogenous peroxidase with 2%
H2O2, the sections were incubated at 37°C for
1 hour in a solution containing TdT and digoxigenin-labelled dUTP. The
sections were then treated with the peroxidase-labeled anti-digoxigenin
Ab solution for 30 minutes. The reaction products were
developed with AEC and counterstained with methyl green. As a negative
control, PBS was substituted for TdT containing digoxigenin-labeled
dUTP, which resulted in no staining. All the reagents were purchased
from Oncor Ltd (Gaithersburg, MD).
 |
RESULTS |
Selective CD30 expression by a subset of activated medullary
thymocytes.
Fresh MNC suspensions from four fetal (between week 11 and 12 of
gestation) and five postnatal (5 days to 3 years of age) thymuses were
assessed by flow cytometry for CD30 expression. No CD30+ cells were
observed in any of fetal thymuses, whereas small but detectable numbers
of CD30+ cells were found in all postnatal thymuses examined, with
percentages varying from 3.2 to 4.2 (mean values, 3.6 ± 0.1). The
great majority of CD30+ cells were double-positive (CD4+CD8+)
lymphocytes, the other being CD4+CD8 (Fig
1A).Virtually all CD30+ T cells were CD45RO+ and showed the expression of
IL-4R (Fig 1B). The consistent expression of IL-4R on CD30+ thymocytes
was confirmed by fractionation experiments. When thymocyte suspensions
were subdivided into IL-4R+ and IL-4R , virtually all CD30+ cells
were recovered in the IL-4R+ fraction (Fig 1C). Because IL-4 has been
shown to be the most potent inducer of both IL-4R and
CD30,8,21-24 these data may be consistent with the
possibility that CD30+ thymocytes are activated T cells which are
responding to IL-4.

View larger version (29K):
[in this window]
[in a new window]
| Fig 1.
Detection and characterization by flow cytometry of
CD30+ T cells in postnatal thymus. Freshly isolated thymic MNC were
resuspended in PBS containing 0.5% BSA and 0.02% sodium azide at the
concentration of 1 × 106 cells/mL. Cells were then
assessed for CD30, CD4, and CD8 expression (A), as well as for CD30,
CD45RO, and IL-4R expression (B) by three-color flow cytometry.
IL-4R+ were then separated from IL-4R thymocytes by incubation of
thymic MNC with biotin-conjugated anti-IL-4R MoAb, followed by
addition of streptavidin-coated MACS colloidal supermagnetic
microbeads, and the two subsets were then assessed for CD30 expression
(C). A representative experiment is shown.
|
|

View larger version (155K):
[in this window]
[in a new window]
| Fig 2.
Localization of CD30+ and IL-4R+ cells in the
medullary areas of postnatal thymus. (A) Autoradiograph of a thymus
cryostat section hybridized with 35S-labeled antisense CD30
probe, showing positive signal in the medullary areas and along the
septa (dark field, original magnification ×40). (B) Autoradiograph of
a consecutive section hybridized with sense CD30 probe, showing
virtually no signal (dark field, original magnification ×40). (C)
Autoradiograph of a thymic medullary area hybridized with antisense
CD30 probe showing high CD30 mRNA expression (dark field, original
magnification × 100). (D) Autoradiograph of a consecutive section
hybridized with sense CD30 probe showing no signal (dark field,
original magnification ×100). (E) CD30 immunoreactive cells in the
thymic medulla. Section was immunostained with anti-CD30 MoAb, using
the avidin-biotin-peroxidase method, and the AEC substrate (red color,
original magnification ×100). (F) IL-4R immunoreactive cells in the
thymic medulla (red color, original magnification ×100).
|
|

View larger version (112K):
[in this window]
[in a new window]
| Fig 3.
CD30L expression by Hassal's corpuscles and
medullary TEC in postnatal thymus. (A) CD30L immunoreactivity in the
thymic medulla. Section was immunostained with anti-CD30L MoAb, using
the avidin-biotin-peroxidase method, and the AEC substrate (red color,
original magnification ×100). (B) CD30L immunoreactivity (red color),
which is clearly visible in a medullary area (bottom right), limited to
a few scattered cells in the cortex (original magnification ×100).
