Blood, Vol. 92 No. 1 (July 1), 1998:
pp. 184-190
Construction and Characterization of a Fusion Protein of Single-Chain
Anti-CD20 Antibody and Human 
-Glucuronidase for
Antibody-Directed Enzyme Prodrug Therapy
By
Hidde J. Haisma,
M. Fleur Sernee,
Erik Hooijberg,
Ruud H. Brakenhoff,
Ida H. v.d. Meulen-Muileman,
Herbert M. Pinedo, and
Epie Boven
From the Departments of Medical Oncology and Otolaryngology/Head and
Neck Surgery, Academic Hospital Vrije Universiteit, Amsterdam; and the
Department of Immunology, The Netherlands Cancer Institute, Antoni van
Leeuwenhoek Huis, Amsterdam, The Netherlands.
 |
ABSTRACT |
The CD20 antigen is an attractive target for specific treatment of
B-cell lymphoma. Antibody-directed enzyme prodrug therapy (ADEPT) aims
at the specific activation of a nontoxic prodrug at the tumor site by
an enzyme targeted by a tumor-specific antibody such as anti-CD20. We
constructed a fusion protein of the single-chain Fv anti-CD20 mouse
monoclonal antibody (MoAb) 1H4 and human 
-glucuronidase for the
activation of the nontoxic prodrug
N-[4-doxorubicin-N-carbonyl(-oxymethyl) phenyl] O--glucuronyl
carbamate to doxorubicin at the tumor site. The cDNAs encoding the
light- and heavy-chain variable regions of 1H4 were cloned, joined by a
synthetic sequence encoding a 15-amino acid linker and fused to human
-glucuronidase by a synthetic sequence encoding a 6-amino acid
linker. An antibody-enzyme fusion protein-producing cell line was
established by transfection of the construct into human embryonic
kidney 293/EBNA cells. The yield of active fusion protein was 100 ng/mL
transfectoma supernatant. Antibody affinity, antibody specificity, and
enzyme activity were fully retained by the fusion protein.
Immunoprecipitation and analysis by sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) showed that the
fusion protein has a relative molecular weight (Mw) of 100 kD under denaturing conditions. Gel filtration analysis
indicated that the enzymatically active form of the fusion protein is a
tetramer with an Mw of approximately 400 kD. The nontoxic prodrug
N-[4-doxorubicin-N-carbonyl(-oxymethyl) phenyl] O--glucuronyl
carbamate was hydrolyzed by the fusion protein at a hydrolysis rate
similar to that of human -glucuronidase. When the fusion protein was
specifically bound to Daudi lymphoma cells, the prodrug induced similar
antiproliferative effects as doxorubicin. Thus, it is feasible to
construct a eukaryotic fusion protein consisting of a single-chain
anti-CD20 antibody and human -glucuronidase for future use in the
activation of anticancer prodrugs in B-cell lymphoma.
| |
INTRODUCTION |
MOST PATIENTS WITH non-Hodgkin's
lymphoma receive chemotherapy, with or without
radiotherapy.1 High-dose chemotherapy followed by stem cell
rescue is now being evaluated for its effect on the clinical course of
the disease and has shown improved event-free and overall
survival.2 Despite high response rates, 50% of all
patients will eventually relapse. Therefore, alternative treatment approaches, such as the use of monoclonal antibodies (MoAbs), are
evaluated. MoAbs directed against tumor-associated antigens are being
applied for both the detection and the treatment of cancer.
MoAb-directed therapy includes the chemically coupled radioisotopes,
cytostatic agents, or toxins to MoAbs.
The CD20 antigen is a suitable candidate for targeted therapy in
patients with non-Hodgkin's lymphoma: it is uniquely and abundantly
expressed on normal and malignant B cells, but not on hematopoietic
stem cells. It is a 33- to 35-kD integral membrane phosphoprotein,
which plays a role in B-cell proliferation and differentiation. The
CD20 antigen is not subject to modulation. MoAbs directed against CD20
have been successfully used in radioimmunotherapy trials in patients
with B-cell malignancies.3,4 In the majority of patients
resistant to chemotherapy, durable responses have been observed.
Recently, phase I and phase II trials have been performed with a
human/mouse chimeric anti-CD20, which shows antibody-dependent cell-mediated cytotoxicity. The response rate in the phase II study was
42%.5
A novel and promising strategy for targeted therapy is the use of MoAbs
to direct enzymes to tumor tissue, which then convert relatively
nontoxic prodrugs into active cytostatic agents (ADEPT, antibody-directed enzyme prodrug therapy).6-8 This approach
overcomes the problem of heterogeneity in MoAb distribution, as the
released drug can diffuse throughout the tumor and destroy tumor cells irrespective of their antigen expression. The catalytic activity of the
enzymes can be very high and, therefore, a high concentration of drug
can be achieved within the tumor, whereas little or no toxic effects
are expected in nontarget tissues. The higher tumor concentration of
the drug is expected to result in a higher response rate and might
overcome drug resistance.
