|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 92 No. 1 (July 1), 1998:
pp. 215-222
Production of Interleukin-10 by Granulocyte Colony-Stimulating
Factor-Mobilized Blood Products: A Mechanism for Monocyte-Mediated
Suppression of T-Cell Proliferation
By
Marco Mielcarek,
Lynn Graf,
Gretchen Johnson, and
Beverly Torok-Storb
From the Transplantation Biology Program, Clinical Research Division,
Fred Hutchinson Cancer Research Center, Seattle, WA.
 |
ABSTRACT |
Previous reports showed that granulocyte colony-stimulating factor
(G-CSF)-mobilized peripheral blood mononuclear cells (G-PBMC) are
hyporesponsive to alloantigen compared with control PBMC. In the
current study, neutralizing antibodies to interleukin-10 (IL-10)
increased the proliferative response of G-PBMC to alloantigen by
50.14% (± 12.79%; n = 8), whereas the proliferative response of
control PBMC was not affected. The inhibition of OKT3-stimulated CD4
cell proliferation by G-PBMC-derived CD14+ cells could
also be abrogated by the addition of IL-10 neutralizing antibodies.
Further, IL-10 levels correlated with the number of CD14 cells in these
cultures. Constitutive IL-10 mRNA levels detected by quantitative
reverse transcriptase-polymerase chain reaction (RT-PCR) were 10-fold
higher in G-PBMC compared with control PBMC. This translated into
significantly higher IL-10 levels after 24-hour lipopolysaccharide
(LPS) stimulation of G-PBMC compared with control PBMC (P = .036). IL-10 mRNA levels were also fivefold higher in isolated
G-PBMC-derived CD14 cells compared with control CD14 cells. This
corresponded to increased constitutive production of IL-10 by isolated
G-PBMC-derived CD14 cells compared with control CD14 cells (357.2 ± 104.5 v 51.7 ± 30.5, P = .051). In conclusion, these data suggest that monocytes contained within G-PBMC, which, in
comparison to marrow, are increased in absolute number and relative
proportion to T cells, may suppress T-cell responsiveness by secretion
of IL-10.
| |
INTRODUCTION |
GRANULOCYTE COLONY-stimulating factor
(G-CSF)-mobilized peripheral blood mononuclear cells (G-PBMC) used for
hematopoietic reconstitution after myeloablative therapy contain a
large number of CD14+ monocytes. This is a direct result of
G-CSF treatment of the donor, which increases peripheral monocyte
counts, with additional enrichment for monocytes through the
leukapheresis procedure. Overall, G-PBMC contain approximately 50 times
more monocytes and 10 times more T cells than typical marrow grafts,
which translates into monocyte-T-cell ratios five times greater in
G-PBMC as compared with marrow or normal PBMC.1
We have reported previously that the large number of CD14+
monocytes in G-PBMC can suppress alloantigen-induced T-cell
proliferation in a dose-dependent and largely contact-independent
fashion.1 In addition, CD4 T cells in G-PBMC compared with
CD4 cells from normal PBMC controls show impaired induction of the CD28
responsive complex (CD28RC), a pivotal interleukin-2 (IL-2)
transcription factor. The suppressed induction of CD28RC in G-PBMC was
reversible after depleting monocytes.2 Other investigators
using murine allogeneic transplantation models, showed that G-CSF
treatment may also have direct effects on donor T-cell function by
inducing a polarization toward a Th2-cytokine
phenotype.3,4
The hyporesponsiveness of G-PBMC to alloantigen in vitro corresponds in
theory to clinical observations in the allogeneic HLA-identical
transplantation setting, where the G-PBMC products, which contain at
least 10 times more T cells than marrow, have not translated into a
higher incidence or severity of acute graft-versus-host disease
(aGVHD).5-8 Whether these two observations are
mechanistically related remains speculative. However, a better
understanding of the mechanisms responsible for the hyporesponsiveness
of G-PBMC to alloantigen could lead to strategies for optimizing the
cellular composition of transplantation products. For this purpose, we extended our previous study and analyzed potential mechanisms of
monocyte-mediated suppression. Data presented in this report suggest
that IL-10, a potent antiinflammatory cytokine preferentially produced
by activated monocytes/macrophages and T cells, is a factor by which
monocytes suppress T-cell responsiveness in G-PBMC products.
| |
MATERIALS AND METHODS |
Donors, G-CSF-mobilization, and PBMC processing.
Samples were collected after written informed consent using forms
approved by the Institutional Review Board of the Fred Hutchinson Cancer Research Center (FHCRC). Donors were treated by subcutaneous injection with recombinant human (rh)G-CSF (Amgen, Inc, Thousand Oaks,
CA) at a dose of 16 µg/kg/d for 4 to 7 days. Leukapheresis was
performed using a continuous flow blood cell separator (Cobe Laboratories, Lakewood, CO) on 2 consecutive days beginning on day 4 of
rhG-CSF administration. Heparinized peripheral blood samples obtained
from the same donor before the first administration of G-CSF (control
PBMC) and samples from the first leukapheresis (G-PBMC) were used for
comparative experiments. Control PBMC were isolated over Ficoll
(Accu-Prep, Accurate Chemicals, Westbury, NY; 1.077 g/mL) step
gradients, hemolysed (ammonium chloride 150 mmol/L; sodium bicarbonate
12 mmol/L) and washed three times in Hank's Balanced Salt Solution
(HBSS)/1% bovine serum albumin (BSA). G-PBMC were suspended in
HBSS/1% BSA and centrifuged at 200g for 10 minutes to remove
platelets. All cells were cryopreserved to allow simultaneous testing.
Isolation of CD4 T cells and monocytes.
For fluorescence-activated cell sorting (FACS), cells were stained with
LeuM3 (anti-CD14-phycoerythrin [PE]; Becton Dickinson, San Jose, CA)
and Leu-3a (anti-CD4-fluorescein isothiocyanate [FITC]; Becton
Dickinson). Staining for both CD14 and CD4 allowed clear separation of
populations and minimized cross-contamination, as some CD14 cells
coexpress CD4. After incubation with antibody conjugates for 20 minutes
on ice, cells were washed twice in HBSS/1% BSA and sorted as described
previously.9 Purity of CD4 and CD14 cells was always
greater than 96% after sorting. Cells were counted, resuspended in
RPMI 1640 medium supplemented with 10% fetal calf serum (FCS),
penicillin (100 U/mL), and streptomycin sulfate (100 g/mL). Viability
always exceeded 95% as determined by trypan blue exclusion.
