|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 92 No. 1 (July 1), 1998:
pp. 273-282
The Evolution of B Precursor Leukemia in the Eµ-ret Mouse
By
Robert Wasserman,
Xiang-Xing Zeng, and
Richard R. Hardy
From the Division of Oncology, The Children's Hospital of
Philadelphia; the Department of Pediatrics, The University of
Pennsylvania School of Medicine, Philadelphia; and the Institute for
Cancer Research, Fox Chase Cancer Center, Philadelphia, PA.
 |
ABSTRACT |
Eµ-ret mice carrying an RFP/RET fusion gene under the
transcriptional control of the immunoglobulin heavy chain enhancer
develop B lineage leukemias/lymphomas. We have characterized B-cell
development in these mice before the onset of clinical disease to
determine the steps involved in leukemogenesis. Flow cytometry reveals
that the
CD45R+CD43+CD24+BP-1+
late pro-B-cell population is markedly expanded in the bone marrow of
3- to 5-week-old Eµ-ret mice. Compared with late pro-B cells from
transgene-negative mice, Eµ-ret late pro-B cells have a limited capacity to differentiate in interleukin (IL)-7 and a higher incidence of VDJ rearrangements, but a similar cell cycle profile. In contrast, CD45R+CD43+CD24+BP-1
early pro-B cells from 3- to 5-week-old Eµ-ret mice, which also express the RFP/RET transgene, differentiate in IL-7 similarly to their
normal counterparts. Furthermore, early pro-B cells from Eµ-ret and
transgene-negative mice have an identical pattern of growth inhibition
when exposed to interferons (IFNs)- / and - , whereas,
pro-B-cell leukemia lines derived from Eµ-ret mice are markedly less
sensitive to growth inhibition by these IFNs. In 13-week-old
well-appearing Eµ-ret mice, late pro-B cells upregulate CYCLIN D1
expression and downregulate CASPASE-1 expression in a pattern that
correlates with the emergence of B precursor cells in the peripheral
blood and the loss of other B lineage subsets in the bone marrow. Taken
together, these results suggest that the expression of the RFP/RET
transgene initially prevents the normal elimination of late pro-B
cells with nonproductive rearrangements. Secondary events that
simultaneously disturb the normal transcriptional regulation of genes
involved in the control of the cell cycle and apoptosis may allow for
subsequent malignant transformation within the expanded late
pro-B-cell population.
 |
INTRODUCTION |
B PRECURSOR ACUTE lymphoblastic leukemia
(ALL), the most common childhood cancer, results from the overgrowth of
the marrow compartment with a clonal population of pro-B or pre-B
cells.1-3 The majority of B precursor leukemias manifest
somatic chromosomal abnormalities such as deletions, translocations,
and alterations in ploidy. Many of the genes affected by these
abnormalities have been identified and characterized as playing a role
in either cell survival or proliferation.4 However, a
limitation of studying the pathogenesis of B precursor ALL using
patient samples is that no preleukemic stage is recognizable.
Therefore, it is unclear whether a genetic abnormality precedes,
follows, or occurs concurrently with transformation. Consequently,
several approaches using animal models have been developed that allow
investigators to observe how a transformed monoclonal population
emerges from a pool of polyclonal B precursors. These approaches
include the infection of murine bone marrow with retroviruses as well
as the generation of mice with transgenic constructs that transform B
lineage cells. For example, mice carrying a transgene (Eµ-myc) that
causes overexpression of the MYC gene develop predominately B precursor
leukemias/lymphomas.5 The study of Eµ-myc mice has
identified alterations in the size, proliferation, and control of
apoptosis within the bone marrow B precursor cell population before
transformation.6,7 Most notably, these studies have
validated a multistep process of leukemogenesis.
The utility of animal model systems to study the pathogenesis of B
precursor ALL is aided by the understanding of normal B lineage
development. Bone marrow B-cell differentiation follows an ordered
pattern where the pro-B-cell stages are characterized by the
rearrangement of the immunoglobulin heavy chain (IgH) loci, the
pre-B-cell stage by the expression of cytoplasmic IgM heavy chain
(µ) protein, and the B-cell stages by expression of surface (s) IgM
and subsequent IgD protein.8,9 In both humans and mice, B
lineage subsets corresponding to these discrete stages of
differentiation can be identified by a specific expression pattern of
cell surface antigens.10-12 These subsets have been isolated by multiparameter flow cytometry and characterized at both the
molecular and cellular levels. In murine B lineage development, the
late pro-B cell corresponds to the most commonly transformed B lineage
cell in human B precursor ALL. Late pro-B cells are in the process of
completing the rearrangement of the IgH chain loci (V to DJ joining).
The successful completion of this stage will result in the production
of µ protein, and the cells will undergo a proliferative burst, the
most prominent of any marrow B lineage stage.10 In
contrast, failure to make a productive VDJ rearrangement will lead to
cell death, although the steps involved in this process largely remain
unknown.13 Thus, late pro-B cells appear to be
particularly vulnerable to transformation through mutations that would
disrupt the control of the cell cycle and apoptosis.
The RET tyrosine kinase is expressed during the pro-B-cell stages of
murine bone marrow B lineage development.14 Ret expression is subsequently downregulated at the pre-B-cell stage as a consequence of µ expression.14 Mutations in RET that result in
constitutive tyrosine kinase activity are oncogenic.15,16 A
fusion protein containing the amino terminal of the RFP protein, a
transcriptional activator, and the membrane and tyrosine kinase domains
of RET induced B lymphoid malignancies when expressed under the
transcriptional control of the IgH enhancer in transgenic (Eµ-ret)
mice.17 Specifically, the Eµ-ret mice developed
adenopathy and hepatosplenomegaly at 2 to 5 months of age. The
malignant cells were characterized as B precursors as they expressed
CD45R but lacked sIgM and had clonal IgH chain
rearrangements.17 We have rederived the Eµ-ret mouse to
determine the abnormalities in B-cell development that occur over time
and result in the transformed state. We studied well-appearing Eµ-ret
mice at 3 to 5 weeks of age to characterize the early effect of the
transgenic construct on B lymphopoiesis and at 13 weeks of age to
identify secondary changes that could contribute to malignant
outgrowth. We have identified the late pro-B-cell fraction (Fr) C as
the specific B lineage differentiation stage perturbed by the
transgenic construct and compared the functional characteristics of
these cells with those from normal mice. In addition, we show changes
in gene expression of two genes, CYCLIN D1 and CASPASE-1, involved in
cell cycle control and apoptosis, respectively, that are detectable
before the onset of frank leukemia.
 |
MATERIALS AND METHODS |
Mice.
A transgenic male mouse carrying a RFP/RET fusion gene under the
transcriptional control of the IgH enhancer (Eµ-ret) was generated on
a C57BL/6 × DBA2 background. The Eµ-ret male was crossed to BALB/c
females as were subsequent male progeny. The mice reported in this
study have been bred through at least two generations of BALB/c
matings. The Eµ-ret construct has been previously described and used
to generate a line of Eµ-ret mice.17
Cell preparation.
A single cell suspension of bone marrow (femur and tibia) was prepared
by injecting ice-cold staining medium (deficient RPMI [Irvine
Scientific, Santa Ana, CA] containing 10 mmol/L HEPES, 3% fetal calf
serum [FCS], and 0.1% NaN3) into the bone to flush out
cells, followed by gentle mixing with a 1-mL syringe. Cells were
treated with 0.165 mol/L NH4Cl to eliminate erythrocytes. Approximately 100 µL of peripheral blood was diluted into 0.5 mL
staining medium with 12.5 U/mL Heparin Sulfate. The suspension was
layered over 1 mL Lympholyte-M (Cedarlane Laboratories, Hornby, Canada)
and spun at 2,600 RPM at room temperature for 20 minutes. The
lymphocyte layer (interface) was removed and washed twice with staining
medium.
Cell surface staining and flow cytometry.
Bone marrow cells were stained as described previously with a
four-color combination of fluorescent monoclonal antibodies: anti-CD45R(B220) (allophycocyanin-6B2), anti-CD43 (fluorescein-S7), anti-BP-1 (phycoerythrin-BP-1), anti-CD24/HSA (biotin-30F1/Texas Red
[or Red-613]-avidin).10 Peripheral blood lymphocytes were stained simultaneously with anti-CD45R(B220)(phycoerythrin-6B2) and
anti-IgM (fluorescein-331.12). Four-color flow cytometry analysis and
sorting of bone marrow was performed using a dual laser (FACSVantage, Becton Dickinson Immunocytometry Systems, San Jose, CA) or a dual laser/dye laser flow cytometer (FACStarPLUS, Becton
Dickinson) equipped with appropriate filters for four-color immunofluorescence. Reanalysis of sorted fractions consistently showed
purities in excess of 95%. Samples were held on ice during sorting.