For ADEPT, we have previously used chemically coupled antibody and
enzyme.9,10 A major disadvantage of such conjugates is
their intrinsic heterogeneity due to the lack of specificity of the
reagents used for conjugation. This necessitates additional purification steps and often results in reduced enzymatic activity or
diminished antibody binding of the conjugate. As an alternative, recombinant DNA technology can be used to prepare conjugates consisting of a uniform product with predictable properties. Single chain antibodies (scFv), consisting of the variable VH and VL chains offer
the advantage of being approximately threefold smaller than intact IgG
and can penetrate tumor lesions more readily. In addition, the lack of
an Fc portion should greatly reduce its immunogenicity.
We constructed a fusion protein consisting of the genes encoding the
variable regions of MoAb 1H4, an MoAb reactive with the CD20
antigen11,12 and human -glucuronidase. The fusion
protein was expressed in eukaryotic cells, because human
-glucuronidase needs to be glycosylated to form an enzymatically
active tetramer.13 The antibody binding specificity and
enzymatic activity of the fusion protein was analyzed and compared with
that of 1H4 and human -glucuronidase, respectively. Because
treatment regimens for non-Hodgkin's lymphoma frequently include
doxorubicin, we investigated the activating capacity of the fusion
protein in the presence of a doxorubicin-glucuronide prodrug,
N-[4-doxorubicin-N-carbonyl(-oxymethyl) phenyl] O--glucuronyl
carbamate (Fig 1).14
View larger version (12K):
[in this window]
[in a new window]
| Fig 1.
Chemical structure of prodrug
N-[4-doxorubicin-N-carbonyl (-oxymethyl) phenyl] O--glucuronyl
carbamate (DOX-GA3).
|
|
| |
MATERIALS AND METHODS |
Reagents.
Restriction enzymes were purchased from New England Biolabs (Beverly,
MA) and GIBCO-BRL (Breda, The Netherlands). T4
polynucleotide kinase, T4 DNA polymerase, T4 DNA ligase, Rnase H,
Terminal Deoxynucleotidyl Transferase and DNA polymerase I
(Klenow fragment) were from GIBCO-BRL. Pwo DNA polymerase
(Boehringer, Almere, NL) was used for polymerase chain reaction (PCR)
amplifications. All enzymes were used as recommended by the suppliers.
Oligonucleotides were synthesized by Pharmacia Biotech (Roosendaal,
NL). Purification of DNA was done using spin columns (Qiagen, Hilden,
Germany).
Cloning of variable regions.
cDNA clones encoding the variable region domains were obtained as
described.15 Briefly, RNA was isolated from
the anti-CD20 hybridoma 1H4 and cDNA was synthesized by reverse
transcription using an oligo-dT primer. The RNA template was destroyed
with RNAse H and an oligo-dC anchor sequence was added to the 3
end of the cDNA using Terminal Deoxynucleotidyl Transferase and
deoxycytidine triphosphate (dCTP). This material was then
used for a PCR using primers specific for the constant regions of the
heavy chain: HC1 tggaattcggggccagtggatagac or light chain: HL2
tgaagcttagatggatacagttggt16 and an oligo-dG primer:
gtgaattcggggggggggggg. The PCR products were cloned in pUC 19 and sequenced by the dideoxy method using a T7 kit (Pharmacia).
Construction of pscFv-CD20-human -glucuronidase.
Oligonucleotide primers were designed, encoding the linkers between the
light chain and heavy chain, and the heavy chain and human
-glucuronidase. The oligonucleotide primer pair CD20VHfor 5
gggaagcttcaccatg ggatggagttgtatc 3 CD20VHback
5
ccacacgaattcggatccgcctcctcctgaggagactgtgagagtgg 3 amplified a fragment coding for the eukaryotic ribosome
binding site, translation initiation codon (bold) and the N-terminal of the signal sequence of MoAb 1H4 and part of a synthetic 15-amino acid
linker (gly4-ser)3 as described by
Huston.17 The primers contained an HindIII site at
the 5 end and a BamHI and EcoRI site at the
3 end indicated in italics.