In some experiments monocytes were obtained after sheep
erythrocyte-rosetting to deplete for T cells,10 followed by
cell sorting based on light scattering characteristics or followed by
counterflow centrifugal elutriation.11 This approach
avoided staining with anti-CD14 antibodies and minimized the
possibility of nonspecific activation. The purity of CD14+
cells obtained using this technique was typically greater than 85%.
Mixed leukocyte cultures (MLC).
Cultures were established in round-bottom 96-well plates (Costar,
Cambridge, MA). Responder PBMC or sorted CD4 cells in indicated numbers
were cultured with 1.0 × 105 irradiated (30 Gy), allogeneic, DR-mismatched PBMC stimulators in 200 µL RPMI 1640 medium supplemented with 10% FCS, L-glutamine (0.4 mg/mL), penicillin
(100 U/mL), and streptomycin (100 g/mL). At 120 hours, cultures were
pulsed with 3H-thymidine (1.0 µCi/well) for the final 18 hours. Cells were harvested and 3H-thymidine incorporation
was measured by liquid scintillation counting. In some experiments
neutralizing monoclonal antibody to hIL-10 (mouse IgG2b, clone 217, R&D
Systems, Minneapolis, MN) at 4 µg/mL was added at the initiation of
cultures.
Polyclonal stimulation assay using immobilized anti-CD3.
Flat-bottom 96-well plates (Costar) were coated overnight at 4°C
with monoclonal antibody OKT3 (Ortho, Raritan, NJ) at 50 ng/mL in
Tris-HCl buffer (pH 9.6). Plates were washed twice with phosphate-buffered saline (PBS)/1% BSA before adding cells. PBMC or
sorted CD4 cells were suspended in RPMI/10% FCS and seeded at
indicated concentrations. At 96 hours, cultures were pulsed with
3H-thymidine for the final 18 hours. For
monocyte-suppression studies, sorted or elutriated CD14 cells were
added to the cultures on day 0. Neutralizing antibodies to IL-10 (NAB
IL-10) were used as described above.
Immunomagnetic cell sorting for CD14 depletion of G-PBMC.
CD14-depleted fractions of G-PBMC containing less than 2% CD14 cells
were obtained by negative selection using LeuM3 anti-CD14-PE, mouse
antihuman-IgG2a (Becton Dickinson) as primary antibody, and rat
antimouse-IgG2a+b conjugated to magnetic microbeads as secondary
antibody according to the manufacturer's instructions (Miltenyi Biotec
GmbH, Bergisch Gladbach, Germany).
IL-10 reverse transcriptase-polymerase chain reaction (RT-PCR).
Cells were pelleted and lysed in Proteinase K/sodium dodecyl sulfate
(SDS) buffer (GIBCO-BRL, Gaithersburg, MD; Boehringer Mannheim,
Indianapolis, IN) as described previously.12 Total RNA was
extracted by phenol-chloroform, precipitated with ethanol, and
resuspended in RNAse-free water.13 Extracted RNA was
treated twice with DNAse (Promega, Madison, WI) to digest genomic DNA followed by phenol-chloroform extraction and ethanol precipitation.
RNA for IL-10 and  2-microglobulin (2m)
analysis was denatured and reverse transcribed by using 0.1 µg/mL
pdT12-18 (Pharmacia, Piscataway, NJ), Moloney murine leukemia virus
(MMLV)-RT (GIBCO-BRL), 0.5 mmol/L of each
dNTP (Pharmacia), 25 mmol/L dithiothreitol (DTT), 0.2 U/mL RNAsin (Promega) and 1x First
Strand Buffer (GIBCO-BRL) in a final volume of 20 µL. For PCR
amplification, first-strand cDNA corresponding to approximately
104 cells was added to PCR mixture (0.5 U Taq-polymerase
[AmpliTaq, Perkin Elmer, Branchburg, NJ], 0.2 mmol/L dNTP, 5 µg/mL
specific primers, RNAse-free water, 50 mmol/L KCl, 10 mmol/L Tris,
0.001% gelatin, and 1.25 mmol/L MgCl2 for IL-10, and 2.5 mmol/L MgCl2 for 2m) in a total volume of 25 µL. The reaction mixtures were amplified in a Perkin Elmer thermal
cycler 9600 for 35 cycles with the following temperature profile: 4 minutes at 94°C, (15 seconds at 94°C, 45 seconds at 56°C,
30 seconds at 72°C) × 35, and 5 minutes at 72°C. PCR with
2m-specific primers was performed on each sample as a
control for efficient cDNA synthesis. Negative controls were included
for every PCR analysis. PCR products were separated in 4% agarose gels
and stained with ethidium bromide. Specific primers were custom
synthesized (FHCRC Shared Resources Facility): 5 IL-10
ACCAAGACCCAGACATCAAG; 3 IL-10 GAGGTACAATAAGGTTTCTCAAG; 5
2m ATGTCTCGCTCCGTGGCCTTAGCT; 3 2m
CCTCCATGATGCTGCTTACATGTC. Amplification products were 350 bp for IL-10
and 380 bp for 2m. The feasibility of this technique for
semiquantitative measurements was confirmed by cDNA-dilution series.
Cytokine analysis.
Culture supernatants were harvested from triplicate cultures at
indicated timepoints and frozen at  20°C until analysis.
Lipopolysaccharide (LPS; from Escherichia coli 026:B6;
Sigma, St Louis, MO) for stimulation was used at a concentration
between 0.01 and 1.0 µg/mL. Cytokine enzyme-linked immunosorbent
assays (ELISAs) were performed by Allen Farrand of the FHCRC
Shared Resources Facility. For IL-1 , tumor necrosis factor-
(TNF-), and interferon- (IFN-), polystyrene 96-well plates
(Costar) were coated overnight (ON) at 4°C with cytokine-specific
capture antibodies in 50 mmol/L Na carbonate, pH 9.5. Capture antibody
concentrations were 2.5 µg/mL for IL-1 (PharMingen, San Diego,
CA), 2 µg/mL for TNF- (Boehringer Mannheim Biochemicals), and 1 µg/mL for IFN- (Endogen, Boston, MA). The next day, plates were
washed and nonspecific binding was blocked by incubation with 1%
BSA/Tris-buffered saline (TBS; Sigma) at room temperature
(RT) for 1 hour. Plates were then washed three times with PBS-T before addition of samples. Diluted
samples, controls, and standards were incubated ON at 4°C. The next
day, plates were washed five times with PBS-T and
detection of captured IL-1 was accomplished by addition of 0.5 µg/mL mouse antihuman IL-1-biotin conjugate (PharMingen);
detection of captured IFN- by addition of a 0.5 µg/mL of mouse
antihuman IFN--biotin conjugate (Endogen). Detection of captured
TNF- was accomplished by addition of a 0.05 U/µL mouse antihuman
TNF--horseradish peroxidase (HRP) conjugate
(Boehringer Mannheim Biochemicals) in 1% BSA/5 mmol/L EDTA/TBS-T at RT
and IL-1 and IFN- antibody-cytokine complex was detected by using
avidin D-HRP (Vector Labs, Burlingame, CA).