(C) Strong CD30L immunoreactivity in the outer part of a Hassal's
corpuscle (original magnification ×1,000). (D) CD30L immunoreactivity
in some medullary cells (original magnification ×250). (E) Double immunostaining for CD30L and cytokeratin in the medullary area. CD30L
was identified by using the AEC substrate (red color) and cytokeratin
by using the Vector SG substrate (bluish-grey color). Hassal's
corpuscles and some cells staining for both cytokeratin and CD30L
(purple-brown color), as well as many cells staining for cytokeratin
alone, are visible (original magnification ×400). (F) Double
immunostaining for CD30L (red color) and TE4 (bluish-grey color). Cells
staining for both CD30L and TE4 (purple-brown color), as well as cells
staining for TE4 alone, are visible (original magnification ×400).
(G) Absence of immunostaining in a thymic medullary section where the
anti-CD30L Ab was replaced by an isotype-matched control MoAb (original
magnification ×400). (H) Double immunostaining showing distinct
cellular distribution for CD30 (red color, arrows) and CD30L
(bluish-grey color, arrowheads, original magnification ×1,000).
|
|

View larger version (118K):
[in this window]
[in a new window]

View larger version (139K):
[in this window]
[in a new window]
| Fig 4.
CD30L expression and detection of apoptotic cells in
fetal and postfetal human thymuses. (A) Large numbers of
cytokeratin-positive cells (bluish-grey color) in a fetal thymus
specimen taken at week 11 of gestation (original magnification ×100).
(B) Absence of TE4 and (C) absence of CD30L immunostaining
(bluish-grey color) in the same fetal thymus (original magnification
×100). (D) Large numbers of cytokeratin-positive cells
(bluish-grey color) in a fetal thymus taken at week 13 of
gestation (original magnification ×400). (E) Several cells in a
adjacent section staining positive for TE4 (bluish-grey color original
magnification ×400). (F) A few cells in an adjacent section showing
CD30L immunoreactivity (bluish-grey color, original magnification
×400). (G) Apoptotic cells detected by the TUNEL technique (red
color) in a postnatal fetal thymus (original magnification ×100). (H)
Absence of apoptotic cells in a fetal thymus taken at week 11 of
gestation (original magnification ×100).
|
|

View larger version (84K):
[in this window]
[in a new window]
| Fig 5.
CD30L expression in a cultured TEC clone derived from
postnatal human thymus. (A) Immunostaining for cytokeratin of cultured cells from a thymic clone; cells were fixed in acetone and stained by
using the avidin-biotin-peroxidase method and the AEC substrate (red
color, original magnification ×100); inset: high-power magnification of three cells showing intense cytokeratin immunoreactivity (original magnification ×250). (B) Absence of reactivity by the same cells stained with an isotype-matched control MoAb (original magnification ×100). (C) Immunostaining for CD30L of cultured
epithelial cells from the same postnatal thymus clone; cells were fixed
in 4% paraformaldehyde and staining was performed by using the
avidin-biotin-peroxidase method and the AEC substrate (red color,
original magnification ×100). (D) Detection of CD30L expression on
cultured cells from the same postnatal thymus clone by flow cytometry.
Cells (1 × 106/mL) were resuspended in PBS containing
0.5% BSA and 0.02% sodium azide and incubated with anti-CD30L (black
area) or isotype-matched control (white area) MoAb, followed by
FITC-conjugated anti-mouse IgG2b goat Ab. Absence of
CD30L expression in cultured kidney glomerular epithelial cells
(E) and in cultured T lymphocytes obtained from the same postnatal
thymus (F).
|
|
To provide additional information on the nature and localization of
CD30+ T cells in the human thymus, in situ hybridization and
immunohistochemical analyses were performed on the same postnatal thymus specimens. By in situ hybridization, CD30 expression was found
in many cells scattered in the medullary areas and along the septa,
whereas cortical areas showed little if any CD30 mRNA expression (Fig
2A and B). By immunohistochemistry, CD30+ cells appeared
to be selectively localized in the medullary areas, but their numbers
were apparently lower than those revealed by in situ hybridization (Fig
2C). Likewise, IL-4R-expressing cells were maximally detectable in the
thymic medulla, their proportions being higher than those of CD30+
cells (Fig 2D). This was caused in part by the lack of CD30 expression
by a proportion of IL-4R+ T lymphocytes, as shown by flow cytometry
(Fig 1B and C), and in part by IL-4R expression by other cell types,
possibly TEC.