The oligonucleotide pair CD20VLfor 5
tgtaagcttggatccggcggaggcggaagcggtggcggaggctctcaaattgttctctcccagtc
3 CD20VLback 5 ccaagaattcctcgagtca tccggaacctttgatttccagcttggtgc 3 amplified a fragment
encoding part of the linker between VH and VL and the MoAb 1H4 light
chain without its signal sequence. The primers contained an
HindIII and BamHI site at the 5 end and an
Xho I and EcoRI site at the 3 end (italics). The
3 terminus also contained a BspEI site followed by a
stop codon (bold) to enable expression of scFv-CD20 without fusion to
human -glucuronidase. The BspEI site is preceded by part of
a gly4ser2 linker for the joining to
-glucuronidase. The oligonucleotide pair GUSfor 5
tgtgaagctttccggaggttctggtctgcagggcgggatgctgtacc 3
GUSback 5
ccaagaattcctcgagcagtagcgactttcatgccaactctttatttcc 3 was
used to amplify a DNA fragment encoding part of the
gly4ser2 linker and human
-glucuronidase18 without its signal peptide. The PCR
primers contained an HindIII and BspEI site at the
5 end and an Xho I and EcoRI site at the
3 end.
All PCR fragments were cloned into pUC19 after digestion with
HindIII and EcoRI and the sequences were checked by the
dideoxy method using T7 DNA polymerase (Pharmacia). pscFv-CD20 was
constructed by inserting the HindIII/BamHI fragment of
partially digested VL CD20 into the VH CD20 vector digested with the
same enzymes. -Glucuronidase cDNA was amplified with the indicated
primers, cut with HindIII and Kpn I, and cloned into a
Kpn I and HindIII-digested pUC19 vector. The
Kpn I-EcoRI fragment of the original cDNA encoding the
enzyme was then ligated into this vector, cut with Kpn I and EcoRI, thus reconstructing the open reading frame encoding
-glucuronidase. The pscFv-CD20--glucuronidase was constructed by
insertion of the BspEI/EcoRI fragment encoding
-glucuronidase into the pscFv-CD20 (Fig
2).
View larger version (20K):
[in this window]
[in a new window]
| Fig 2.
Schematic representation of the pCEP4
scFv-CD20--glucuronidase expression vector. Transcription is driven
by the human cytomegalovirus (CMV) enhancer-promotor sequence. The
polyadenylation signal and transcription termination signal are from
the bovine growth hormone gene.
|
|
Expression and purification of scFv-CD20--glucuronidase.
The insert containing scFv-CD20--glucuronidase was prepared by
EcoRI digestion, blunt ends preparation by treatment with dNTPs (2-deoxynucleoside 5-triphosphates) and Klenow
polymerase, followed by subsequent HindIII digestion. The
isolated HindIII-EcoRI/blunt fragment of
scFv-CD20--glucuronidase was ligated into Xba I
(blunt)/HindIII digested vector pcDNA3 (InVitrogen, Leek, NL).
An enzyme control vector was constructed using the human
-glucuronidase-encoding cDNA.18 The plasmids were
transfected into COS-7 cells by diethyl aminoethyl
(DEAE)-dextran for transient expression.19
Cells were grown in Dulbecco's modified Eagle's medium (DMEM)
containing 5% fetal calf serum (FCS) for 72 hours and the medium
containing scFv-CD20--glucuronidase or -glucuronidase was
collected. To obtain stable transfectants, the fusion protein insert
was isolated from the pcDNA3 vector by digestion with HindIII
and Xho I and ligated into the pCEP4 vector (InVitrogen)
digested with the same enzymes. The pCEP4 vector is an Epstein-Barr
virus (EBV)-based vector, which is maintained and replicated
extrachromosomally in primate and canine cells. This vector was used to
transform 293/EBNA (InVitrogen) cells using DOSPER
(Boehringer). Transfected cells were selected in medium containing 400 µg/mL hygromycin B (Boehringer). After 2 to 3 weeks resistant clones
were isolated and recloned by limiting dilution. The
scFv-CD20--glucuronidase fusion protein was purified from
transfectoma supernatants by ion-exchange chromatography as described
for human -glucuronidase.20
Characterization.
The molecular weight of the fusion protein or -glucuronidase was
determined by immunoprecipitation and gel filtration. For immunoprecipitation, COS-7 cells were metabolically labeled 48 hours
after transfection. First the cells were starved for 1 hour in DMEM
plus 5% dialyzed fetal bovine serum, which lacked methionine and
cysteine. For labeling, the same medium was used containing 100 µCi
of Trans35S-label (ICN, Zoetermeer, The
Netherlands) for 4 hours. Cell extracts and supernatants
were then immunoprecipitated with rabbit antihuman -glucuronidase as
described18 and analyzed by sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) as described by
Laemmli.21
Gel filtration was performed with an SX200 column (1.6 × 60 cm;
Pharmacia, Roosendaal, NL) in phosphate-buffered saline (PBS) to
estimate the molecular mass of the native fusion protein. The column
was run at 0.5 mL/min and fractions (0.5 mL) were assayed for
-glucuronidase activity. The column was calibrated with bovine serum
albumin (67 kD), IgG (150 kD), and -galactosidase (480 kD).