For human IL-8 and IL-10, 96-well plates (Costar) were coated ON at RT
with 2 µg/mL of mouse antihuman IL-8 or rat antihuman IL-10 (Endogen)
in PBS. Nonspecific binding was blocked with 1% BSA/TBS at RT for 1 hour and plates were washed three times with PBS-T.
Diluted samples were incubated in 0.1% BSA/TBS-T containing 25 ng/mL
of mouse antihuman IL-8-biotin or 100 ng/mL of rat antihuman IL-10
(Endogen) in 96-well plates (Costar) for 2 hours before addition to the
binding plate. After transfer to binding plates, samples were incubated
another 2 hours at RT. Detection of captured IL-8 or IL-10 was
accomplished by addition of PolyHRP-SA20 conjugate (Research
Diagnostics Inc, Flanders, NJ) at a 1:20,000 dilution of 0.1%
BSA/TBS-T at RT. After 30 minutes incubation, all plates were washed
five times with PBS-T before substrate (TMB, 2-Component, KPL) was added. Reactions were stopped with 1 mol/L
H3PO4. Optical density was determined at 450 to
650 nm using a microplate reader (Vmax; Molecular Devices, Sunnyvale,
CA). Unknown values were calculated from a standard curve using
recombinant human standards (R&D Systems). All samples, standards, and
controls were run in duplicates. Interassay and intraassay coefficients
of variation (CVs) were determined to be less than 10%
with assay sensitivities of <5 pg/mL for IL-1, <1 pg/mL for
IFN-, and TNF-, and <0.5 pg/mL for IL-8 and IL-10.
Statistical analysis.
Proliferation and cytokine data are summarized with means and standard
errors. Statistical comparisons were performed using t-tests.
Where appropriate, paired versions of the t-test were applied.
| |
RESULTS |
Monocytes suppress OKT3-stimulated T-cell proliferation.
We have reported previously that control and G-PBMC-derived CD14 cells
suppress proliferation of autologous PBMC responders or purified CD4
responders in MLC in a dose-dependent fashion when irradiated
allogeneic stimulators were used.1 We have now extended our
previous study using immobilized OKT3 for polyclonal stimulation of
T-cell proliferation. As shown in Fig 1A,
the addition of increasing numbers of control monocytes obtained by
elutriation to a fixed number (100 × 103) of
autologous PBMC responders lead to a dose-dependent suppression of
proliferation. When increasing numbers of unfractionated G-PBMC were
stimulated with immobilized OKT3 (Fig 1B), proliferation decreased
progressively after exceeding a threshold number of approximately 100 × 103 cells/200 µL. This threshold number varied
dependent on the proportion of monocytes present in a sample. In
contrast, CD14-depleted G-PBMC containing less than 2%
CD14+ cells showed increasing proliferation up to cell
concentrations of 300 × 103 cells/200 µL
(Fig 2B). These results suggest that
monocytes also suppress OKT3-stimulated T-cell proliferation in a
dose-dependent manner.
View larger version (13K):
[in this window]
[in a new window]
| Fig 1.
Monocytes suppress OKT3-stimulated T-cell proliferation.
(A) Control PBMC at fixed numbers (100 × 103) plus
varying numbers of autologous control monocytes obtained by counterflow
centrifugal elutriation were cultured in flat-bottom 96-well plates
precoated with OKT3 antibody at a concentration of 50 ng/mL.
Proliferation was measured on day 4 by 3H-thymidine
incorporation. Values represent the mean ± SEM from triplicate
cultures. (B) Unfractionated G-PBMC (solid line) or CD14-depleted
G-PBMC (dashed line) at increasing numbers were cultured in OKT3-coated
96-well plates. Cultures were pulsed and harvested as described above.
Results from one of three experiments are shown.
|
|
View larger version (11K):
[in this window]
[in a new window]
| Fig 2.
Endogenously produced IL-10 suppresses OKT3-stimulated
T-cell proliferation and inflammatory cytokine production in cocultures between G-PBMC-derived CD4 and CD14 cells. CD4 cells at fixed numbers
(50 × 103) plus sorted CD14 cells at varying numbers were
cultured in flat-bottom 96-well plates precoated with OKT3 antibody at
a concentration of 50 ng/mL. (A) Proliferation was measured on day 4 by
3H-thymidine incorporation in cultures with (dashed lines)
or without (solid lines) neutralizing antibodies to IL-10. Values
represent the mean ± SEM from triplicate cultures. (B through E)
Concentrations of cytokines IL-10, IFN-, TNF-, and IL-1 as
indicated were determined at the time of the proliferation assay (day
4) by ELISA in cultures without (solid lines) or with (dashed lines)
neutralizing antibodies to IL-10. Shown is the mean of duplicate ELISA
determinations using pooled supernatants from triplicate cultures.
|
|
Endogenously produced IL-10 suppresses OKT3-stimulated T-cell
proliferation and proinflammatory cytokine production.
Monocytes are a major source of the antiinflammatory cytokine
IL-10.14-18 To test whether IL-10 might be involved in
monocyte-mediated suppression, fixed numbers of sorted G-PBMC-derived
CD4 cells plus varying numbers of G-PBMC-derived CD14 cells were
stimulated with immobilized OKT-3 in the presence or absence of NAB
IL-10. As shown in Fig 2A, 50 × 103 CD4 cells alone
did not proliferate, as accessory cells were not present in this
system. The addition of small numbers of CD14 cells (6.25 to 12.5 × 103 G-PBMC-derived CD14 cells; CD4/CD14 ratio 8:1
to 4:1), however, lead to a steep increase in proliferation. After
exceeding a threshold number of 25 × 103 CD14 cells
(CD4/CD14 ratio 2:1), proliferation decreased. The CD4/CD14 ratio was
4.3 in control PBMC, 0.9 in G-PBMC, and 2.4 in aspirated
marrow.1 In the presence of NAB IL-10, G-PBMC-derived CD14
cells even at higher numbers (100 × 103 CD14 cells;
CD4/CD14 ratio 1:2) were not suppressive. Corresponding IL-10 levels in
culture supernatants at the time when the cultures were pulsed (day 4)
are shown in Fig 2B. IL-10 levels increased with increasing numbers of
monocytes added to the cultures. These data indicate that endogenously
produced IL-10 is a mediator of monocyte-suppression of T-cell
proliferation. Figures 1C to E summarize levels for IFN-, TNF-,
and IL-1 in the same cultures generated in the presence or absence
of NAB IL-10. They show that IL-10 is a potent suppressor of
inflammatory cytokine production in these cultures with the strongest
inhibitory effect on IFN-.