High CD30L expression by medullary TEC and Hassal's corpuscles.
To establish whether cell types potentially able to interact with CD30+
medullary thymocytes were detectable, the presence of CD30L-expressing
cells in the same thymus specimens was investigated. CD30L has been
found to be expressed by a subset of activated macrophages and T
lymphocytes,9 as well as by B cells,10 and
granulocytes.11 Surprisingly, we found high CD30L
expression in the outer wall of Hassal's corpuscles from all five
thymuses examined, as well as in several TEC mainly localized in the
medullary areas (Fig 3A, C, and D), whereas only a few
scattered CD30L+ cells were found in the cortex (Fig 3B). As control,
CD30L expression was assessed under the same experimental conditions in
other lymphoid and nonlymphoid tissues, such as peripheral blood,
tonsil, lymph nodes, skin, kidney, and gut. Although a few lymphoid
cells in tonsils and lymph nodes showed slight CD30L staining, no
similar CD30L immunoreactivity was found in any hematopoietic or
epithelial cell from the different tissues examined (data not shown).
The epithelial nature of CD30L-expressing cells in the human thymus was
confirmed by double immunostaining for CD30L and cytokeratin or TE4, an
antigen selectively expressed by medullary and subcapsular cortical
TEC.25 Indeed, all CD30L-reactive cells also stained positive for cytokeratin, but not all cytokeratin-positive cells stained positive for CD30L (Fig 3E). Likewise, all CD30L-expressing cells stained positively for TE4, but not vice versa (Fig 3F). No
staining of medullary TEC or Hassal's corpuscles was found by using an
isotype matched control MoAb (Fig 3G). More importantly, when double
immunohistochemistry with anti-CD30 and anti-CD30L MoAb was performed,
clear-cut separation of the two stainings in possibly interacting CD30+
T cells and CD30L+ TEC was observed (Fig 3H). By contrast, despite the
presence of large numbers of cytokeratin-positive cells (Fig
4A), neither TE4 nor CD30L expression was found in any
of four fetal thymuses obtained before week 12 of gestation (Fig 4B and
C). Of note, cells showing DNA strand breaks (apoptotic
cells), as assessed by the TUNEL technique, were largely present in all
postnatal thymuses (Fig 4G), but they could not be detected in fetal
thymuses before week 12 of gestation (Fig 4H). However, in two of three
fetal thymuses obtained at week 13 of gestation, which also contained
large numbers of cells staining positively for cytokeratin (Fig 4D),
TE4 immunoreactive cells (Fig 4E) and a few, but clearly
distinguishable CD30L-reactive cells, were observed (Fig 4F). TEC
cultures were also derived from one postnatal and one fetal thymic
sample by an explant technique and repeated subculture in
D-valine-containing medium as selective condition against fibroblast
growth, and in the absence of exogenous growth factors. Some thymic
stromal cell lines enriched in epithelial cells (80% to 100%, as
determined by cytokeratin immunostaining) were obtained after repeated
subculture from both postnatal and fetal thymuses. However, only two
clones obtained from the postnatal thymus which showed positive
staining with the anti-cytokeratin MoAb (Fig 5A), but
not with an isotype-matched control Ab (Fig 5B), also stained
positively with the anti-CD30L Ab (Fig 5C). Cytofluorimetric analysis
revealed CD30L reactivity by the great majority of cells from the same
TEC clones (Fig 5D), but neither by other TEC clones derived from the
same line, nor by cultured kidney epithelial cells (Fig 5E), nor thymic
T lymphocytes (Fig 5F), used as additional controls. Taken together,
these findings suggest that CD30L expression is limited to a subset of
medullary TEC, becomes detectable during the thymus development only
after the week 12 of gestation, and precedes the appearance of
apoptosis.