Two-color flow cytometry analysis of peripheral blood and interleukin-7
(IL-7) treated pro-B cells was performed on a single laser flow
cytometer (FACScan, Becton Dickinson).
Cell lines and cell culture conditions.
The 02/1 cell line was produced from a single cell clone of the
Eµ-ret 02 cell line.18 The 2-19 cell line was derived
from a bulk culture of the leukemic bone marrow from our Eµ-ret mouse line. These two cell lines are CD45R+CD43+ and
cytoplasmic µ and thus correspond to the pro-B cell
stage of B lineage differentiation19 (and unpublished
observations). In the interferon (IFN) proliferation assays, the lines
were cultured for 3 days in standard medium (RPMI 1640 supplemented
with 5% FCS, 2 mmol/L L-glutamine, 25 mmol/L HEPES, and 50 µmol/L
2-mercaptoethanol), and IL-7 (Genzyme, Cambridge, MA) at 100 U/mL was
added at time 0 to cultures containing the 2-19 line. In the IL-7
differentiation and IFN proliferation assays, sorted pro-B cells were
cultured for 4 days using standard medium supplemented with IL-7 at 100 U/mL at time 0. In the IFN proliferation assays, murine IFN- /
(Sigma, St Louis, MO) and IFN- (Genzyme) were added at time 0 at the
indicated concentrations.
Cell cycle analysis.
Pro-B cells were sorted directly into 80% ethanol and chilled to
20°C. The cells were pelleted and resuspended in 500 µL of
staining solution (phosphate-buffered saline [PBS] containing 50 µg/mL propidium iodide, 0.1% Triton X-100, 0.5 mmol/L EDTA, and 50 µg/mL RNAse A). Cells were then analyzed by flow cytometry and the
cell cycle histograms were produced using the Modfit program (Verite
Software, Topsham, ME).
RNA extraction and reverse transcription-polymerase chain reaction
assay (RT-PCR).
A total of 105 cells were either sorted directly
(bone marrow pro-B cells) into microcentrifuge tubes
containing 350 µL of RNA lysis buffer (6 mol/L Guanidine thiocyanate,
0.67% Na N-lauroylsarcosine, 33 mmol/L Na Citrate, and 133 mmol/L 2-mercaptoethanol) or first suspended in 150 µL PBS
(cell lines). After mixing, the samples were extracted with an equal
volume of acid phenol (pH 4.3), and then 1/5 volume of chloroform:
isoamyl alcohol (24:1) was mixed with the removed top layer. After a
15-minute incubation on ice, the samples were spun at 10,000 rpm at
4°C for 15 minutes. The top layer was removed and an equal volume of
isopropanol was added along with 1 µl of glycogen (20 mg/mL). The
samples were precipitated for 1 hour at 20°C and spun at 10,000 rpm at 4°C for 20 minutes. The RNA pellet was washed with 70%
ethanol, dried in a speed vacuum, and resuspended in 18 µL of water.
cDNA was synthesized using a reaction mixture consisting of 4 µL of
RNA, 6 µL of water, and 1 µL of 10 U/mL random hexamers (Pharmacia,
Piscataway, NJ), which was incubated for 10 minutes at 70°C and
placed on ice. The following reagents were then added: 2 µL of 10×
PCR buffer (Life Technologies, Grand Island, NY), 2 µL of 25 mmol/L
MgCl2, 2 µL of 0.1 mol/L dithiothreitol (DTT), and 1 µL
of 10 mmol/L dNTPs (Amersham Life Science, Arlington Heights, IL). The
mixture was incubated at 25°C for 5 minutes, and 1 µL (20 to 40 U/µL) of RNAsin (Promega, Madison, WI) and 1 µL (200 U/µL) of
Superscript II-reverse transcriptase (Life Technologies) was added and
incubated for 10 minutes at 25°C. The reaction was then incubated at
42°C for 50 minutes and subsequently at 95°C for 5 minutes.
PCR reactions were performed in a 50-µL reaction mixture containing 1 to 2 µL of cDNA with final concentrations of 1× PCR buffer II
(Perkin Elmer Roche, Branchburg, NJ), 2.5 mmol/L MgCl2, 0.1 mmol/L dNTPs, 1 µmol/L of primers, and 2.5 U of Taq polymerase (Perkin Elmer Roche). Primer sequences (5 -3 ) were: -actin (623 bp), sense-CCTAAGGCCAACCGTGAAAAG and antisense-TCTTCATGGTGCTAGGAGCCA; CASPASE-1 (510 bp), sense-GCACATTTCCAGGACTGACTGG and
antisense-ACACCACTCCTTGTTTCTCTCCAC; CYCLIN D1 (567 bp),
sense-AGTGCGTGCAGAAGGAGATT and antisense-TGGAAAGAAAGTGCGTTGTG; and
CYCLIN D2 (568 bp), sense-TCCTCTGGCCATGAATTACC and
antisense-ATGCTGCTCTTGACGGAACT. Primer pairs spanned introns to
discriminate signals resulting from contaminating DNA. After an initial
10-minute incubation at 80°C for 10 minutes, the PCR conditions were
95°C for 30 seconds, 62°C (for the first five cycles) or 58°C
(for subsequent cycles) for 30 seconds, and 72°C for 45 seconds for
the indicated number of cycles. Five to ten microliters of amplified
cDNAs were run on 1.5% agarose gels and blotted onto Hybond N
membranes (Amersham). Filters were ultravioletly
crosslinked, hybridized with 5 end-labeled oligoprobes specific for
their corresponding PCR products, and visualized using Biomax-MS film
(Kodak, Rochester, NY). Probe sequences (5 -3 ) were: -actin,
CCTCCCTGGAGAAGAGCTATGA; CASPASE-1, CACAGCTCTGGAGATGGTGA; CYCLIN D1,
TGCAAATGGAACTGCTTCTG; and CYCLIN D2, CCTCACGACTTCATTGAGCA.
DNA preparation, PCR, and data analysis.
Pro-B cells were sorted directly into standard media, pelleted, and
lysed in modified STE buffer (50 mmol/L Tris-HCL pH 8.0, 10 mmol/L
EDTA, 100 mmol/L NaCL, 0.1% sodium dodecyl sulfate [SDS], and 1 µg/mL Proteinase K) at a concentration of 1 to 2 × 103
cells/µL.20 The lysate was incubated at 55°C for 1 hour
and then at 95°C for 5 minutes. One to two microliters of lysate was amplified using the above PCR reagents and conditions for RT-PCR. Primer sequences were; -actin (737 bp), sense-GTGTCATGGTAGGTATGGGT and antisense-GCGCACAATCTCACGTTCAG; and 5 DFL16.1 (560 bp),
sense-GAGTGCCATCAGACACCACAG and antisense-GTGTGGAAAGCTGTGTATCCCC.
Blotting and hybridization were performed as above using
oligonucleotide probes specific for -actin (AACTGGGACGACATGGAGAA)
and 5 DFL16.1 (CCTAAGCCATACAGTGTACC). The autoradiographs were scanned
using National Institute's of Health (Bethesda, MD) Image software. To
correct for differences in the amount of inputed DNA, the signal
intensity for the 5 DFL16.1 amplifications was normalized by using the
-actin signal for the corresponding sample.
 |
RESULTS |
The Eµ-ret mice grow and gain weight at the same rate as their
transgene-negative littermates and are thus indistinguishable from
their littermates until they develop adenopathy. We compared the
pattern of B-cell development in the bone marrow of Eµ-ret mice at 3 to 5 weeks of age to transgene-negative littermates by flow cytometry.
Figure 1 shows a representative example
from mice in this age range. Figure 1A provides the surface expression staining pattern of CD45R and CD43 in the bone marrow cells of 4-week-old mice. CD45R identifies all B lineage cells, whereas CD43
expression distinguishes the CD43+ pro and early
pre-B-cell fractions (Fr A-C ) from the more differentiated CD43 subsets.10 As seen in the figure there
is an increase in the population of Fr A-C cells in the Eµ-ret mice.