-Glucuronidase activity was measured fluorometrically. To 50 µL of
transfection supernatant or purified enzyme 100 µL substrate (4-methylumbelliferyl--glucuronide, 1 mmol/L in 100 mmol/L sodium acetate buffer pH 4.5) was added and incubated for 30 minutes at
37°C. The reaction was stopped by the addition of 1 mL 0.1 mol/L
Glycine-NaOH pH 10.5. Fluorescence was measured using an excitation
wavelength of 370 nm and an emission wavelength of 450 nm.
The binding of the fusion protein was determined with Daudi
cells.22 Purified fusion protein was added to Daudi cells
(105) at various concentrations for 1 hour at 4°C in
100 µL. Cells were washed three times with PBS and resuspended in 100 µL 4-methylumbelliferyl--glucuronide in buffer. After 2 hours at
37°C, 1 mL 0.1 mol/L glycine-NaOH was added and the fluorescence
was measured as described above. Binding was determined by subtracting
the values obtained with cells preincubated with an excess of anti-CD20
MoAb BCA-B206 from the fluorescence of the
samples.
Prodrug activation.
The kinetics of the hydrolysis by human -glucuronidase or fusion
protein was determined with the prodrug
N-[4-doxorubicin-N-carbonyl(-oxymethyl) phenyl] O--glucuronyl
carbamate14 at a concentration of 100 µmol/L in PBS
containing 0.1% BSA at pH 6.8 and at 37°C. Hydrolysis was followed
by high-performance liquid chromatography (HPLC) analysis
using a silica-C18 column (4.6 × 100 mm, 3 µm
CP; MicroSpher, Chrompack, Middelburg, NL) and an
isocratic eluent, which consisted of 2 mmol/L triethylamine in 20 mmol/L NaH2PO4 (pH 4.0)-acetonitrile (2:1,
vol/vol) at a flow rate of 1 mL/min. Before each analysis, samples were diluted in ice-cold methanol to precipitate proteins. The
eluate was analyzed with a fluorescence detector using an excitation
wavelength of 480 nm and an emission wavelength of 580 nm. Peak areas
were used to calculate the concentrations of drug and prodrug.
In vitro antiproliferative effects.
Daudi lymphoma cells22 were incubated with fusion protein
(10 µg/mL) or PBS for 1 hour at 4°C, washed three times and
seeded into 96-well plates at 2 × 104 cells/well. To
determine the specificity of the fusion protein, a separate set of
Daudi cells was pretreated (30 minutes, 4°C) with an excess of
anti-CD20 antibody BCA-B20,6 washed, and then incubated
with fusion protein. The cells were then exposed to the prodrug
N-[4-doxorubicin-N-carbonyl(-oxymethyl) phenyl] O--glucuronyl
carbamate at concentrations ranging from 0.01 to 50 µmol/L. In
separate wells an excess of -glucuronidase was present to determine
the antiproliferative effects of prodrug completely hydrolyzed by the
enzyme. After 24 hours, 200-µL medium was added and the cells were
allowed to proliferate for another 72 hours. Cells were fixed with
trichloroacetic acid and stained with Sulforhodamine B as
described.12 The antiproliferative effects were determined
and expressed as IC50 values, the concentrations that give 50% growth
inhibition compared with control growth.
| |
RESULTS |
Cloning of the 1H4 variable cDNAs and construction of
scFv-CD20--glucuronidase fusion protein.
The cDNAs encoding the 1H4 variable domains were cloned by reverse
transcriptase PCR from total RNA isolated from the 1H4 hybridoma. The
nucleotide sequence of the heavy and light variable chain cDNA was
determined. At least three independent clones were sequenced to ensure
that the DNA polymerase used in the PCR induced no mutations. The
nucleotide and deduced amino acid sequence of the cDNA encoding the
scFv-CD20 is shown in Fig 3. The sequences were used to design primers for the construction of the fusion protein.
View larger version (26K):
[in this window]
[in a new window]
| Fig 3.
Nucleotide and deduced amino acid sequence of the VH and
VL of anti-CD20 MoAb 1H4. The primers used for cloning are underlined. The cleavage site of the leader peptide (bold) is indicated by the
arrow.
|
|
The plasmid pCD20--glucuronidase was constructed as shown in Fig 2.
A 15-amino acid linker containing (gly4ser)3,
as described previously, separated the variable VH and VL antibody
domains.17 The cDNA encoding human
-glucuronidase18 was inserted in frame of the scFv
separated by a 6-amino acid linker segment. The signal peptides of VL
and human -glucuronidase were removed. The open reading frame
encoded a recombinant protein, which after cleavage of the secretory
signal sequence and C-terminal processing, was composed of 878 amino
acids with a predicted molecular weight (Mw) of 100 kD.