 |
DISCUSSION |
The results of the present study provide additional evidence for a role
of CD30 expression by T cells in the outcome of differentiation and/or selection events in the thymus. A previous study had
already reported spontaneous CD30 expression on small numbers of cells in the human thymic medulla.3 More recent data using
Northern blot analysis have shown abundant expression of CD30 mRNA in
the murine thymus.26 The mechanisms responsible for CD30
expression by T cells have recently been clarified. In activated human
T cells, CD30 expression is associated with the production of Th2-type cytokines both in vitro4,5 and in vivo,6,7 and
seems to be dependent on the presence of IL-4.21 In
activated murine T cells, CD30 expression is mainly caused by the
activity of IL-4.8 Because IL-4 strongly upregulates on
murine T cells the expression of IL-4R,22-24 even in mice
CD30 expression would be limited to T cells that express functional
IL-4R. Thus, in both mice and humans CD30 expression seems to reflect
the ability of T cells to respond to IL-4. The fact that virtually all
CD30+ cells in the postnatal human thymus were CD45RO+ IL-4R+ (as shown
by the cytofluorimetric analysis) and that CD30+ and IL-4R+ cells
coexist in the thymic medulla (as shown by both in situ hybridization and immunohistochemistry) is in agreement with these findings. Based on
these data, it is reasonable to speculate that after activation by
autologous peptides, human thymocytes produce IL-4, which in turn
upregulates in an autocrine or paracrine way the expression of both
IL-4R22-24 and CD30.8,21 Thus, although it has
been suggested that both positive and negative selection can occur in
the cortex,27 the demonstration of IL-4R+ CD30+ thymocytes
in the medullary areas may be rather consistent with the thought that
negative selection takes place predominantly in the
medulla.28
However, the most important finding emerging from this study is the
identification of cells which, because of their ability to express the
ligand for CD30, can represent the potential target for CD30+
thymocytes. Surprisingly and interestingly, CD30L was detected in the
outer wall of Hassal's corpuscles and in medullary TEC, as clearly
shown by the concomitant expression not only of cytokeratin, but also
of TE4, an antigen selectively present in cortical subcapsular and
medullary TEC.25 Of note, the expression of CD30L in both
TEC and Hassal's corpuscles was unusually high in comparison with any
other lymphoid and nonlymphoid tissue tested, suggesting a selective
role for such a molecule in the thymic medulla.
The physiological meaning of CD30/CD30L interactions in the thymus is
of great potential interest. In vitro studies have indeed showed that
CD30 is able to mediate proliferation, differentiation, or even cell
death, depending on both cell type and origin.12 Interestingly, CD30-deficient mice have been shown to contain elevated
numbers of thymocytes and exhibit a gross defect in negative but not
positive selection, suggesting an important role for CD30/CD30L interactions at the thymic level in the deletion of autoreactive T
cells.13 Because of the obvious difficulty to perform
functional studies in humans, we could not directly prove that the
interaction between CD30+ thymocytes and CD30L-expressing TEC in the
thymic medulla is one of the effector mechanisms responsible for
negative selection. However, the data here reported provide indirect
morphological evidence in favor of this possibility. First, both TE4+
and CD30L+ cells were absent in fetal thymuses obtained
before week 12 of gestation when apoptosis could not yet be observed.
Cells staining positive for both TE4 and CD30L became detectable in
fetal thymuses obtained at week 13 of gestation, which is consistent
with the observation that human thymus is not differentiated fully
before week 15 of gestation, when the cortico-medullary junctions and the first Hassal's corpuscles become visible.29 Finally,
CD30L was widely expressed even at level of Hassal's corpuscles in all postnatal thymuses, where large numbers of apoptotic cells in both
cortical and medullary areas could be observed.