Figure 1B represents the pattern of CD24 and BP-1 expression among
CD45R+CD43+ gated B lineage cells. As shown,
these surface markers allow for the subdivision of
CD45R+CD43+ cells into pre pro-B (Fr A), early
pro-B (Fr B), late pro-B (Fr C), and early pre-B (Fr C ) subsets. The
marked increase in Fr C late pro-B cells in the Eµ-ret mice is
illustrated. Of note, the Fr C cells in the Eµ-ret mice have a higher
expression of BP-1 than their normal counterparts. Table
1 provides the actual percentages of total
marrow cells for the different CD45R+CD43+
fractions in these mice as well as the percentage of
CD45R+CD43 cells that is comprised of pre-B
cells (cytoplasmic IgM+), immature B cells
(sIgM+), and mature B cells
(sIgM+sIgD+). In both transgenic mice, there
is a decrease in the percentage of more mature
CD45R+CD43 B lineage cells, whereas the
percentage of the less mature CD45R+CD43+ cells
is increased 1.6- to 2-fold. As noted in Table 1, the increase in the
CD45R+CD43+ cell percentage is primarily due to
the 15- to 24-fold increase in the late pro-B-cell Fr C, as Fr A, B,
and C cells are present at similar percentages to the
transgene-negative mouse. Although the percentages of Fr A, B, and C
cells in the Eµ-ret mice are similar to the transgene-negative mouse,
the actual number of Fr A, B, and C cells are reduced approximately
25% because of the depressed bone marrow cellularity. Consequently,
CD45R+CD43 cells are also reduced in number
to a greater extent than indicated by the decreased percentage of this
population.

View larger version (45K):
[in this window]
[in a new window]
| Fig 1.
Representative flow cytometry of bone marrow showing
separation of B lineage subsets by cell-surface antigen expression in 4-week-old Eµ-ret (Tg+) and transgene-negative
(Tg ) mice. (A) CD45R+ B lineage cells
are resolved into less differentiated (CD43+) and more
differentiated subsets (CD43 ). The CD43+
subset, which is markedly expanded in the Eµ-ret mice, comprises the
three pro-B-cell fractions (Fr A through C) and the early pre-B-cell
fraction (Fr C ). (B) The CD45R+CD43+
subset is further resolved into Fr A through C based on BP-1 and CD24
expression. There is a selective expansion of the
BP-1+CD24+ late pro-B-cell fraction C in the
Eµ-ret mice.
|
|
The increased number of late pro-B cells with the accompanying
decrease in the more mature B lineage cells indicated that the RFP/RET
transgene product might impair the differentiation of late pro-B
cells. We took sorted Fr B early pro-B cells and Fr C late pro-B
cells from 4-week-old mice and allowed them to differentiate in media
supplemented with IL-7 (100 U/mL) over 4 days. We then stained the
cells for cell surface expression of CD43 and IgM. Figure
2 shows that Fr B cells from both Eµ-ret and transgene-negative mice have similar patterns of differentiation in
IL-7 with the majority of cells differentiating to the
CD43 stages. However, the two Eµ-ret Fr B samples did
have a higher percentage of cells (11.4% and 7.8%) that remained
phenotypically as CD43+ pro- or early pre-B cells
compared with the transgene-negative Fr B sample (4.2%). In contrast,
a markedly higher number of sorted Fr C cells fail to differentiate
beyond the CD43+ stage (59.1% and 32.8%) in the two
Eµ-ret mice compared with the transgene-negative mouse (2.1%). Thus,
the early pro-B cell population from the Eµ-ret mice differentiates
better than the late pro-B cell population.

View larger version (13K):
[in this window]
[in a new window]
| Fig 2.
Differentiation patterns of sorted early (Fr B) and late
(Fr C) pro-B cells from 4-week-old Eµ-ret (Tg+) and
transgene-negative (Tg ) mice. A total of 2 to 4 × 104 cells were cultured in IL-7 (100 U/mL) for 4 days and
analyzed by flow cytometry for cell surface expression of CD43 and IgM. Mean percentages are given for duplicate cultures. Cells retaining CD43
expression correspond phenotypically to either the pro-B-cell or early
pre-B-cell stage, whereas the cells losing CD43 expression correspond
to the late pre-B (sIgM ) or B-cell stage
(sIgM+). Fr C late pro-B cells from Eµ-ret mice
retain a higher percentage of cells with CD43 expression.
|
|
We next investigated whether Fr C late pro-B cells in the young
Eµ-ret mice have higher levels of VDJ rearrangements compared with
transgene-negative mice. We sorted Fr B and Fr C pro-B cells from
4-week-old mice and isolated DNA. We amplified by PCR a 560-bp region
upstream of the most 5 D gene, DFL16.1, in the IgH locus. Because this
region also lies 3 to the V gene IgH locus, it is lost upon V to DJ
rearrangement.21 A previous study in BALB/c mice detecting
deletions 5 to the J locus (indicating DJ rearrangement) as well as 5
to the D locus showed that Fr C late pro-B cells had a higher
percentage of DJ rearrangements than Fr B cells, but that both
fractions had a paucity of VDJ rearrangements.10 As can be
seen in Fig 3, Fr B cells from the Eµ-ret
mice have a comparable signal intensity as the early pro-B cells from
the transgene negative mouse for the 5 DFL16.1 sequence. Thus, early pro-B cells from Eµ-ret mice are similar to early pro-B cells from
the transgene-negative mouse in their lack of VDJ rearrangements. However, analysis of Fr C cells shows a greater than 50% decrease in
intensity of the 5 DFL16.1 amplified sequence in the Eµ-ret mice
compared with the transgene-negative mouse. These results indicate that
at least half of the IgH loci present in the late pro-B cells from the
Eµ-ret mice have undergone V to DJ recombination.

View larger version (59K):
[in this window]
[in a new window]
| Fig 3.
PCR analysis of completed VDJ rearrangement of the IgH
locus in sorted early (Fr B) and late (Fr C) pro-B cells from
4-week-old Eµ-ret (Tg+) and transgene-negative
(Tg ) mice. A 560-bp region upstream of the most V
proximal D element, DFL16.1, that is lost on V to DJ rearrangement was
amplified. Autoradiography was used to compare the signal intensity of
the 5 DFL16.1 amplification after standardization with an -actin signal. Fr B cells from the Eµ-ret mice average 98% of the 5 DFL16.1 signal intensity generated by Fr B cells from the transgene negative mice, whereas the Fr C cells average 43% of the signal intensity generated by the Fr C cells from the transgene-negative mice.
Shown are 30-minute exposures of 26 cycles of amplification from the
DNA of approximately 2 × 103 cells.
|
|
Because the Fr C cells in the young Eµ-ret mice appeared to be
comprised of a population of late pro-B cells with nonproductive rearrangements, we wanted to determine whether expression of the transgene construct might make pro-B cells resistant to cytokines known to inhibit proliferation and induce apoptosis in B precursor cells.22,23 We compared the sensitivity of Fr B cells
cultured in IL-7 to growth inhibition by IFN- / and IFN- in
both Eµ-ret mice and transgene-negative mice. We chose to compare
early pro-B cells because these two populations are similar in their
ability to differentiate in IL-7, have comparable levels of VDJ
rearrangements, and the transgene is already expressed at this stage
(data not shown). We also compared the sensitivity of these early
pro-B cells with an IL-7-dependent (2-19) and independent (02/1)
pro-B-cell leukemia line derived from Eµ-ret mice with adenopathy
and hepatosplenomegaly. As seen in Fig 4,Fr B cells from 3- to 5-week-old Eµ-ret and transgene-negative mice
have identical patterns of growth inhibition by IFN- / , with
greater than 50% inhibition noted with concentrations of 100 U/mL. The
IL-7-dependent line, 2-19, was less sensitive than the sorted cells to
growth inhibition at each concentration of IFN- / . The
IL-7-independent line, 02/1, showed the least sensitivity with less
than 50% growth inhibition to IFN- / even at a concentration of
1,000 U/mL. In regards to IFN- sensitivity, we found that Fr B cells
from the Eµ-ret and transgene-negative mice also exhibited the same
pattern of growth inhibition. As seen in Fig 4, sorted Fr B cells
exhibited greater than 50% growth inhibition with 0.5 U/mL IFN- . In
contrast, the 2-19 line required 10 U/mL of IFN- to achieve a
greater than 50% inhibition, and this level of inhibition was still
less than that achieved with 0.5 U in the Fr B cells. The 02/1 line was
relatively resistant with some inhibition noted only with the 10 U/mL
of IFN- . In addition to growth inhibition, the proportion of dead to
live cells in the cultures as measured by propidium iodide staining was
similar between the two Fr B populations (data not shown). These
results indicate that there is no difference in sensitivity to
IFN- / and - between early pro-B cells from young Eµ-ret and
transgene-negative mice.