Expression and characterization of fusion protein.
The fusion protein was expressed in eukaryotic cells because human
-glucuronidase needs to be glycosylated to form an enzymatically active tetramer.13 The supernatants of the transfected
COS-7 cells contained approximately 10 ng/mL of enzymatically active fusion protein, which was approximately 10-fold less than that of COS-7
cells transfected with vector encoding human -glucuronidase. For
continuous production of fusion protein, 293/EBNA cells were transfected with pCEP4 vector encoding the fusion protein. Clones were
selected with hygromycin B and subcloned by limiting dilution. Culture
supernatants from these cells produced approximately 100 ng/mL fusion
protein.
Fusion protein or -glucuronidase was analyzed by immunoprecipitation
followed by SDS-PAGE. The fusion protein migrated with an apparent Mw
of 100 kD, whereas -glucuronidase monomers showed an Mw of
approximately 80 kD (Fig 4). Gel
filtration analysis of the fusion protein showed that it migrates as a
tetrameric protein with the expected Mw of approximately 400 kD (data
not shown).
View larger version (48K):
[in this window]
[in a new window]
| Fig 4.
Immunoprecipitation of scFv-CD20--glucuronidase.
COS-7 cells were transfected with scFvCD20--glucuronidase or
-glucuronidase cDNA. The cells were labeled 48 hours after
transfection with 35S-methionine/cysteine for 4 hours, the
supernatant was immunoprecipitated with rabbit anti--glucuronidase
antibody and analyzed by SDS-PAGE.
|
|
The binding of the fusion protein to Daudi lymphoma cells is shown in
Fig 5. The specificity of binding was
determined with the blocking anti-CD20 antibody BCA-B20. Binding of the
fusion protein was less than 5% in the presence of excess antibody.
From the binding data, the apparent affinity of the fusion protein was
calculated to be 3 × 109 L/mol.
View larger version (11K):
[in this window]
[in a new window]
| Fig 5.
Binding of scFv-CD20--glucuronidase to Daudi lymphoma
cells. Cells were incubated with fusion protein. Cells were
washed and the binding was determined by measuring the
-glucuronidase activity.
|
|
Prodrug activation and antiproliferative effects.
The enzymatic activity of the fusion protein was compared with that of
native recombinant -glucuronidase using the prodrug N-[4-doxorubicin-N-carbonyl(-oxymethyl) phenyl] O--glucuronyl carbamate as a substrate. At 100 µmol/L prodrug concentration, the
activation rates for the conversion of prodrug to drug were similar
(T1/2 = 130 minutes) for both the fusion protein and the enzyme
(Fig 6), showing that the fusion protein
possessed the full enzymatic activity of human -glucuronidase.
View larger version (13K):
[in this window]
[in a new window]
| Fig 6.
Hydrolysis of the prodrug
N-[4-doxorubicin-N-carbonyl (-oxymethyl) phenyl] O--glucuronyl
carbamate (100 µmol/L, closed symbols) to the cytotoxic drug
doxorubicin (open symbols) by human -glucuronidase ( and  , 1 µg/mL) or scFv-CD20--glucuronidase ( and  , 1 µg/mL) as
determined by reversed-phase HPLC and fluorescence detection.
|
|
Daudi lymphoma cells were used to determine the specific activation of
the prodrug N-[4-doxorubicin-N-carbonyl (-oxymethyl) phenyl]
O--glucuronyl carbamate by scFv-CD20--glucuronidase fusion
protein. In the presence of an excess of -glucuronidase, the prodrug
was activated to doxorubicin. Similarly, preincubation of Daudi cells
with the fusion protein increased the antiproliferative effects of the
prodrug as a result from activation (Fig
7). Specificity was evident, because cells preincubated with an excess
of BCA-B20 blocking antibody and fusion protein showed no increase in
growth inhibition when compared with incubation with the prodrug alone.
View larger version (27K):
[in this window]
[in a new window]
| Fig 7.
Antiproliferative effects of doxorubicin, prodrug
N-[4-doxorubicin-N-carbonyl(-oxymethyl) phenyl] O--glucuronyl
carbamate (DOX-GA3), and prodrug combined with
scFv-CD20--glucuronidase. Cells were incubated with fusion protein,
blocking antibody, and fusion protein, or PBS. Cells were then seeded
in 96-wells plates and exposed to drug or prodrug for 24 hours. After
72 hours, cell growth was measured with a protein dye, Sulforhodamine
B.
|
|
| |
DISCUSSION |
We have constructed an expression plasmid for the production of a
single-chain antibody-enzyme fusion protein composed of the anti-CD20
antibody 1H4 and the human lysosomal enzyme -glucuronidase. The
scFv-CD20--glucuronidase fusion protein was expressed in eukaryotic
cells and was shown to exist in a tetrameric form. The fusion protein
bound to CD20-expressing Daudi lymphoma cells; the antigen specificity
was confirmed by competition experiments. The enzymatic activation of
the prodrug N-[4-daunorubicin-N-carbonyl (-oxymethyl) phenyl]
O--glucuronyl carbamate by the fusion protein was at the same rate
as that for -glucuronidase. The fusion protein, when specifically
bound to Daudi lymphoma cells, completely activated the nontoxic
prodrug and growth inhibition was similar to that obtained with
doxorubicin.