Neutralization of endogenous IL-10 can partially overcome
proliferative hyporesponsiveness in G-PBMC.
As reported previously, unfractionated G-PBMC contained a
several-fold greater proportion of monocytes and showed substantially lower proliferative responses in MLC as compared with equivalent numbers of unfractionated control PBMC.1 To determine the
role of endogenously produced IL-10 in causing proliferative
hyporesponsiveness of G-PBMC, allogeneic MLC in the presence and
absence of NAB IL-10 were initiated using paired samples of
unfractionated control and G-PBMC responders. As shown in
Fig 3B, proliferative hyporesponsiveness of
G-PBMC could be partially overcome when NAB IL-10 were added at
initiation of culture, in particular at high responder cell concentrations (100 and 200 × 103 cells/200 µL).
Neutralization of IL-10 did not significantly increase proliferative
responsiveness when control PBMC responders were used (Fig 3A).
Furthermore, neutralization of endogenous IL-10 did not increase
proliferation when sorted G-PBMC-derived CD4 responders were used
instead of unfractionated G-PBMC (Fig 3C and D).
Figure 4 summarizes changes in
proliferative responses with NAB IL-10 in allogeneic MLC in a larger
series of experiments comparing control PBMC (n = 6) with G-PBMC (n = 8) responders. The mean (± standard error of mean [SEM]) increase
in proliferation with IL-10 neutralization was 1.71% (± 5.90%)
for control PBMC responders and 50.14% (± 12.79%) for G-PBMC
responders, respectively (P = .044, paired t-test).
Therefore, endogenously produced IL-10 is partially responsible for
proliferative hyporesponsiveness seen with alloantigen-stimulated
G-PBMC.
View larger version (16K):
[in this window]
[in a new window]
| Fig 3.
Neutralization of endogenous IL-10 can partially overcome
proliferative hyporesponsiveness of G-PBMC in MLC. Unfractionated control PBMC (A) and G-PBMC (B), or purified control CD4 cells (C) and
G-PBMC-derived CD4 cells (D) from one donor were used at indicated
numbers as responders with 100 × 103 irradiated (30 Gy)
allogeneic PBMC stimulators in MLC. Proliferation was measured on day 5 by 3H-thymidine incorporation in cultures without (solid
lines) or with (dashed lines) neutralizing antibodies to IL-10. Values
represent the mean ± SEM from triplicate cultures. Shown is one of
three experiments with side-by-side comparison of unfractionated and purified CD4 cell responders.
|
|
View larger version (17K):
[in this window]
[in a new window]
| Fig 4.
Change of proliferative responsiveness of control and
G-PBMC with neutralization of endogenous IL-10 in MLC. In the
experiment, 105 ( ) or 2 × 105 ( )
unfractionated control (n = 6) or G-PBMC (n = 8) responders plus
100 × 103 irradiated (30 Gy) allogeneic PBMC stimulators
were cultured in round-bottom 96-well plates. Proliferation was
measured on day 5 by 3H-thymidine incorporation as
described in Materials and Methods. Values represent the mean change of
proliferation in triplicate cultures containing neutralizing antibodies
to IL-10 compared with controls. *Only data points derived from paired
G-PBMC and control PBMC samples contributed to the P value (n
= 6).
|
|
IL-10 mRNA expression in control and G-PBMC.
Constitutive expression levels of IL-10 mRNA in unfractionated control
and G-PBMC and sorted populations of control and G-PBMC-derived CD4
and CD14 cells were compared by RT-PCR (Fig
5). Mean quantitation values for duplicate amplification products (Fig
5A) were normalized against 2m as a control for
sufficient cDNA synthesis (Fig 5B). Two experiments with paired samples
from different normal donors showed that relative expression of IL-10
mRNA was about 10-fold greater in unfractionated G-PBMC compared with
unfractionated control PBMC (10.2 v 1.0 relative units).
Baseline IL-10 mRNA expression in purified CD4 cells was almost
undetectable. Sorted CD14 cells had a strong signal and expression in
G-PBMC-derived CD14 cells was approximately five times greater than in
control CD14 cells (20.63 v 4.30 relative units). Hence, the
strong constitutive mRNA signal for IL-10 in unfractionated G-PBMC was
due to the large number of CD14 cells, which also expressed
qualitatively more IL-10 mRNA than control CD14 cells.
View larger version (36K):
[in this window]
[in a new window]
| Fig 5.
Constitutive IL-10 mRNA and
2-microglobulin expression in control and G-PBMC. (A)
RT-PCR for IL-10 and 2-microglobulin was performed from
mRNA extracts of unfractionated PBMC or sorted CD4 and CD14 cells as
described in Materials and Methods. The purity of sorted populations
exceeded 96%. (B) Mean quantitations (ImageQuant software) of
duplicate amplification products were normalized against signals
obtained for 2-microglobulin. Shown is one of two
experiments using paired control and G-PBMC samples from each of two
donors.
|
|
Cytokine production by unfractionated control and G-PBMC and purified
monocytes.
IL-10 levels were determined in 24-hour conditioned medium from
unstimulated and LPS-stimulated cultures (1.5 × 106
cells/mL) (Fig 6). Baseline production by
unfractionated control PBMC (n = 9) and G-PBMC (n = 9) was 72.9 ± 35.6 pg/mL and 7.9 ± 5.2 pg/mL, respectively. LPS stimulation (1 µg/mL) increased IL-10 production in control PBMC to 488.8 (± 159.9) pg/mL, which was 6.7-fold above baseline and to 1428.4 (± 378.0) pg/mL in G-PBMC, which was 180.8-fold above baseline. The
difference in IL-10 production between stimulated products was
statistically significant (P = .036).
View larger version (18K):
[in this window]
[in a new window]
| Fig 6.