An additional hypothesis that can be raised from the results of this
study concerns the physiological meaning of Hassal's corpuscles. The
function, if any, of these whorled structures is presently unknown. In
a recent report, it has been shown that cross-linked CD30L can
transduce a signal to the ligand-bearing cell, blurring the distinction
between ligand and receptor.30 Thus, the demonstration of
high CD30L expression in the outer wall of Hassal's corpuscles might
provide the explanation of why these residues of degenerating TEC
develop. It may indeed be suggested that CD30L-expressing Hassal's
corpuscles reflect the high turnover of medullary TEC death because of
reverse signaling provided by the interaction with CD30+ thymocytes.
 |
FOOTNOTES |
Submitted September 30, 1997;
accepted December 29, 1997.
Supported by grants provided by Associazione Italiana Ricerca Cancro
(AIRC), the Italian Ministry of Health (AIDS and Multiple Sclerosis
Projects), and European Community (EC) (Biotech and FAIR Projects).
Address reprint requests to Sergio Romagnani, MD, Istituto
di Medicina Interna e Immunoallergologia, Viale Morgagni 85, 50134-Firenze, Italy.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.
 |
ACKNOWLEDGMENT |
The excellent technical assistance of Nadia Misciglia is acknowledged.
 |
REFERENCES |
1.
Smith CA,
Davis T,
Anderson D,
Solam L,
Beckmann MP,
Jerzy R,
Dower SK,
Cosman D,
Goodwin RG:
A receptor for tumor necrosis factor defines an unusual family of cellular and viral proteins.
Science
248:1019,
1990[Abstract/Free Full Text]
2.
Schwab U,
Stein H,
Gerdes J,
Lemke H,
Kirchner H,
Schaadt M,
Diehl V:
Production of a monoclonal antibody specific for Hodgkin and Sternberg-Reed cells of Hodgkin's disease and a subset of normal lymphoid cells.
Nature
299:65,
1982[Medline]
[Order article via Infotrieve]
3.
Stein H,
Mason DY,
Gerdes J,
O'Connor N,
Wainscoat J,
Pallesen G,
Gatter K,
Falini B,
Delson G,
Lemke H,
Schwarting R,
Lennert K:
The expression of Hodgkin's disease associated antigen Ki-1 in reactive and neoplastic lymphoid tissue: Evidence that the Reed Sternberg cells and histiocytic malignancies are derived from activated lymphoid cells.
Blood
66:848,
1985[Abstract/Free Full Text]
4.
Manetti R,
Annunziato F,
Biagiotti R,
Giudizi M-G,
Piccinni M-P,
Giannarini L,
Sampognaro S,
Parronchi P,
Vinante F,
Pizzolo G,
Maggi E,
Romagnani S:
CD30 expression by CD8+ T cells producing type 2 helper cytokines. Evidence for large numbers of CD8+CD30+ T cell clones in human immunodeficiency virus infection.
J Exp Med
180:2407,
1994[Abstract/Free Full Text]
5. Del Prete GF, De Carli M, Almerigogna F, Daniel CK, D'Elios MM,
Zancuoghi G, Vinante F, Pizzolo G, Romagnani S: Preferential expression
of CD30 by human CD4+ T cells producing Th2-type cytokines. FASEB J
9:81, 1995
6.
Chilosi M,
Facchetti F,
Notarangelo LD,
Romagnani S,
Del Prete GF,
Almerigogna F,
De Carli M,
Pizzolo G:
CD30 cell expression and abnormal soluble CD30 serum accumulation in Omenn's syndrome. Evidence for a Th2-mediated condition.
Eur J Immunol
26:329,
1996[Medline]
[Order article via Infotrieve]
7.
D'Elios MM,
Romagnani P,
Scaletti C,
Annunziato F,
Manghetti M,
Mavilia C,
Parronchi P,
Pupilli C,
Pizzolo G,
Maggi E,
Del Prete GF,
Romagnani S:
In vivo CD30 expression in human diseases with predominant activation of Th2-like T cells.
J Leukoc Biol
61:539,
1997[Abstract]
8.