View larger version (12K):
[in this window]
[in a new window]
| Fig 4.
The effect of IFN- / and IFN- on the growth of
sorted early (Fr B) pro-B cells from 3- to 5-week-old Eµ-ret
(Tg+) and transgene-negative (Tg )
mice. A total of 2 to 4 × 104 Fr B cells were cultured in
IL-7 (100 U/mL) for 4 days along with the indicated amount of the IFN.
A total of 2 × 105 cells from the Eµ-ret-derived
pro-B-cell lines, 2-19 and 02/1, were cultured for 3 days with (2-19)
or without (02/1) IL-7. The proliferation percentages were calculated
relative to the amount of proliferation (sum of live and dead cells)
observed in the absence of the IFN (set at 100%). Mean percentages are
given for two different sorts (Fr B cells) or two separate experiments
(cell lines), and standard deviations are indicated by the error bars. Cell number was measured either by flow cytometry (Fr B cells) or by
light microscopy (cell lines). The ratio of live to dead cells in the
Fr B cell cultures from both the Eµ-ret and transgene-negative mice,
as measured by propidium iodide staining, were similar for each IFN
concentration.
|
|
Lastly, we wanted to determine whether the increased number of Fr C
late pro-B cells in the young Eµ-ret mice could in part be accounted
for by a proliferative signal provided by the transgene product. Thus,
we examined the cell cycle parameters of late pro-B cells from the
bone marrow of 4-week-old Eµ-ret and transgene-negative mice. Figure
5 shows the cell cycle histograms of a
transgene-negative mouse compared with two Eµ-ret mice. The Fr C
cells from the transgene-negative mouse had 13.9% of cells with a DNA
content greater than G0 + G1, whereas Fr C
cells from the two Eµ-ret mice had somewhat lower percentages of
cells (8.7% and 10.8%) with a DNA content greater than G0 + G1. Consequently, these data indicate that Fr C cells in
the Eµ-ret mice may have a slightly prolonged cell cycle (longer G1) or, alternatively, that there are slightly more cells
not in cycle (larger G0 percentage). In addition, the
hypodiploid percentage in the transgene-negative mouse was 1.1%,
compared with 0.8% and 0.1% for the two Eµ-ret mice. The lower
percentage of hypodiploid Fr C cells found in the freshly prepared bone
marrow of Eµ-ret mice suggests that these cells may have a lower rate of apoptosis.

View larger version (11K):
[in this window]
[in a new window]
| Fig 5.
Cell cycle parameters in sorted late (Fr C) pro-B cells
from 4-week-old Eµ-ret (Tg+) and transgene-negative
(Tg ) mice. A total of 3 to 5 × 103 Fr C
cells were directly sorted into 80% ethanol and subsequently stained
with propidium iodide for analysis of DNA content by flow cytometry.
|
|
We were also interested in determining what subsequent steps might be
involved in the malignant transformation of the late pro-B cells. We
screened bone marrow or lymph node samples from eight Eµ-ret mice
with lymphadenopathy and hepatosplenomegaly for alterations in the
transcription of genes that control the cell cycle and apoptosis by
RT-PCR. We did not screen for the downregulation of N-myc as previously
reported in the tumors of Eµ-ret mice.17 The majority of
samples showed upregulated CYCLIN D1 expression and downregulated
CASPASE-1 expression compared with normal late pro-B cells. We then
wanted to determine whether these abnormalities might be detectable
before the clinical onset of leukemia.
Consequently, as shown in Fig 6A we
identified a litter of well-appearing 13-week-old mice in which three
Eµ-ret mice showed in the peripheral blood increasing amounts of
CD45R+sIgM cells, presumed to represent
circulating late pro-B cells or lymphoblasts. As seen in Table
2, the percentage of these peripheral blood
B precursor cells in the Eµ-ret mice ranged from 1.5% to 4.8%
compared with 0.1% for a transgene-negative mouse. The bone marrow of
these 13-week-old Eµ-ret mice revealed a predominance of Fr C late
pro-B cells as illustrated in Fig 6B. Similar to the 4-week-old
Eµ-ret mice, the late pro-B-cell population from these older
Eµ-ret mice remained less than 5% of the total bone marrow
population, and no mouse had obvious adenopathy. Specifically, the late
pro-B cells constituted 4.2%, 3.6%, and 4.3% of the bone marrow
population from mice 2-21, 2-14, and 2-18, respectively, compared with
0.3% for the transgene-negative littermate 2-16 (Table 2). In contrast
to the 4-week-old Eµ-ret mice, the 13-week-old mice showed a variable
decrease in the percentage of other CD45R+CD43+
B lineage subsets. We sorted the late pro-B Fr C cells from the three
Eµ-ret mice and the transgene-negative littermate and performed RT-PCR for the expression of CYCLIN D1 and CASPASE-1 as seen in Fig
7. CASPASE-1 expression was downregulated
and CYCLIN D1 upregulated to an extent that correlates not only with
the amount of circulating CD45R+sIgM cells
in the peripheral blood, but also with the progressive loss of the
early pro- (Fr B) and early pre- (Fr C ) B cells in the bone marrow
(Fig 6 and Table 2).

View larger version (34K):
[in this window]
[in a new window]
| Fig 6.
Flow cytometry of peripheral blood and bone marrow of
13-week-old well-appearing Eµ-ret (Tg+) littermates
and transgene-negative (Tg ) mice. (A) Density
separated peripheral blood lymphocytes were stained for CD45R and IgM
expression. Varying amounts of an abnormal population of
CD45R+sIgM B precursor cells are present
in the Eµ-ret mice. (B) CD45R+CD43+ gated
bone marrow cells from the above Eµ-ret mice along with a
Tg littermate were resolved by BP-1 and CD24 staining
into the pro-B cell Fr A through C and early pre-B Fr C . Eµ-ret
mouse 2-7 was an 11-week-old with splenomegaly and adenopathy.
|
|

View larger version (50K):
[in this window]
[in a new window]
| Fig 7.
RT-PCR analysis of gene expression of -actin,
CASPASE-1, and CYCLIN D1 in the sorted late pro-B cells (Fr C) of
13-week-old well-appearing Eµ-ret (Tg+) and
transgene-negative littermates (Tg ) mice. Ret 02/1 is
a pro-B-cell leukemia line derived from an Eµ-ret mouse. The
autoradiograms shown represent 30-minute to 1-hour exposures of 22 ( -actin) or 26 cycles (CASPASE-1 and CYCLIN D1) of amplification.
|
|
Lastly, we wanted to determine whether CYCLIN D1 expression correlates
with proliferation and could account for the outgrowth of a leukemic
clone in the Eµ-ret mice. We took bone marrow from mouse 2-19, which
had developed hepatosplenomegaly and adenopathy, and cultured the cells
for 4 days with and without IL-7. The marrow cells remained viable when
cultured without IL-7 but did not proliferate, whereas there was a
fourfold increase in cell number in the cultures supplemented with
IL-7. As shown in Fig 8, RT-PCR analysis of the bone marrow cells placed in media alone showed marked CYCLIN D1
expression but minimal CYCLIN D2 expression, the latter of which is
normally expressed in late pro-B cells. However, the bone marrow cells
supplemented with IL-7 downregulated CYCLIN D1 expression, but markedly
upregulated CYCLIN D2 expression. In contrast, the 02/1 line, which
proliferates in the absence of IL-7, expresses CYCLIN D1 (Fig 7) but
not CYCLIN D2 (data not shown), indicating that additional alterations
in cell cycle control has occurred in the 02/1 line.

View larger version (24K):
[in this window]
[in a new window]
| Fig 8.
RT-PCR analysis of gene expression of -actin, CYCLIN
D1, and CYCLIN D2 in the pro-B-cell leukemia of an Eµ-ret mouse.