IL-10 production by unfractionated control and G-PBMC and
purified control and G-PBMC monocytes. (A) Unfractionated mononuclear cells (1.5 × 106/mL), or (B) purified monocytes (0.5 × 106/mL) were isolated as described in Materials and Methods
and cultured in flat-bottom 96-well plates in the presence or absence
of LPS at indicated concentrations. Supernatants from triplicate
cultures were harvested after 24 hours, pooled, and IL-10 levels were
determined by ELISA. (*) Indicates a P value < .05 compared
with control.
|
|
We then determined whether there were qualitative differences in
production of cytokines IL-10, IL-1, IL-8, and TNF- between control and G-PBMC-derived CD14 cells. To minimize the possibility of
nonspecific activation through anti-CD14 staining, monocyte-enriched fractions were prepared without antibody labeling by cell sorting based
on light scattering characteristics. The purity of CD14+
cells obtained was greater than 85%. As shown in Figs 6B and 7, there was a trend for greater
constitutive production of IL-10, IL-1, IL-8, and TNF- by CD14
cells isolated from G-PBMC (n = 6) compared with those isolated from
control PBMC (n = 4). This difference was statistically significant for
constitutive secretion of IL-8 (P = .007). However, LPS-induced
secretion of these cytokines was not significantly different between
these two groups. Thus, the approximately threefold higher LPS-induced
IL-10 levels in unfractionated G-PBMC compared with unfractionated
control PBMC were due to differences in monocyte quantity rather than
quality.
View larger version (19K):
[in this window]
[in a new window]
| Fig 7.
Production of IL-1, IL-8, and TNF- by purified
control and G-PBMC monocytes. Purified monocytes were isolated as
described in Materials and Methods and cultured at 0.5 × 106/mL in flat-bottom 96-well plates in the presence or
absence of LPS (1 µg/mL). Supernatants from triplicate cultures were
harvested after 24 hours, pooled, and cytokine levels were determined
by ELISA. (*) Indicates a P value < .05 compared
with control.
|
|
| |
DISCUSSION |
The present study identifies IL-10 as a monocyte-derived factor
responsible for the suppression of T-cell proliferation and inflammatory cytokine production in G-PBMC. This finding extends our
previous study that showed CD14+ monocytes in G-PBMC were
able to suppress T-cell proliferation in a dose-dependent and largely
contact-independent fashion.1 Sufficiently large numbers of
monocytes from unmobilized blood were also suppressive indicating that
monocyte-mediated suppression was mainly due to quantitative rather
than qualitative differences. Therefore, the 50-fold increase in
monocyte number, and increased ratio of monocytes to T cells in G-PBMC
may explain the hyporesponsiveness of G-PBMC when tested in vitro.
Our interest in IL-10 as a potential factor causing proliferative
hyporesponsiveness in G-PBMC was prompted by its known
immunosuppressive effects and the fact that monocytes are a major
source of this cytokine.14-18 IL-10 is also produced by
activated T cells, B lymphocytes, and keratinocytes.18-20
It has been shown to be suppressive for T-cell activation and
proliferation by downregulating pivotal monocyte accessory functions
such as costimulatory molecules B7-1 and B7-2, and HLA class II
molecules.21-25 Furthermore, IL-10 is a potent inhibitor of
Th1-cytokine production by T cells,19 but it
also inhibits proinflammatory cytokine production by monocytes, potentially through autocrine mechanisms.15,16 Finally,
IL-10 has been shown to have direct, accessory cell-independent,
inhibitory effects on T-cell proliferation by interfering with IL-2
production,26,27 and it may induce long-lasting
antigen-specific anergy in T cells.28 Taken together, IL-10
is a potent negative regulator of the immune response, including
reactions to alloantigen.
In this report, we show that monocyte-suppression of OKT3-stimulated
CD4 cell proliferation could be largely overcome by neutralizing the
endogenously produced IL-10 (Fig 2). Further, neutralization of
endogenous IL-10 in allogeneic MLC increased proliferative responsiveness of G-PBMC by approximately 50% without causing significant changes in proliferation when control PBMC were used (Figs
3 and 4). This finding corresponded to approximately threefold higher
IL-10 levels in LPS-stimulated supernatants from G-PBMC compared with
control PBMC (Fig 6). However, proliferative hyporesponsiveness of
G-PBMC was not completely reversible with IL-10 neutralization, suggesting that IL-10 was not exclusively responsible for suppression in MLC (Fig 3).
We also addressed the question as to whether G-CSF treatment might
alter cytokine production by monocytes. Our data show that equal
numbers of control and G-PBMC-derived monocytes produced comparable
amounts of monokines IL-10, IL-1, TNF-, and IL-8 with LPS
stimulation (Fig 6B and 7). Hence, the most plausible explanation for
higher IL-10 levels in LPS-stimulated G-PBMC appears to be the large
number of monocytes rather than differences in cytokine production on a
cell-per-cell basis. However, baseline IL-10 mRNA levels by RT-PCR were
fivefold higher (Fig 5) and there was also a trend for higher
constitutive levels of IL-10, IL-1, IL-8, and TNF- in
supernatants from isolated G-PBMC-derived CD14 cells compared with
control CD14 cells. Therefore, CD14 cells in G-PBMC may have a lower
stimulatory threshold for production and secretion of certain cytokines
including IL-10.
Bacchetta et al29 reported high levels of
IL-10 transcripts in non-T-cell subsets of PBMC from transplanted
severe combined immunodeficiency (SCID) patients who had developed
mixed chimerism compared with PBMC of normal controls. Another report
described decreased PBMC IL-10 production in vitro by cells from
patients who developed chronic GVHD after allogeneic marrow
transplantation compared with cells from patients without this
complication.30 Even though the overall clinical experience
with IL-10 in the transplantation setting is very limited, these in
vitro data suggest a possible role of IL-10 in dampening GVH reactions
and maintaining in vivo tolerance.
When recipients of G-PBMC were compared with recipients of marrow,
increased numbers of monocytes and monocyte progenitors transferred
with G-PBMC products translated into increased monocyte counts during
at least the first 2 months posttransplantation.31 A direct
comparison of posttransplantation IL-10 serum levels between recipients
of G-PBMC and marrow would be interesting but, to our knowledge, has
not yet been performed.
Therapeutic strategies currently used to successfully prevent aGVHD
show that immunosuppression needs to be present during the early phase
of donor T-cell encounter with host-antigen. Therefore, it seems
reasonable to speculate that large numbers of IL-10-producing monocytes
transferred with a graft may lead to transient or even long-lasting
dampening of alloreactivity. However, the outcome of patients receiving
G-PBMC products regarding the development of chronic GVHD remains to be
seen.
Taken together, our data suggest that monocytes in G-CSF-mobilized
blood products can suppress T-cell responsiveness through production of
IL-10. These findings might help to explain why the infusion of 10 times more T cells in G-PBMC compared with marrow does not increase the
incidence or severity of aGVHD. They may also raise the question as to
whether all CD34-enrichment strategies for T-cell depletion are a
reasonable clinical approach, as they can be accompanied by a loss of
monocytes.
| |
FOOTNOTES |
Submitted November 24, 1997;
accepted March 4, 1998.