Nakamura T,
Lee RK,
Nam SY,
Al-Ramadi BK,
Koni PA,
Bottomly K,
Podack ER,
Flavell RA:
Reciprocal regulation of CD30 expression on CD4+ T cells by IL-4 and IFN- .
J Immunol
158:2090,
1997[Abstract]
9.
Smith CA,
Gruss H-J,
Davis T,
Anderson D,
Farrah T,
Baker E,
Sutherland GR,
Brannan CI,
Copeland NG,
Jenkins NA,
Grabstein KH,
Gliniak B,
McAllister IB,
Fanslow W,
Alderson M,
Falk B,
Gimpel S,
Gillis S,
Din WS,
Goodwin RG,
Armitage RJ:
CD30 antigen, a marker for Hodgkin's lymphoma, is a receptor whose ligand defines an emerging family of cytokines with homology to TNF.
Cell
73:1349,
1993[Medline]
[Order article via Infotrieve]
10.
Younes A,
Consoli U,
Zhao S,
Snell V,
Thoma E,
Gruss H,
Cabanillas FV,
Andreeff M:
CD30 ligand is expressed on resting normal and malignant B lymphocytes.
Br J Haematol
93:569,
1996[Medline]
[Order article via Infotrieve]
11.
Gruss H,
Pinto A,
Gloghini A,
Wehnes E,
Wright B,
Boiani M,
Aldinucci D,
Gattei V,
Zagonel V,
Smith CA,
Kadin ME,
Von Schilling C,
Goodwin RG,
Herrmann F,
Carbone A:
CD30 ligand expression in nonmalignant and Hodgkin's disease-involved lymphoid tissues.
Am J Pathol
149:469,
1996[Abstract]
12.
Gruss H,
Boiani N,
Williams DE,
Armitage RJ,
Smith CA,
Goodwin RG:
Pleiotropic effects of the CD30 ligand on CD30-expressing cells and lymphoma cell lines.
Blood
83:2045,
1994[Abstract/Free Full Text]
13.
Amakawa R,
Hakem A,
Kundig TM,
Matsuyama T,
Simard JJL,
Timms E,
Wakeham A,
Mittruecker H-W,
Griesser H,
Takimoto H,
Schmits R,
Shahinian A,
Oshaki PS,
Penninger JF,
Mak TW:
Impaired negative selection of T cells in Hodgkin's disease antigen CD30-deficient mice.
Cell
84:551,
1996[Medline]
[Order article via Infotrieve]
14.
Miltenyi S,
Muller W,
Weichel W,
Radbruch A:
High gradient magnetic cell separation with MACS.
Cytometry
11:231,
1990[Medline]
[Order article via Infotrieve]
15.
Fernandez E,
Vicente A,
Zapata A,
Brera B,
Lozano JL,
Carlos-Martinez A,
Toribio ML:
Establishment and characterization of cloned human thymic epithelial cell lines. Analysis of adhesion molecule expression and cytokine production.
Blood
83:3245,
1994[Abstract/Free Full Text]
16.
van Det NF,
van der Born J,
Tamsma JT,
Verhagen NAM,
van den Heuvel LPWJ,
Berden JHM,
Bruijn JA,
Daha MR,
van der Woude FJ:
Proteoglycan production by human glomerular visceral epithelial cells and mesangial cells in vitro.
Biochem J
307:759,
1995
17.
Sanger F,
Nicklen S,
Coulson AR:
DNA sequencing with chain-terminating inhibitors.
Proc Natl Acad Sci USA
74:5463,
1997
18.
Pupilli C,
Brunori M,
Misciglia N,
Selli C,
Ianni L,
Yanagisaw M,
Mannelli M,
Serio M:
Presence and distribution of endothelin-1 gene expression in human kidney.
Am J Physiol
267:F679,
1994[Abstract/Free Full Text]
19.
Parronchi P,
Romagnani P,
Annunziato F,
Sampognaro S,
Becchio A,
Giannarini L,
Maggi E,
Pupilli C,
Tonelli F,
Romagnani S:
Type 1 T helper (Th1)-cell predominance and IL-12 expression in the gut of patients with Crohn's disease.