Several chemically prepared -glucuronidase immunoconjugates have
been described for activation of anticancer prodrugs. We have used both
Escherichia coli (E coli)-derived -glucuronidase and human
-glucuronidase conjugated to MoAb 323/A3 for the activation of
anthracycline prodrugs such as epirubicin-glucuronide and
daunorubicin-glucuronide.11,12,14 Roffler et
al23 have used E coli -glucuronidase for the
activation of an aniline mustard prodrug. Antibody-enzyme conjugates
prepared with chemical cross-linkers have the disadvantage that the
conjugates differ in the amount and position of the cross-links
resulting in inconsistent fractions of enzyme and antibody activity.
Recombinant DNA techniques provide the means of directly producing a
fusion protein with defined characteristics. Furthermore, when scFv
fragments are used, the antibody size is reduced from 150 kD to
approximately 25 kD. The smaller size of a fusion protein prepared with
scFv fragments instead of IgG will result in better tumor penetration properties.24 In addition, scFv are expected to be less
immunogenic than whole IgG antibodies.25,26
The yield of enzymatically active fusion protein was low: 10 ng/mL in
COS-7 transfectoma supernatants. This was approximately 10-fold lower
than the expression level of -glucuronidase in the same vector.
Southern blot analysis of transcripts indicated that RNA levels were
reduced in cells transfected with the fusion protein when compared with
those of the enzyme (data not shown). We could increase the expression
level 10-fold in 293/EBNA cells, which were transfected with the pCEP4
vector. This vector is EBV-based and is maintained and replicated
extrachromosomally in primate and canine cells.
Several antibody-enzyme fusion proteins have been described. Goshorn et
al27 and Rodrigues et al28 have developed
Fv--lactamase fusions. These fusion proteins, prepared with a
bacterial enzyme, showed selective activation in vitro of cephalosporin
prodrugs of a nitrogen mustard and doxorubicin, respectively. Bosslet
et al29,30 have developed an antibody-human
-glucuronidase fusion protein. This fusion protein was tested in
mice bearing human tumor xenografts and found to be rapidly cleared
from the blood resulting in tumor:blood ratios of >100:1 at 7 days
after injection. The combination of this fusion protein with a
doxorubicin prodrug showed superior growth inhibition when compared
with doxorubicin alone. The fusion protein of Bosslet et
al29 differs from our scFv-CD20--glucuronidase fusion
protein in that the enzyme was fused to a humanized VH containing an
IgG3 hinge region, which was joined to the VL of the antibody by
disulfide bond formation. The antibody moiety was a F(ab)2
fragment and not a scFv. The apparent native Mw of this fusion protein
was 250 kD, which is conflicting with the observation that
-glucuronidase needs a tetrameric configuration with an apparent Mw
of 400 kD to be enzymatically active.13 Apparently,
processing of the c-terminal end of -glucuronidase in the baby
hamster kidney cells used by Bosslet et al differs from that of other
cells, which leads to dimeric enzyme molecules.31
The observed Mw of 400 kD of the scFv-CD20--glucuronidase fusion
protein is similar to the size of the chemically linked conjugate with
Mw 400 kD.20 Unfortunately, the large size of the tetrameric protein will impede tumor penetration. We have constructed a similar fusion protein between human -galactosidase, which is a monomeric lysosomal enzyme, and scFv-CD20. The
scFv-CD20--galactosidase fusion protein had an apparent Mw of 100 kD, both on SDS-PAGE, as well as by gel filtration (data not shown) and
should have improved in vivo tumor penetration properties.
Of importance, the design of the expression cassette used for
scFv-CD20--glucuronidase enables the rapid exchange of both the
scFv and the enzyme. Thus, fusion proteins may be constructed that
target different tumor types and use prodrugs activated by other
enzymes.
| |
FOOTNOTES |
Submitted October 30, 1997;
accepted January 27, 1998.
Address reprint requests to Hidde J. Haisma, PhD,
Department of Medical Oncology, Academic Hospital Vrije Universiteit,
PO Box 7057, 1007 MB Amsterdam, The Netherlands; e-mail:
hj.haisma.oncol{at}med.vu.nl.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.
| |
ACKNOWLEDGMENT |
We gratefully acknowledge the gift of the cDNA encoding human
-glucuronidase and the rabbit antiserum against human
-glucuronidase from Prof. W. Sly.
| |
REFERENCES |
1.