Supported in part by Grants No. DK51417 and CA18221 from the National
Institutes of Health, Department of Health and Human Services, Bethesda, MD.
Address reprint requests to Marco Mielcarek, MD, Fred Hutchinson Cancer
Research Center, 1124 Columbia St, M-318, Seattle, WA 98104.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.
| |
ACKNOWLEDGMENT |
We thank Dr Peter Kiener, Bristol-Myers Squibb, for technical support
regarding counterflow centrifugal elutriation of monocytes and Dr
William Bensinger, FHCRC, for providing the leukapheresis samples for
the study.
| |
REFERENCES |
1.
Mielcarek M,
Martin P,
Torok-Storb B:
Suppression of alloantigen-induced T-cell proliferation by CD14+ cells derived from granulocyte colony-stimulating factor (G-CSF)-mobilized peripheral blood mononuclear cells.
Blood
89:1629,
1997[Abstract/Free Full Text]
2.
Tanaka J,
Mielcarek M,
Torok-Storb B:
Impaired induction of the CD28-responsive complex (CD28RC) in G-CSF mobilized CD4 T cells.
Blood
91:347,
1998[Abstract/Free Full Text]
3.
Pan L,
Delmonte J Jr,
Jalonen CK,
Ferrara JLM:
Pretreatment of donor mice with granulocyte colony-stimulating factor polarizes donor T lymphocytes toward type-2 cytokine production and reduces severity of experimental graft versus host disease.
Blood
86:4422,
1995[Abstract/Free Full Text]
4.
Zeng D,
Dejbakhsh-Jones S,
Strober S:
Granulocyte colony-stimulating factor reduces the capacity of blood mononuclear cells to induce graft-versus-host disease: Impact on blood progenitor cell transplantation.
Blood
90:453,
1997[Abstract/Free Full Text]
5.
Korbling M,
Przepiorka D,
Huh YO,
Engel H,
van Besien K,
Giralt S,
Andersson B,
Kleine HD,
Seong D,
Deisseroth AB,
Andreeff M,
Champlin R:
Allogeneic blood stem cell transplantation for refractory leukemia and lymphoma: Potential advantage of blood over marrow allografts.
Blood
85:1659,
1995[Abstract/Free Full Text]
6.
Bensinger WI,
Weaver CH,
Appelbaum FR,
Rowley S,
Demirer T,
Sanders J,
Storb R,
Buckner CD:
Transplantation of allogeneic peripheral blood stem cells mobilized by recombinant human granulocyte colony-stimulating factor.
Blood
85:1655,
1995[Abstract/Free Full Text]
7.
Schmitz N,
Dreger P,
Suttorp M,
Rohwedder EB,
Haferlach T,
Löffler H,
Hunter A,
Russell NH:
Primary transplantation of allogeneic peripheral blood progenitor cells mobilized by filgrastim (G-CSF).
Blood
85:1666,
1995[Abstract/Free Full Text]
8.
Pavletic ZS,
Bishop MR,
Tarantolo SR,
Martin-Algarra S,
Bierman PJ,
Vose JM,
Reed EC,
Gross TG,
Kollath J,
Nasrati K,
Jackson JD,
Armitage JO,
Kessinger A:
Hematopoietic recovery after allogeneic blood stem-cell transplantation compared with bone marrow transplantation in patients with hematologic malignancies.
J Clin Oncol
15:1608,
1997[Abstract]
9.
Mielcarek M,
Roecklein BA,
Torok-Storb B:
CD14+ cells in granulocyte colony-stimulating factor (G-CSF)-mobilized peripheral blood mononuclear cells induce secretion of interleukin-6 and G-CSF by marrow stroma.
Blood
87:574,
1996[Abstract/Free Full Text]
10.
Madsen M,
Johnsen HE:
A methodological study of E-rosette formation using AET-treated sheep red blood cells.
J Immunol Methods
27:61,
1979[Medline]
[Order article via Infotrieve]
11.
Wahl LM,
Katona IM,
Wilder RL,
Winter CC,
Haraoui B,
Scher I,
Wahl SM:
Isolation of human mononuclear cell subsets by counterflow centrifugal elutriation (CCE). I. Characterization of B-lymphocyte-, T-lymphocyte-, and monocyte-enriched fractions by flow cytometric analysis.
Cell Immunol
85:373,
1984[Medline]
[Order article via Infotrieve]
12.
Graf L,
Torok-Storb B:
Identification of a novel DNA sequence differentially expressed between normal human CD34+CD38hi and CD34+CD38lo marrow cells.
Blood
86:548,
1995[Abstract/Free Full Text]
13.
Wilkinson M:
RNA isolation: A mini-prep method.
Nucleic Acids Res
16:10933,
1988[Free Full Text]
14.
Frankenberger M,
Sternsdorf T,
Pechumer H,
Pforte A,
Ziegler-Heitbrock HW:
Differential cytokine expression in human blood monocyte subpopulations: A polymerase chain reaction analysis.
Blood
87:373,
1996[Abstract/Free Full Text]
15.
de Waal Malefyt R,
Abrams J,
Bennett B,
Figdor CG,
de Vries JE:
Interleukin 10 (IL-10) inhibits cytokine synthesis by human monocytes: An autoregulatory role of IL-10 produced by monocytes.
J Exp Med
174:1209,
1991[Abstract/Free Full Text]
16.
Parry SL,
Sebbag M,
Feldmann M,
Brennan FM:
Contact with T cells modulates monocyte IL-10 production: Role of T cell membrane TNF-alpha.
J Immunol
158:3673,
1997[Abstract]
17.
Geissler K:
Current status of clinical development of interleukin-10.
Curr Opin Hematol
3:203,
1996 [Medline]
[Order article via Infotrieve]
18.
Moore KW,
O'Garra A,
de Waal Malefyt R,
Vieira P,
Mosmann TR:
Interleukin-10 (review).
Annu Rev Immunol
11:165,
1993[Medline]
[Order article via Infotrieve]
19.
Fiorentino DF,
Bond MW,
Mosmann TR:
Two types of mouse T helper cell. IV. Th2 clones secrete a factor that inhibits cytokine production by Th1 clones.
J Exp Med
170:2081,
1989[Abstract/Free Full Text]
20.
Yssel H,
de Waal Malefyt R,
Roncarolo MG,
Abrams JS,
Lahesmaa R,
Spits H,
de Vries JE:
IL-10 is produced by subsets of human CD4+ T cell clones and peripheral blood T cells.