Bone marrow was recovered from an Eµ-ret mouse (2-19) with adenopathy and splenomegaly and directly cultured for 4 days with or without IL-7
(100 U/mL). The cells survived without proliferation in media without
IL-7 and proliferated fourfold in media supplemented with IL-7. The
autoradiograms shown represent 30-minute exposures of 22 ( -actin) or
30 cycles (CYCLINS) of amplification.
|
|
 |
DISCUSSION |
In this study we have characterized bone marrow B-cell development in
the Eµ-ret mouse before the onset of frank leukemia to better
understand the events that lead to transformation. Initially, we wanted
to identify early changes in B-cell development that would likely arise
as a direct effect of the transgene product. The RFP/RET chimeric
protein, the product of the Eµ-ret transgene, has been proposed to
function as a constitutively activated ret kinase,24,25 but
it is possible that some of the effects of this protein result from an
abnormality of transcriptional regulation mediated by the truncated RFP
transcriptional activator.26,27 At 3 to 5 weeks of age, we
found that Eµ-ret mice show a profound overexpansion of the late
pro-B-cell population and decreased amounts of more mature
CD43 B lineage cells. The selective abnormality in the
late pro-B-cell population may be unique to the Eµ-ret mice because
several other mouse models of B lineage malignancies usually have
abnormalities in additional B lineage cells subsets. Specifically, in
the bone marrow of Eµ-myc mice an early and intermediate stage was
characterized as having increased amounts of pre-B cells (cytoplasmic
IgM+sIgM ) whose population later decreased
below normal levels, whereas the pro-B-cell population remained
elevated.6 In the bone marrow of IL-7 transgenic mice, all
CD45R+ subsets were elevated with the increase in the
pre-B-cell population predominating.28 Lastly, in the
pristane granuloma model of plasmacytoma, there is a persistent
increase in the total pro-B-cell (TdT+) population of
the bone marrow with a coincident loss of pre-B and B cells after a
single injection of pristane into the peritoneum.29 Thus,
depending on the specific inducing factor, various patterns of aberrant
B precursor cell development in the bone marrow may precede the
outgrowth of a malignant clone.
In murine B-cell development, differentiation beyond the pro-B-cell
stage is dependent on µ protein. Hence, B-cell differentiation is
arrested at the CD43+ late pro-B cell stage in
recombination-deficient mice, but CD43 pre-B cells are
produced in these mice when they carry µ transgenes.30-32 Consequently, we explored the possibility that the transgenic construct
interfered with the normal recombination process such that the ability
of pro-B cells to differentiate to the pre-B-cell stage was impaired.
Indeed, the Fr C late pro-B cells from the Eµ-ret mice had a
markedly higher percentage of cells that remained CD43+ in
short-term cultures with IL-7 compared with the transgene-negative mouse. However, Fr B early pro-B cells from the Eµ-ret mice, which are present in similar amounts to the transgene-negative mice and
already express the Eµ-ret transgene, had only a slightly higher
percentage of cells that remained CD43+ compared with
normal early pro-B cells. We interpret the Fr B results as indicating
that the transgene product does not globally impair differentiation at
the pro-B cell to pre-B-cell transition but might allow some late
pro-B cells to survive without differentiating in the Eµ-ret mice.
Taken together with the Fr C results, these data suggest that the late
pro-B cells that fail to differentiate might accumulate over time and
overpopulate the bone marrow in the Eµ-ret mice. Furthermore, it is
possible that the decreased number of more mature
CD45R+CD43 cells seen in the Eµ-ret mice
may result from an inhibition of Fr B-cell differentiation either by
competition for stromal cell sites with Fr C cells or by alterations in
cytokine levels as a response to the overexpanded pool of Fr C cells.
At the genomic level, late pro-B cells have undergone DJ rearrangement
usually on both IgH alleles and are in the process of rearranging a V
gene to the DJ joining. However, the majority of late pro-B cells
appear to lack a completed VDJ joining.10 Thus, it is
likely that late pro-B cells rapidly differentiate to the pre-B-cell
stage upon productive VDJ rearrangement, whereas those cells that make
nonproductive rearrangements are rapidly eliminated. Accordingly,
cytoplasmic µ protein was not detected in Fr C late pro-B
cells,19 and the pro-B-cell population was found to have
the highest frequency of cells undergoing apoptosis among marrow B
lineage cells.13 We used a deletional
analysis10 to determine the relative abundance of VDJ
joinings in the early and late pro-B cells of Eµ-ret and
transgene-negative mice. The analysis indicated that the majority of
IgH alleles have complete VDJ rearrangements (or deletions) within the
Eµ-ret late pro-B-cell population unlike the population from the
transgene-negative mice. Although we did not investigate whether the
late pro-B-cell population from the Eµ-ret mice might contain some
cells with productive rearrangements and cytoplasmic µ protein, the
finding that the majority of B precursor leukemias from Eµ-ret mice
lack µ protein (data not shown) suggests that the rearrangements are
predominately nonproductive. Furthermore, the vast majority of VDJ
rearrangements in Fr C late pro-B cells were shown to be
nonproductive.33 Thus, it appears that the initial
expansion of the late pro-B-cell population in the Eµ-ret mouse
results from the failure of cells with nonproductive rearrangements to
undergo apoptosis.
The steps whereby late pro-B cells with nonproductive VDJ
rearrangements undergo apoptosis remain largely unknown. Macrophages have been visualized ingesting apoptotic B lineage cells, and this
phagocytic activity likely accounts for the relative paucity of
detectable apoptotic cells in bone marrow.34 In the absence of macrophage ingestion, bone marrow cultured in simple media for 8 hours shows a marked increase in the percentage of apoptotic B lineage
cells, especially pro-B cells, indicating that internal signals likely
determine the fate of normal late pro-B cells.13 The
signaling pathway that triggers the death of late pro-B cells appears
to invoke the BCL-XL protein.35 Most notably,
transgenic mice that overexpress BCL-XL in B lineage cells
specifically generate increased number of pro-B cells with a
predominance of aberrant and nonproductive IgH
rearrangements.36 This observation contrasts with the
development of mature B-cell and very early B progenitor cell lymphoma
cells seen in mice carrying BCL-2 transgene
constructs,37,38 but is consistent with the expression
pattern of these two genes in marrow B lineage cells;
BCL-XL is expressed higher than BCL-2 in pro- and pre-B
cells, whereas BCL-2 is expressed higher in progenitor and mature B
cells.35 Furthermore, studies from knockout mice that lack
the RET receptor or its ligand, glial cell line-derived neurotrophic
factor, suggest that RET activity is necessary for the survival of
enteric neurons and embryonic renal cells.39,40 Thus,
constitutive RET tyrosine kinase activity provided by the RFP/RET
protein might produce a survival signal that overrides the apoptotic
signal generated in late pro-B cells with nonproductive VDJ
rearrangements. Because RET is normally downregulated by the production
of µ protein during murine B lineage development,14 it is
conceivable that RET participates in the survival of pro-B cells
rearranging the IgH loci. However, we have not detected any specific
abnormalities in B lineage development in RET knockout mice39 (unpublished observations, August
1995). We do not know whether RET activity affects
BCL-XL function, but levels of BCL-XL mRNA are
not notably different in late pro-B cells from Eµ-ret mice compared
with those from transgene-negative mice. In addition, RET activation
does not appear to be a common event in the pathogenesis of human B
precursor ALL.41
IFN- and - can directly inhibit proliferation and induce
apoptosis in marrow B precursor cells and IL-7-dependent B precursor lines.23 In contrast, IL-2-, IL-3-, or IL-4-dependent
and cytokine-independent B lineage lines are relatively resistant to
IFN- and - .23 IFN- , like IFN- / , was also
shown to inhibit proliferation and cause apoptosis in IL-7-dependent B
precursor cells.22 Consequently, we wanted to determine
whether pro-B cells that express the Eµ-ret transgene might also be
resistant to the effects of these IFN. An IL-7-dependent and a
cytokine-independent pro-B-cell line derived from Eµ-ret mice had
either no or minimal inhibition of proliferation, respectively, at
concentrations of IFN known to inhibit normal marrow B precursor cells
and IL-7-dependent B precursor cell lines. In contrast, the early
pro-B cells from young Eµ-ret and transgene-negative mice were
similarly sensitive to growth inhibition and cell death induced by the
IFN. These cytokine studies indicate that the expression of the
transgene alone cannot account for the relative resistance to IFN seen
in the Eµ-ret leukemias.
Because macrophages were shown to be the predominant producer of
IFN- / activity in the marrow23 and T-cell- or
natural killer cell-generated IFN- can activate
macrophages,42,43 it is possible that these three IFN play
a role in the initial containment of the overexpanding late pro-B-cell
population. Interestingly, Jacobsen et al7 observed a
pretumorous phase in the bone marrow of Eµ-myc mice characterized by
increased numbers of apoptotic B lineage cells and their phagocytosis
by macrophages. However, the authors proposed that the activity of the
MYC gene may have been responsible for the increase in the rate of B
precursor cell apoptosis, and the macrophage activity was simply a
response to the increased cell death.7 Nonetheless, these
cytokine data suggest that the development of resistance to growth
suppressing stimuli, as manifested in the Eµ-ret leukemias, is a
later event that may allow for the outgrowth of a malignant clone.