Armitage JO:
Treatment of non-Hodgkin's lymphoma.
N Engl J Med
328:1023,
1993[Free Full Text]
2.
Philip T,
Guglielmi C,
Hagenbeek A,
Somers R,
Vanderlelie H,
Bron D,
Sonneveld P,
Gisselbrecht C,
Cahn JY,
Harousseau JL,
Coiffier B,
Biron P,
Mandelli F,
Chauvin F:
Autologous bone marrow transplantation as compared with salvage chemotherapy in relapses of chemotherapy-sensitive non-Hodgkin's lymphoma.
N Engl J Med
333:1540,
1995[Abstract/Free Full Text]
3.
Kaminski MS,
Zasadny KR,
Francis IR,
Milik AW,
Ross CW,
Milik AW,
Estes J,
Tuck M,
Regan D,
Fisher S,
Glenn SD,
Wahl RL:
I-131-anti-B1 radioimmunotherapy for B-cell lymphoma.
J Clin Oncol
14:1974,
1996[Abstract/Free Full Text]
4.
Press OW,
Eary JF,
Appelbaum FR,
Martin PJ,
Nelp WB,
Glenn S,
Fisher DR,
Porter B,
Matthews DC,
Gooley T,
Bernstein ID:
Phase II trial of 131-I-B1 (anti-CD20) antibody therapy with autologous stem cell transplantation for relapsed B cell lymphomas.
Lancet
346:336,
1995[Medline]
[Order article via Infotrieve]
5.
Maloney DG,
Liles TM,
Czerwinski DK,
Waldichuk C,
Rosenberg J,
Grillolopez A,
Levy R:
Phase I clinical trial using escalating single-dose infusion of chimeric anti-CD20 monoclonal antibody (IDEC-C2B8) in patients with recurrent B-cell lymphoma.
Blood
84:2457,
1994[Abstract/Free Full Text]
6.
Bagshawe KD:
Antibody-directed enzyme prodrug therapy.
Drug Dev Res
34:220,
1995
7.
Knox RJ,
Connors TA:
Antibody-directed enzyme prodrug therapy.
Clin Immunother
3:136,
1995
8.
Senter PD,
Wallace PM,
Svensson HP,
Vrudhula VM,
Kerr DE,
Helstrom I,
Helstrom KE:
Generation of cytotoxic agents by targeted enzymes.
Bioconjug Chem
4:3,
1993[Medline]
[Order article via Infotrieve]
9.
Haisma HJ,
Boven E,
Van Muijen M,
De Jong J,
Van der Vijgh WJF,
Pinedo HM:
A monoclonal antibody-beta-glucuronidase conjugate as activator of the prodrug epirubicin-glucuronide for specific treatment of cancer.
Br J Cancer
66:474,
1992[Medline]
[Order article via Infotrieve]
10. Haisma HJ, Van Muijen M, Pinedo HM, Boven E: Comparison of two
anthracycline-based prodrugs for activation by a monoclonal antibody--glucuronidase conjugate in the specific treatment of cancer. Cell Biophys 24/25:185, 1994
11.
Hooijberg E,
Sein JJ,
Van den Berk PCM,
Hekman A:
Characterization of a series of isotype switch variants of a new CD20 monoclonal antibody.
Hybridoma
15:23,
1995
12.
Hooijberg E,
Sein JJ,
Van den Berk PCM,
Hart AAM,
Van der Valk MA,
Kast WM,
Melief CJM,
Hekman A:
Eradication of large human B cell tumors in nude mice with unconjugated CD20 monoclonal antibodies and interleukin 2.
Cancer Res
55:2627,
1995[Abstract/Free Full Text]
13.
Shipley JM,
Grubb JH,
Sly WS:
The role of glycosylation and phosphorylation in the expression of active human beta-glucuronidase.
J Biol Chem
268:12193,
1993[Abstract/Free Full Text]
14.
Houba PHJ,
Leenders RGG,
Boven E,
Scheeren JW,
Pinedo HM,
Haisma HJ:
Characterization of novel anthracycline prodrugs activated by human -glucuronidase.
Biochem Pharmacol
52:455,
1996[Medline]
[Order article via Infotrieve]
15.
Frohman MA,
Dush MK,
Martin GR:
Rapid production of full-length cDNAs from rare transcripts: Amplification using a single gene-specific oligonucleotide primer.
Proc Natl Acad Sci USA
85:8998,
1988[Abstract/Free Full Text]
16.