Am J Pathol
150:823,
1997[Abstract]
20.
Gavrieli Y,
Sherman Y,
Ben Sasson SA:
Identification of programmed cell death in situ via specific labelling of nuclear DNA fragmentation.
J Cell Biol
119:493,
1992[Abstract/Free Full Text]
21.
Annunziato F,
Manetti R,
Cosmi L,
Galli G,
Heusser CH,
Romagnani S,
Maggi E:
Opposite role for interleukin 4 and interferon- on CD30 and lymphocyte activation gene-3 (LAG-3) expression by activated naive T cells.
Eur J Immunol
27:2239,
1997[Medline]
[Order article via Infotrieve]
22.
Ohara J,
Paul WE:
Up-regulation of interleukin-4/B-cell stimulatory factor 1 receptor expression.
Proc Natl Acad Sci USA
85:8221,
1988[Abstract/Free Full Text]
23.
Renz H,
Domenico J,
Gelfand EW:
IL-4-dependent up-regulation of IL-4 receptor expression in murine T and B cells.
J Immunol
146:3049,
1991[Abstract]
24.
Nakamura T,
Kamogawa Y,
Bottomly K,
Flavell RA:
Polarization of IL-4- and IFN-gamma-producing CD4+ T cells following activation of naive CD4+ T cells.
J Immunol
158:1085,
1997[Abstract]
25.
Haynes BF,
Scearce RM,
Lobach DF,
Hensley LL:
Phenotypic characterization and ontogeny of mesodermal-derived and endocrine epithelial components of the human thymic microenvironment.
J Exp Med
159:1149,
1984[Abstract/Free Full Text]
26.
Bowen MA,
Lee RK,
Miragliotta G,
Nam SY,
Podack ER:
Structure and expression of murine CD30 and its role in cytokine production.
J Immunol
156:442,
1996[Abstract]
27.
Murphy KM,
Heimberger AB,
Loh DY:
Induction by antigen of intrathymic apoptosis of CD4+CD8+TCR1o thymocytes in vivo.
Science
250:1720,
1990[Abstract/Free Full Text]
28.
Surh CD,
Sprent J:
T-cell apoptosis detected in situ during positive and negative selection in the thymus.
Nature
372:100,
1994[Medline]
[Order article via Infotrieve]
29.
Spits H,
Lanier LL,
Philips JH:
Development of human T and natural killer cells.
Blood
85:2654,
1995[Free Full Text]
30.
Wiley SR,
Goodwin RG,
Smith CA:
Reverse signaling via CD30 ligand.
J Immunol
157:3635,
1996[Abstract]

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
R. Zeiser, V. H. Nguyen, J.-Z. Hou, A. Beilhack, E. Zambricki, M. Buess, C. H. Contag, and R. S. Negrin
Early CD30 signaling is critical for adoptively transferred CD4+CD25+ regulatory T cells in prevention of acute graft-versus-host disease
Blood,
March 1, 2007;
109(5):
2225 - 2233.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. A. Chentoufi, M. Palumbo, and C. Polychronakos
Proinsulin Expression by Hassall's Corpuscles in the Mouse Thymus
Diabetes,
February 1, 2004;
53(2):
354 - 359.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
A. Younes and M. E. Kadin
Emerging Applications of the Tumor Necrosis Factor Family of Ligands and Receptors in Cancer Therapy
J. Clin. Oncol.,
September 15, 2003;
21(18):
3526 - 3534.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Lasagni, M. Francalanci, F. Annunziato, E. Lazzeri, S. Giannini, L. Cosmi, C. Sagrinati, B. Mazzinghi, C. Orlando, E. Maggi, et al.
An Alternatively Spliced Variant of CXCR3 Mediates the Inhibition of Endothelial Cell Growth Induced by IP-10, Mig, and I-TAC, and Acts as Functional Receptor for Platelet Factor 4
J. Exp. Med.,
June 2, 2003;
197(11):
1537 - 1549.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Chiarle, J. Z. Gong, I. Guasparri, A. Pesci, J. Cai, J. Liu, W. J. Simmons, G. Dhall, J. Howes, R. Piva, et al.