Thus, the Eµ-ret transgene appears to create a high-risk population
of late pro-B cells that will acquire additional mutations before
becoming transformed.
The cause of the elevated BP-1 levels in the Fr C cells from the
Eµ-ret mice is unknown. IL-7 and IFN- / have been shown to
increase BP-1 expression despite their opposite effects on proliferation.44-46 Consequently, it is possible that BP-1
overexpression results from either increased stromal cell IL-7
production in response to the deficient lymphopoiesis or the release of
the type 1 IFN as part of the host response to contain the overexpanded pool of late pro-B cells.
To begin to characterize the secondary mutational events that occur in
the expanded late pro-B cell population, we screened for alterations
in expression of genes that control the cell cycle. We studied the
expression of the D CYCLINS, because these CYCLINS are synthesized in
response to growth-inducing cytokines and their expression is the least
cell-cycle phase dependent.47 We found that the majority of
leukemias from the Eµ-ret mice express CYCLIN D1, whereas CYCLIN D1
mRNA is barely detectable in normal late pro-B cells. The appearance
of CYCLIN D1 expression is a characteristic of a diverse type of
malignancies, and it occurs secondary to a t(11;14)(q13;q32) involving
its rearrangement to the IgH loci in mantle B-cell
lymphomas.48 In addition, abnormal CYCLIN D1 expression has
been noted in the lymphomas of Eµ-myc mice.49 Surprisingly, transgenic mice that carry a CYCLIN D1 gene driven by an
IgH enhancer have only minor alterations in bone marrow B lymphopoiesis
and infrequent tumor formation.49,50
In 13-week-old well-appearing Eµ-ret mice whose bone marrow contained
less than 5% late pro-B cells, we found increasing amounts of CYCLIN
D1 expression that correlated with the disappearance of the less
differentiated early pro-B cell and more differentiated pre-B cells
as well as the amount of B precursor cells in the peripheral blood. In
the absence of IL-7, the Eµ-ret pro-B-cell leukemia line, 2-19, survives without proliferation and expresses CYCLIN D1 but not CYCLIN
D2. In contrast, the 2-19 line downregulates CYCLIN D1 and upregulates
CYCLIN D2 while proliferating in IL-7. These later observations
indicate that CYCLIN D1 expression per se is not sufficient to provide
a proliferative signal even in Eµ-ret pro-B cells that already have
other abnormalities. Consequently, the IL-7-independent proliferation
of the Eµ-ret pro-B cell line, 02/1, which expresses CYCLIN D1 but
not CYCLIN D2, suggests that additional mutations need to occur for
CYCLIN D1 to drive proliferation. Furthermore, the IL-7-dependent
proliferation of normal pro-B cells appears to be a consequence of
cytoplasmic µ protein production. As a result, pro-B cells from
recombination-deficient mice fail to proliferate in IL-7 alone, whereas
pro-B cells from recombination-deficient mice expressing µ transgenes proliferate similarly to normal late pro-B
cells.30,31 Thus, the ability of Eµ-ret late pro-B-cell leukemias to proliferate without µ protein production suggests that a
secondary event in the Eµ-ret late pro-B cells is the uncoupling of
proliferation from differentiation. In this regard, functional analysis
of the IL-7 receptor chain has identified distinct domains that
signal for proliferation and differentiation,51 raising the
possibility that the IL-7-dependent proliferative pathway is activated
independent of the differentiation pathway in the Eµ-ret late
pro-B-cell leukemias. In Abelson murine leukemia virus-transformed B
precursor cells, STAT proteins normally activated by IL-7 were
tyrosine-phosphorylated in the absence of this cytokine.52 This later mechanism could account for the IL-7-independent growth of
the ret 02/1 B precursor line.
Because resistance to external apoptotic stimuli such as IFN exposure
also appears to be a secondary event in the transformation of late
pro-B cells, we screened for alterations in expression of genes that
control apoptosis.35,53 We studied the expression of
BCL-XL, BCL-2, BAX, CASPASE-1, and CASPASE-3 in late pro-B cells and B precursor leukemias from Eµ-ret mice. CASPASE-1 was the
only gene to show consistent abnormalities at the transcriptional level
as its downregulation was noted in B precursor leukemias and the late
pro-B cells of older mice. CASPASE-1 is expressed in all bone marrow B
lineage fractions but at the highest levels in late pro-B
cells.54 Furthermore, CASPASE-1 expression is minimal in
fetal liver pro-B-cell development with a fivefold reduction in
expression compared with marrow late pro-B cells.54 There
are two potential mechanisms whereby CASPASE-1 downregulation might
inhibit apoptosis in the late pro-B cells from Eµ-ret mice. CASPASE-1 downregulation could directly block the transmission of an
apoptotic signal initiated by an external stimulus. T cells from
CASPASE-1-deficient mice are resistant to FAS-induced
apoptosis,55 and B-cell receptor cross-linking was recently
shown to prevent FAS-induced cell death by inactivating
CASPASE-1.56 Alternatively, CASPASE-1 downregulation might
prevent the activation of apoptosis-inducing cytokines expressed within
the late pro-B cells. In support, CASPASE-1 activity has been shown to
activate the proinflammatory cytokines IL-1 , IL-1 , and IL-18
(IFN- -releasing factor) from their mature forms in other
hematopoietic cell lineages.55,57-59 In either scenario,
the correlation between the loss of other B lineage marrow fractions
with CASPASE-1 downregulation in the late pro-B cells suggests that
CASPASE-1 downregulation may allow the late pro-B cells to survive in
the presence of a factor capable of killing other B lineage cells. This
factor may be synthesized by cells in the bone marrow compartment as
part of the host response to control the late pro-B-cell expansion or
perhaps from the late pro-B cells themselves.
Most notably, the coincident upregulation of CYCLIN D1 and
downregulation of CASPASE-1 expression may represent the emergence of a
clonal and thus transformed population within the pool of late pro-B
cells. It is possible that the abnormal transcriptional control of
these genes represents a coordinate process mediated by the aberrant
expression of a transcriptional factor. Accordingly, in human B
precursor ALL, transcriptional activators are often one component of a
chimeric protein produced from a chromosomal translocation.4 Thus, there may be a requirement for
transformation that includes the simultaneous activation and repression
of proliferative and apoptotic pathways, respectively. Further studies
will be directed toward determining whether these abnormalities of gene expression represent transformation.
 |
FOOTNOTES |
Submitted January 7, 1998;
accepted March 6, 1998.
Supported by Grant No. DHP 176 from the American Cancer Society and by
the University of Pennsylvania Cancer Center Core Support Grant.
Address reprint requests to Robert Wasserman, MD, Division of Oncology,
The Children's Hospital of Philadelphia, 34th and Civic Center Blvd,
Philadelphia, PA 19104.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.
 |
ACKNOWLEDGMENT |
We thank T. Iwamato for the ret 02/1 cell line and the Eµ-ret
construct; C.H. Pletcher, S.-J. Jeong, and J.S. Moore for their technical assistance and the use of the Flow Cytometry and Cell Sorter
Facility of the University of Pennsylvania Cancer Center; S. Shinton
for technical assistance; and G.M. Brodeur for his advice and comments
on the manuscript.
 |
REFERENCES |
1.
Kersey JH:
Fifty years of studies of the biology and therapy of childhood leukemia.
Blood
90:4243,
1997[Free Full Text]
2.
Poplack DG:
Acute lymphoblastic leukemia
, in Pizzo PA,
Poplack DG
(eds):
Principles and Practice of Pediatric Oncology
Philadelphia, PA, Lippincott
, 1997
, p 409
3.
Pui CH:
Acute lymphoblastic leukemia.
Pediatr Clin North Am
44:831,
1997[Medline]
[Order article via Infotrieve]
4.
Look AT:
Oncogenic transcription factors in the human acute leukemias.
Science
278:1059,
1997[Abstract/Free Full Text]
5.
Harris AW,
Pinkert CA,
Crawford M,
Langdon WY,
Brinster RL,
Adams JM:
The E mu-myc transgenic mouse. A model for high-incidence spontaneous lymphoma and leukemia of early B cells.
J Exp Med
167:353,
1988[Abstract/Free Full Text]
6.
Sidman CL,
Shaffer DJ,
Jacobsen K,
Vargas SR,
Osmond DG:
Cell populations during tumorigenesis in Eu-myc transgenic mice.
Leukemia
7:887,
1993[Medline]
[Order article via Infotrieve]
7.