Caton AJ,
Brownlee GG,
Staudt LM,
Gerhard W:
Structural and functional implications of a restricted antibody response to a defined antigenic region on the influenza virus hemaglutinin.
EMBO J
5:1577,
1986[Medline]
[Order article via Infotrieve]
17.
Huston JS,
Levinson D,
Mudgett-Hunter M,
Tai MS,
Novotny J,
Margolies MN,
Ridge RJ,
Bruccoleri RE,
Haber E,
Crea R:
Protein engineering of antibody binding sites, recovery of specific activity in an anti-digoxin single-chain Fv analogue produced in Escherichia coli.
Proc Natl Acad Sci USA
85:5879,
1988[Abstract/Free Full Text]
18.
Oshima A,
Kyle JW,
Miller RD,
Hoffman JW,
Powell PP,
Grubb JH,
Sly WS,
Tropak M,
Guise KS,
Gravel RA:
Cloning, sequencing and expression of cDNA for human beta-glucuronidase.
Proc Natl Acad Sci USA
84:685,
1987[Abstract/Free Full Text]
19.
Brakenhoff RH,
Knippels EM,
van Dongen GAMS:
Optimization and simplification of expression cloning in eukaryotic vector/host systems.
Anal Biochem
218:460,
1994[Medline]
[Order article via Infotrieve]
20.
Houba PHJ,
Boven E,
Haisma HJ:
Improved characteristics of a human -glucuronidase antibody conjugate after deglycosylation for use in antibody-directed enzyme prodrug therapy.
Bioconjug Chem
7:606,
1996[Medline]
[Order article via Infotrieve]
21.
Laemmli UK:
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature
227:680,
1970[Medline]
[Order article via Infotrieve]
22.
Klein E,
Klein G,
Nadkami JS,
Nadkami JJ,
Wigzell H,
Clifford P:
Surface IgM-kappa specificity on a Burkitt lymphoma cell in vivo and in derived culture lines.
Cancer Res
28:1300,
1968[Abstract/Free Full Text]
23.
Roffler SR,
Wang SM,
Chern JW,
Yeh MY,
Tung E:
Anti-neoplasticglucuronide prodrug treatment of human tumor cells targeted with a monoclonal antibody-enzyme conjugate.
Biochem Pharmacol
42:2062,
1991[Medline]
[Order article via Infotrieve]
24.
Jain RK:
Haemodynamic and transport barriers to the treatment of solid tumours.
Int J Radiat Biol
60:85,
1991[Medline]
[Order article via Infotrieve]
25.
LoBuglio AF,
Wheeler RH,
Trang J,
Haynes A,
Rogers K,
Harvey EB,
Sun L,
Ghrayeb J,
Khazaeli MB:
Mouse/human chimeric monoclonal antibody in man, kinetics and immune response.
Proc Natl Acad Sci USA
86:4220,
1989[Abstract/Free Full Text]
26.
Meredith RF,
LoBuglio AF,
Plott WE,
Orr RA,
Brezovich IA,
Russell CD,
Harvey EB,
Yester MV,
Wagner AJ,
Spencer SA:
Pharmacokinetics, immune response, and biodistribution of iodine-131-labeled chimeric mouse/human IgG1,k 17-1A monoclonal antibody.
J Nucl Med
32:1162,
1991[Abstract/Free Full Text]
27.
Goshorn SC,
Svensson HP,
Kerr DE,
Somerville JE,
Senter PD,
Fell HP:
Genetic construction, expression, and characterization of a single chain anti-carcinoma antibody fused to beta-lactamase.
Cancer Res
53:2123,
1993[Abstract/Free Full Text]
28.
Rodrigues ML,
Presta LG,
Kotts CE,
Wirth C,
Mordenti J,
Osaka G,
Wong WL,
Nuijens A,
Blackburn B,
Carter P:
Development of a humanized disulfide-stabilized anti-p185HER2 Fv-beta-lactamase fusion protein for activation of a cephalosporin doxorubicin prodrug.
Cancer Res
55:63,
1995[Abstract/Free Full Text]
29.
Bosslet K,
Czech J,
Lorenz P,
Sedlacek HH,
Schuermann M,
Seeman G:
Molecular and functional characterization of a fusion protein suited for tumour-specific prodrug activation.
Br J Cancer
65:234,
1992[Medline]
[Order article via Infotrieve]
30.
Bosslet K,
Czech J,
Hoffman D:
Tumor-selective prodrug activation by fusion protein-mediated catalysis.
Cancer Res
54:2151,
1994[Abstract/Free Full Text]
31.
Gehrmann MC,
Opper M,
Sedlacek HH,
Bosslet K,
Czech J:
Biochemical properties of recombinant human -glucuronidase synthesized in baby hamster kidney cells.
Biochem J
301:821,
1994
Abstract
Introduction
Abstract