J Immunol
149:2378,
1992[Abstract]
21.
de Vries JE:
Regulation of human monocyte functions by interleukin-10
, in de Vries JE,
de Waal Malefyt R
(eds):
Interleukin-10.
Austin, TX, R.G. Landes
, 1995
, p 37
22.
O'Garra A:
Interleukin-10: An inhibitor of macrophage-dependent stimulation of Th1 cells
, in de Vries JE,
de Waal Malefyt R
(eds):
Interleukin-10.
Austin, TX, R.G. Landes
, 1995
, p 53
23.
Fiorentino DF,
Zlotnik A,
Vieira P,
Mosmann TR,
Howard M,
Moore KW,
O'Garra A:
IL-10 acts on the antigen-presenting cell to inhibit cytokine production by Th1 cells.
J Immunol
146:3444,
1991[Abstract]
24.
Ding L,
Linsley PS,
Huang LY,
Germain RN,
Shevach EM:
IL-10 inhibits macrophage costimulatory activity by selectively inhibiting the up-regulation of B7 expression.
J Immunol
151:1224,
1993[Abstract]
25.
D'Andrea A,
Aste-Amezaga M,
Valiante NM,
Ma X,
Kubin M,
Trinchieri G:
Interleukin 10 (IL-10) inhibits human lymphocyte interferon gamma-production by suppressing natural killer cell stimulatory factor/IL-12 synthesis in accessory cells.
J Exp Med
178:1041,
1993[Abstract/Free Full Text]
26.
de Waal Malefyt R,
Yssel H,
de Vries JE:
Direct effects of IL-10 on subsets of human CD4+ T cell clones and resting T cells. Specific inhibition of IL-2 production and proliferation.
J Immunol
150:4754,
1993[Abstract]
27.
Taga K,
Mostowski H,
Tosato G:
Human interleukin-10 can directly inhibit T-cell growth.
Blood
81:2964,
1993[Abstract/Free Full Text]
28.
Groux H,
Bigler M,
de Vries JE,
Roncarolo MG:
Interleukin-10 induces a long-term antigen-specific anergic state in human CD4+ T cells.
J Exp Med
184:19,
1996[Abstract/Free Full Text]
29.
Bacchetta R,
Bigler M,
Touraine JL,
Parkman R,
Tovo PA,
Abrams J,
de Waal Malefyt R,
de Vries JE,
Roncarolo MG:
High levels of interleukin 10 production in vivo are associated with tolerance in SCID patients transplanted with HLA mismatched hematopoietic stem cells.
J Exp Med
179:493,
1994[Abstract/Free Full Text]
30.
Korholz D,
Kunst D,
Hempel L,
Sohngen D,
Heyll A,
Bonig H,
Gobel U,
Zintl F,
Burdach S:
Decreased interleukin 10 and increased interferon-gamma production in patients with chronic graft-versus-host disease after allogeneic bone marrow transplantation.
Bone Marrow Transplant
19:691,
1997[Medline]
[Order article via Infotrieve]
31.
Ottinger HD,
Beelen DW,
Scheulen B,
Schaefer UW,
Grosse-Wilde H:
Improved immune reconstitution after allotransplantation of peripheral blood stem cells instead of bone marrow.
Blood
88:2775,
1996[Abstract/Free Full Text]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
J. Joseph, P. Mehta, A. Rimawi, M. Cottler-Fox, A. Sinha, B. Mansingh, E. S. Smith III, and J. L. Mehta
Stem cell mobilization utilizing granulocyte colony stimulating factor in advanced chronic heart failure: lessons from a pilot study
Eur. Heart J. Suppl.,
December 1, 2008;
10(suppl_K):
K24 - K26.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. Anderlini and R. E. Champlin
Biologic and molecular effects of granulocyte colony-stimulating factor in healthy individuals: recent findings and current challenges
Blood,
February 15, 2008;
111(4):
1767 - 1772.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
U. Bharadwaj, M. Li, R. Zhang, C. Chen, and Q. Yao
Elevated Interleukin-6 and G-CSF in Human Pancreatic Cancer Cell Conditioned Medium Suppress Dendritic Cell Differentiation and Activation
Cancer Res.,
June 1, 2007;
67(11):
5479 - 5488.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. R. Fraser, G. Cook, I. M. Franklin, J. G. Templeton, M. Campbell, T. L. Holyoake, and J. D. M. Campbell
Immature monocytes from G-CSF-mobilized peripheral blood stem cell collections carry surface-bound IL-10 and have the potential to modulate alloreactivity
J. Leukoc. Biol.,
October 1, 2006;
80(4):
862 - 869.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. S. Morris, K. P. A. MacDonald, and G. R. Hill
Stem cell mobilization with G-CSF analogs: a rational approach to separate GVHD and GVL?
Blood,
May 1, 2006;
107(9):
3430 - 3435.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Z. F. M. Vasconcelos, B. M. dos Santos, J. Farache, T. S. S. Palmeira, R. B. Areal, J. M. T. Cunha, M. A. Barcinski, and A. Bonomo
G-CSF-treated granulocytes inhibit acute graft-versus-host disease
Blood,
March 1, 2006;
107(5):
2192 - 2199.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Rutella, F. Zavala, S. Danese, H. Kared, and G. Leone
Granulocyte Colony-Stimulating Factor: A Novel Mediator of T Cell Tolerance
J. Immunol.,
December 1, 2005;
175(11):
7085 - 7091.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. P. A. MacDonald, V. Rowe, A. D. Clouston, J. K. Welply, R. D. Kuns, J. L. M. Ferrara, R. Thomas, and G. R. Hill
Cytokine Expanded Myeloid Precursors Function as Regulatory Antigen-Presenting Cells and Promote Tolerance through IL-10-Producing Regulatory T Cells
J. Immunol.,
February 15, 2005;
174(4):
1841 - 1850.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Eapen, M. M. Horowitz, J. P. Klein, R. E. Champlin, F. R. Loberiza Jr, O. Ringden, and J. E. Wagner
Higher Mortality After Allogeneic Peripheral-Blood Transplantation Compared With Bone Marrow in Children and Adolescents: The Histocompatibility and Alternate Stem Cell Source Working Committee of the International Bone Marrow Transplant Registry
J. Clin. Oncol.,
December 15, 2004;
22(24):
4872 - 4880.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Crough, M. Nieda, and A. J. Nicol
Granulocyte Colony-Stimulating Factor Modulates {alpha}-Galactosylceramide-Responsive Human V{alpha}24+V{beta}11+ NKT Cells
J. Immunol.,
October 15, 2004;
173(8):
4960 - 4966.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Tanaka, T. Toubai, Y. Tsutsumi, Y. Miura, N. Kato, S. Umehara, K. Kahata, A. Mori, N. Toyoshima, S. Ota, et al.