Jacobsen KA,
Prasad VS,
Sidman CL,
Osmond DG:
Apoptosis and macrophage-mediated deletion of precursor B cells in the bone marrow of E mu-myc transgenic mice.
Blood
84:2784,
1994[Abstract/Free Full Text]
8.
Chen J,
Alt FW:
Gene rearrangement and B-cell development.
Curr Opin Immunol
5:194,
1993[Medline]
[Order article via Infotrieve]
9.
Burrows PD,
Cooper MD:
B cell development and differentiation.
Curr Opin Immunol
9:239,
1997[Medline]
[Order article via Infotrieve]
10.
Hardy RR,
Carmack CE,
Shinton SA,
Kemp JD,
Hayakawa K:
Resolution and characterization of pro-B and pre-pro-B cell stages in normal mouse bone marrow.
J Exp Med
173:1213,
1991[Abstract/Free Full Text]
11.
Billips LG,
Lassoued K,
Nunez C,
Wang J,
Kubagawa H,
Gartland GL,
Burrows PD,
Cooper MD:
Human B-cell development.
Ann N Y Acad Sci
764:1,
1995[Medline]
[Order article via Infotrieve]
12.
Jennings CD,
Foon KA:
Recent advances in flow cytometry: Application to the diagnosis of hematologic malignancy.
Blood
90:2863,
1997[Free Full Text]
13.
Lu L,
Osmond DG:
Apoptosis during B lymphopoiesis in mouse bone marrow.
J Immunol
158:5136,
1997[Abstract]
14.
Wasserman R,
Li Y-S,
Hardy RR:
Differential expression of the blk and ret tyrosine kinases during B lineage development is dependent on Ig rearrangement.
J Immunol
155:644,
1995[Abstract]
15.
Goodfellow PJ,
Wells SA Jr:
RET gene and its implications for cancer.
J Natl Cancer Inst
87:1515,
1995[Abstract/Free Full Text]
16.
Eng C:
Seminars in medicine of the Beth Israel Hospital, Boston. The RET proto-oncogene in multiple endocrine neoplasia type 2 and Hirschsprung's disease.
N Engl J Med
335:943,
1996[Free Full Text]
17.
Iwamoto T,
Pu M,
Ito M,
Takahashi M,
Isobe K-I,
Nagase F,
Kawashima K,
Ichihara M,
Nakashima I:
Preferential development of pre-B lymphomas with drastically down-regulated N-myc in the Eµ-ret transgenic mice.
Eur J Immunol
21:1809,
1991[Medline]
[Order article via Infotrieve]
18.
Ichihara M,
Iwamoto T,
Isobe K,
Takahashi M,
Nakayama A,
Pu M,
Dai Y,
Parashar A,
Ohkus K,
Kato M,
Hotta T,
Nakashima I:
Oncogene-linked in situ immunotherapy of pre-B lymphoma arising in Eµ/ret transgenic mice.
Br J Cancer
71:808,
1995[Medline]
[Order article via Infotrieve]
19.
Wasserman R,
Li YS,
Hardy RR:
Down-regulation of terminal deoxynucleotidyl transferase by Ig heavy chain in B lineage cells.
J Immunol
158:1133,
1997[Abstract]
20.
Drews R,
Drohan WN,
Lubon H:
Transgene detection in mouse tail digests.
Biotechniques
17:866,
1994[Medline]
[Order article via Infotrieve]
21.
Ichihara Y,
Hayashida H,
Miyazawa S,
Kurosawa Y:
Only DFL16, DSP2, and DQ52 gene families exist in mouse immunoglobulin heavy chain diversity gene loci, of which DFL16 and DSP2 originate from the same primordial DH gene.
Eur J Immunol
19:1849,
1989[Medline]
[Order article via Infotrieve]
22.
Grawunder U,
Melchers F,
Rolink A:
Interferon-gamma arrests proliferation and causes apoptosis in stromal cell/interleukin-7-dependent normal murine pre-B cell lines and clones in vitro, but does not induce differentiation to surface immunoglobulin-positive B cells.
Eur J Immunol
23:544,
1993[Medline]
[Order article via Infotrieve]
23.
Wang J,
Lin Q,
Langston H,
Cooper MD:
Resident bone marrow macrophages produce type 1 interferons that can selectively inhibit interleukin-7-driven growth of B lineage cells.
Immunity
3:475,
1995[Medline]
[Order article via Infotrieve]
24.
Taniguchi M,
Iwamoto T,
Hamaguchi M,
Matsuyama M,
Takahashi M:
The ret oncogene products are membrane-bound glycoproteins phosphorylated on tyrosine residues in vivo.
Biochem Biophys Res Commun
181:416,
1991[Medline]
[Order article via Infotrieve]
25.
Taniguchi M,
Iwamato T,
Nakashima I,
Nakayama A,
Ohbayashi M,
Matsuyama M,
Takahashi M:
Establishment and characterization of a malignant melanocytic tumor cell line expressing the ret oncogene.
Oncogene
7:1491,
1992[Medline]
[Order article via Infotrieve]
26.
Hasegawa N,
Iwashita T,
Asai N,
Murakami H,
Iwata Y,
Isomura T,
Goto H,
Hayakawa T,
Takahashi MA:
RING finger motif regulates transforming activity of the rfp/ret fusion gene.
Biochem Biophys Res Commun
225:627,
1996[Medline]
[Order article via Infotrieve]
27.
Cao T,
Borden KL,
Freemont PS,
Etkin LD:
Involvement of the rfp tripartite motif in protein-protein interactions and subcellular distribution.
J Cell Sci
110:1563,
1997[Abstract]
28.
Valenzona HO,
Pointer R,
Ceredig R,
Osmond DG:
Prelymphomatous B cell hyperplasia in the bone marrow of interleukin-7 transgenic mice: Precursor B cell dynamics, microenvironmental organization and osteolysis.
Exp Hematol
24:1521,
1996[Medline]
[Order article via Infotrieve]
29.
Rico-Vargas SA,
Potter M,
Osmond DG:
Perturbation of B cell genesis in the bone marrow of pristane-treated mice. Implications for plasmacytoma induction.
J Immunol
154:2082,
1995[Abstract]
30.
Reichman-Fried M,
Bosma MJ,
Hardy RR:
B lineage cells in µ-transgenic scid mice proliferate in response to IL-7 but fail to show evidence of immunoglobulin light chain rearrangement.
Int Immunol
5:303,
1993[Abstract/Free Full Text]
31.
Spanopoulou E,
Roman CAJ,
Corcoran LM,
Schlissel MS,
Silver DP,
Nemazee D,
Nussenzweig MC,
Shinton SA,
Hardy RR,
Baltimore D:
Functional immunoglobulin transgenes guide ordered B-cell differentiation in Rag-1-deficient mice.
Genes Dev
8:1030,
1994[Abstract/Free Full Text]
32.
Young F,
Ardman B,
Shinkai Y,
Lansford R,
Blackwell TK,
Mendelsohn M,
Rolink A,
Melchers F,
Alt FW:
Influence of immunoglobulin heavy- and light-chain expression on B-cell differentiation.
Genes Dev
8:1043,
1994[Abstract/Free Full Text]
33.
Ehlich A,
Martin V,
Muller W,
Rajewsky K:
Analysis of the B-cell progenitor compartment at the level of single cells.
Curr Biol
4:573,
1994[Medline]
[Order article via Infotrieve]
34.
Osmond DG,
Rico-Vargas S,
Valenzona H,
Fauteux L,
Liu L,
Janani R,
Lu L,
Jacobsen K:
Apoptosis and macrophage-mediated cell deletion in the regulation of B lymphopoiesis in mouse bone marrow.
Immunol Rev
142:209,
1994[Medline]
[Order article via Infotrieve]
35.
Yang E,
Korsmeyer SJ:
Molecular thanatopsis: A discourse on the BCL2 family and cell death.
Blood
88:386,
1996[Free Full Text]
36.
Fang W,
Mueller DL,
Pennell CA,
Rivard JJ,
Li YS,
Hardy RR,
Schlissel MS,
Behrens TW:
Frequent aberrant immunoglobulin gene rearrangements in pro-B cells revealed by a bcl-xL transgene.
Immunity
4:291,
1996[Medline]
[Order article via Infotrieve]
37.
McDonnell TJ,
Deane N,
Platt FM,
Nunez G,
Jaeger U,
McKearn JP,
Korsmeyer SJ:
bcl-2-immunoglobulin transgenic mice demonstrate extended B cell survival and follicular lymphoproliferation.
Cell
57:79,
1989[Medline]
[Order article via Infotrieve]
38.