NPM-ALK transgenic mice spontaneously develop T-cell lymphomas and plasma cell tumors
Blood,
March 1, 2003;
101(5):
1919 - 1927.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Vinante, A. Rigo, M. T. Scupoli, and G. Pizzolo
CD30 triggering by agonistic antibodies regulates CXCR4 expression and CXCL12 chemotactic activity in the cell line L540
Blood,
January 1, 2002;
99(1):
52 - 60.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Romagnani, F. Annunziato, E. Lazzeri, L. Cosmi, C. Beltrame, L. Lasagni, G. Galli, M. Francalanci, R. Manetti, F. Marra, et al.
Interferon-inducible protein 10, monokine induced by interferon gamma, and interferon-inducible T-cell alpha chemoattractant are produced by thymic epithelial cells and attract T-cell receptor (TCR) {alpha}{beta}+CD8+ single-positive T cells, TCR{gamma}{delta}+ T cells, and natural killer-type cells in human thymus
Blood,
February 1, 2001;
97(3):
601 - 607.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. L. DeYoung, O. Duramad, and A. Winoto
The TNF Receptor Family Member CD30 Is Not Essential for Negative Selection
J. Immunol.,
December 1, 2000;
165(11):
6170 - 6173.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Muta, L. H. Boise, L. Fang, and E. R. Podack
CD30 Signals Integrate Expression of Cytotoxic Effector Molecules, Lymphocyte Trafficking Signals, and Signals for Proliferation and Apoptosis
J. Immunol.,
November 1, 2000;
165(9):
5105 - 5111.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Annunziato, P. Romagnani, L. Cosmi, C. Beltrame, B. H. Steiner, E. Lazzeri, C. J. Raport, G. Galli, R. Manetti, C. Mavilia, et al.
Macrophage-Derived Chemokine and EBI1-Ligand Chemokine Attract Human Thymocytes in Different Stage of Development and Are Produced by Distinct Subsets of Medullary Epithelial Cells: Possible Implications for Negative Selection
J. Immunol.,
July 1, 2000;
165(1):
238 - 246.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. E. Kadin
Regulation of CD30 Antigen Expression and Its Potential Significance for Human Disease
Am. J. Pathol.,
May 1, 2000;
156(5):
1479 - 1484.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. ROMAGNANI, C. BELTRAME, F. ANNUNZIATO, L. LASAGNI, M. LUCONI, G. GALLI, L. COSMI, E. MAGGI, M. SALVADORI, C. PUPILLI, et al.
Role for Interactions Between IP-10/Mig and CXCR3 in Proliferative Glomerulonephritis
J. Am. Soc. Nephrol.,
December 1, 1999;
10(12):
2518 - 2526.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
P. Romagnani, A. De Paulis, C. Beltrame, F. Annunziato, V. Dente, E. Maggi, S. Romagnani, and G. Marone
Tryptase-Chymase Double-Positive Human Mast Cells Express the Eotaxin Receptor CCR3 and Are Attracted by CCR3-Binding Chemokines
Am. J. Pathol.,
October 1, 1999;
155(4):
1195 - 1204.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Chantry, P. Romagnani, C. J. Raport, C. L. Wood, A. Epp, S. Romagnani, and P. W. Gray
Macrophage-Derived Chemokine Is Localized to Thymic Medullary Epithelial Cells and Is a Chemoattractant for CD3+, CD4+, CD8low Thymocytes
Blood,
September 15, 1999;
94(6):
1890 - 1898.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Kishimoto and J. Sprent
Several Different Cell Surface Molecules Control Negative Selection of Medullary Thymocytes
J. Exp. Med.,
July 1, 1999;
190(1):
65 - 74.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Chiarle, A. Podda, G. Prolla, E. R. Podack, G. J. Thorbecke, and G. Inghirami
CD30 Overexpression Enhances Negative Selection in the Thymus and Mediates Programmed Cell Death Via a Bcl-2-Sensitive Pathway
J. Immunol.,
July 1, 1999;
163(1):
194 - 205.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|