Cytolytic activity and regulatory functions of inhibitory NK cell receptor-expressing T cells expanded from granulocyte colony-stimulating factor-mobilized peripheral blood mononuclear cells
Blood,
August 1, 2004;
104(3):
768 - 774.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. S. Morris, K. P. A. MacDonald, V. Rowe, D. H. Johnson, T. Banovic, A. D. Clouston, and G. R. Hill
Donor treatment with pegylated G-CSF augments the generation of IL-10-producing regulatory T cells and promotes transplantation tolerance
Blood,
May 1, 2004;
103(9):
3573 - 3581.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Franzke, W. Piao, J. Lauber, P. Gatzlaff, C. Konecke, W. Hansen, A. Schmitt-Thomsen, B. Hertenstein, J. Buer, and A. Ganser
G-CSF as immune regulator in T cells expressing the G-CSF receptor: implications for transplantation and autoimmune diseases
Blood,
July 15, 2003;
102(2):
734 - 739.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. P. A. MacDonald, V. Rowe, C. Filippich, R. Thomas, A. D. Clouston, J. K. Welply, D. N. J. Hart, J. L. M. Ferrara, and G. R. Hill
Donor pretreatment with progenipoietin-1 is superior to granulocyte colony-stimulating factor in preventing graft-versus-host disease after allogeneic stem cell transplantation
Blood,
March 1, 2003;
101(5):
2033 - 2042.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Rutella, L. Pierelli, G. Bonanno, S. Sica, F. Ameglio, E. Capoluongo, A. Mariotti, G. Scambia, G. d'Onofrio, and G. Leone
Role for granulocyte colony-stimulating factor in the generation of human T regulatory type 1 cells
Blood,
September 18, 2002;
100(7):
2562 - 2571.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
V. Lapierre, A. Auperin, H. Tayebi, J. Chabod, P. Saas, M. Michalet, S. Francois, F. Garban, C. Giraud, D. Tramalloni, et al.
Increased presence of anti-HLA antibodies early after allogeneic granulocyte colony-stimulating factor-mobilized peripheral blood hematopoietic stem cell transplantation compared with bone marrow transplantation
Blood,
July 30, 2002;
100(4):
1484 - 1489.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Heitger, P. Winklehner, P. Obexer, J. Eder, C. Zelle-Rieser, G. Kropshofer, M. Thurnher, and W. Holter
Defective T-helper cell function after T-cell-depleting therapy affecting naive and memory populations
Blood,
May 13, 2002;
99(11):
4053 - 4062.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. Tzachanis, A. Berezovskaya, L. M. Nadler, and V. A. Boussiotis
Blockade of B7/CD28 in mixed lymphocyte reaction cultures results in the generation of alternatively activated macrophages, which suppress T-cell responses
Blood,
February 15, 2002;
99(4):
1465 - 1473.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. M. Zaucha, T. Gooley, W. I. Bensinger, S. Heimfeld, T. R. Chauncey, R. Zaucha, P. J. Martin, M. E. D. Flowers, J. Storek, G. Georges, et al.
CD34 cell dose in granulocyte colony-stimulating factor-mobilized peripheral blood mononuclear cell grafts affects engraftment kinetics and development of extensive chronic graft-versus-host disease after human leukocyte antigen-identical sibling transplantation
Blood,
December 1, 2001;
98(12):
3221 - 3227.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G. E. Georges, R. Storb, B. Bruno, S. J. Brodie, J. D. Thompson, A. G. Taranova, J. M. Zaucha, M.-T. Little, E. Zellmer, P. F. Moore, et al.
Engraftment of DLA-haploidentical marrow with ex vivo expanded, retrovirally transduced cytotoxic T lymphocytes
Blood,
December 1, 2001;
98(12):
3447 - 3455.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. S. Joshi, J. C. Lynch, S. Z. Pavletic, S. R. Tarantolo, S. J. Pirruccello, A. Kessinger, and M. R. Bishop
Decreased immune functions of blood cells following mobilization with granulocyte colony-stimulating factor: association with donor characteristics
Blood,
September 15, 2001;
98(6):
1963 - 1970.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
V. Lapierre, N. Oubouzar, A. Auperin, D. Tramalloni, H. Tayebi, E. Robinet, M. Kuentz, D. Blaise, O. Hartmann, P. Herve, et al.
Influence of the hematopoietic stem cell source on early immunohematologic reconstitution after allogeneic transplantation
Blood,
May 1, 2001;
97(9):
2580 - 2586.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. Pulendran, J. Banchereau, S. Burkeholder, E. Kraus, E. Guinet, C. Chalouni, D. Caron, C. Maliszewski, J. Davoust, J. Fay, et al.
Flt3-Ligand and Granulocyte Colony-Stimulating Factor Mobilize Distinct Human Dendritic Cell Subsets In Vivo
J. Immunol.,
July 1, 2000;
165(1):
566 - 572.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. Przepiorka, T. L. Smith, J. Folloder, I. Khouri, N. T. Ueno, R. Mehra, M. Korbling, Y. O. Huh, S. Giralt, J. Gajewski, et al.
Risk Factors for Acute Graft-Versus-Host Disease After Allogeneic Blood Stem Cell Transplantation
Blood,
August 15, 1999;
94(4):
1465 - 1470.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. K. Singh, M. L. Varney, S. Buyukberber, K. Ino, A. G. Ageitos, E. Reed, S. Tarantolo, and J. E. Talmadge
Fas-FasL-mediated CD4+ T-Cell Apoptosis following Stem Cell Transplantation
Cancer Res.,
July 1, 1999;
59(13):
3107 - 3111.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. Pan, T. Teshima, G. R. Hill, D. Bungard, Y. S. Brinson, V. S. Reddy, K. R. Cooke, and J. L.M. Ferrara
Granulocyte Colony-Stimulating Factor-Mobilized Allogeneic Stem Cell Transplantation Maintains Graft-Versus-Leukemia Effects Through a Perforin-Dependent Pathway While Preventing Graft-Versus-Host Disease
Blood,
June 15, 1999;
93(12):
4071 - 4078.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. Corradini, C. Voena, C. Tarella, M. Astolfi, M. Ladetto, A. Palumbo, M. T. Van Lint, A. Bacigalupo, A. Santoro, M. Musso, et al.
Molecular and Clinical Remissions in Multiple Myeloma: Role of Autologous and Allogeneic Transplantation of Hematopoietic Cells
J. Clin. Oncol.,
January 1, 1999;
17(1):
208 - 208.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Abstract
Introduction
Abstract