Strasser A,
Harris AW,
Cory S:
E mu-bcl-2 transgene facilitates spontaneous transformation of early pre-B and immunoglobulin-secreting cells but not T cells.
Oncogene
8:1,
1993[Medline]
[Order article via Infotrieve]
39.
Schuchardt A,
D'Agati V,
Larsson-Blomberg L,
Constantini F,
Pachnis V:
Defects in the kidney and enteric nervous system of mice lacking the tyrosine kinase receptor Ret.
Nature
367:380,
1994[Medline]
[Order article via Infotrieve]
40.
Sanchez MP,
Silos-Santiago I,
Frisen J,
He B,
Lira SA,
Barbacid M:
Renal agenesis and the absence of enteric neurons in mice lacking GDNF.
Nature
382:70,
1996[Medline]
[Order article via Infotrieve]
41.
Gattei V,
Celetti A,
Cerrato A,
Degan M,
De Iuliis A,
Rossi FM,
Chiappetta G,
Consales C,
Improta S,
Zagonel V,
Aldinucci D,
Agosti V,
Santoro M,
Vecchio G,
Pinto A,
Grieco M:
Expression of the RET receptor tyrosine kinase and GDNFR-alpha in normal and leukemic human hematopoietic cells and stromal cells of the bone marrow microenvironment.
Blood
89:2925,
1997[Abstract/Free Full Text]
42.
Alzona M,
Jack HM,
Fisher RI,
Ellis TM:
IL-12 activates IFN-gamma production through the preferential activation of CD30+ T cells.
J Immunol
154:9,
1995[Abstract]
43.
Locksley RM:
Interleukin 12 in host defense against microbial pathogens.
Proc Natl Acad Sci USA
90:5879,
1993[Free Full Text]
44.
Wang J,
Walker H,
Lin Q,
Jenkins N,
Copeland NG,
Watanabe T,
Burrows PD,
Cooper MD:
The mouse BP-1 gene: Structure, chromosomal localization, and regulation of expression by type I interferons and interleukin-7.
Genomics
33:167,
1996[Medline]
[Order article via Infotrieve]
45.
Welch PA,
Burrows PD,
Namen A,
Gillis S,
Cooper MD:
Bone marrow stromal cells and interleukin-7 induce coordinate expression of the BP-1/6C3 antigen and pre-B cell growth.
Int Immunol
2:697,
1990[Abstract/Free Full Text]
46.
Sherwood PJ,
Weissman IL:
The growth factor IL-7 induces expression of a transformation-associated antigen in normal pre-B cells.
Int Immunol
2:399,
1990[Abstract/Free Full Text]
47.
Sherr CJ:
Cancer cell cycles.
Science
274:1672,
1996[Abstract/Free Full Text]
48. (suppl 2)
Meusers P,
Hense J,
Brittinger G:
Mantle cell lymphoma: Diagnostic criteria, clinical aspects and therapeutic problems.
Leukemia
11:S60,
1997
49.
Bodrug SE,
Warner BJ,
Bath ML,
Lindeman GJ,
Harris AW,
Adams JM:
Cyclin D1 transgene impedes lymphocyte maturation and collaborates in lymphomagenesis with the myc gene.
EMBO J
13:2124,
1994[Medline]
[Order article via Infotrieve]
50.
Lovec H,
Grzeschiczek A,
Kowalski MB,
Moroy T:
Cyclin D1/bcl-1 cooperates with myc genes in the generation of B-cell lymphoma in transgenic mice.
EMBO J
13:3487,
1994[Medline]
[Order article via Infotrieve]
51.
Corcoran AE,
Smart FM,
Cowling RJ,
Crompton T,
Owen MJ,
Venkitaraman AR:
The interleukin-7 receptor alpha chain transmits distinct signals for proliferation and differentiation during B lymphopoiesis.
EMBO J
15:1924,
1996[Medline]
[Order article via Infotrieve]
52.
Danial NN,
Pernis A,
Rothman PB:
Jak-STAT signaling induced by the v-abl oncogene.
Science
269:1875,
1995[Abstract/Free Full Text]
53.
Cohen GM:
Caspases: The executioners of apoptosis.
Biochem J
326:1,
1997
54.
Hayakawa K,
Li YS,
Wasserman R,
Sauder S,
Shinton S,
Hardy RR:
B lymphocyte developmental lineages.
Ann N Y Acad Sci
815:15,
1997[Medline]
[Order article via Infotrieve]
55.
Kuida K,
Lippke JA,
Ku G,
Harding MW,
Livingston DJ,
Su MS,
Flavell RA:
Altered cytokine export and apoptosis in mice deficient in interleukin-1 beta converting enzyme.
Science
267:2000,
1995[Abstract/Free Full Text]
56.
Bras A,
Martinez AC,
Baixeras E:
B cell receptor cross-linking prevents Fas-induced cell death by inactivating the IL-1 beta-converting enzyme protease and regulating Bcl-2/Bcl-x expression.
J Immunol
159:3168,
1997[Abstract]
57.
Li P,
Allen H,
Banerjee S,
Franklin S,
Herzog L,
Johnston C,
McDowell J,
Paskind M,
Rodman L,
Salfeld J,
Towne E,
Tracey D,
Wardwell S,
Wei FY,
Wong W,
Kamen R,
Seshadri T:
Mice deficient in IL-1 beta-converting enzyme are defective in production of mature IL-1 beta and resistant to endotoxic shock.
Cell
80:401,
1995[Medline]
[Order article via Infotrieve]
58.
Ghayur T,
Banerjee S,
Hugunin M,
Butler D,
Herzog L,
Carter A,
Quintal L,
Sekut L,
Talanian R,
Paskind M,
Wong W,
Kamen R,
Tracey D,
Allen H:
Caspase-1 processes IFN-gamma-inducing factor and regulates LPS-induced IFN-gamma production.
Nature
386:619,
1997[Medline]
[Order article via Infotrieve]
59.
Gu Y,
Kuida K,
Tsutsui H,
Ku G,
Hsiao K,
Fleming MA,
Hayashi N,
Higashino K,
Okamura H,
Nakanishi K,
Kurimoto M,
Tanimoto T,
Flavell RA,
Sato V,
Harding MW,
Livingston DJ,
Su MS:
Activation of interferon-gamma inducing factor mediated by interleukin-1beta converting enzyme.
Science
275:206,
1997[Abstract/Free Full Text]

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
A. B. Eberle, K. Herrmann, H.-M. Jack, and O. Muhlemann
Equal transcription rates of productively and nonproductively rearranged immunoglobulin {micro} heavy chain alleles in a pro-B cell line
RNA,
June 1, 2009;
15(6):
1021 - 1028.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. I. Brown, J. Hulitt, J. Fish, C. Sheen, M. Bruno, Q. Xu, M. Carroll, J. Fang, D. Teachey, and S. A. Grupp
Thymic Stromal-Derived Lymphopoietin Induces Proliferation of Pre-B Leukemia and Antagonizes mTOR Inhibitors, Suggesting a Role for Interleukin-7R{alpha} Signaling
Cancer Res.,
October 15, 2007;
67(20):
9963 - 9970.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. L. McCormick and R. Kavet
Animal Models for the Study of Childhood Leukemia: Considerations for Model Identification and Optimization to Identify Potential Risk Factors
International Journal of Toxicology,
May 1, 2004;
23(3):
149 - 161.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. W. Verschuren, J. G. Hodgson, J. W. Gray, S. Kogan, N. Jones, and G. I. Evan
The Role of p53 in Suppression of KSHV Cyclin-induced Lymphomagenesis
Cancer Res.,
January 15, 2004;
64(2):
581 - 589.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. I. Brown, J. Fang, K. Alcorn, R. Barr, J. M. Kim, R. Wasserman, and S. A. Grupp
Rapamycin is active against B-precursor leukemia in vitro and in vivo, an effect that is modulated by IL-7-mediated signaling
PNAS,
December 9, 2003;
100(25):
15113 - 15118.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Kim, J. Fang, S. Rheingold, R. Aplenc, R. Wasserman, and S. A. Grupp
Cytoplasmic {micro} Heavy Chain Confers Sensitivity to Dexamethasone-induced Apoptosis in Early B-lineage Acute Lymphoblastic Leukemia
Cancer Res.,
August 1, 2002;
62(15):
4212 - 4216.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X.-X. Zeng, H. Zhang, R. R. Hardy, and R. Wasserman
The Fetal Origin of B-Precursor Leukemia in the Eľ-ret Mouse
Blood,
November 15, 1998;
92(10):
3529 - 3536.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|