|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 92 No. 1 (July 1), 1998:
pp. 32-39
Perturbed Granulopoiesis in Mice With a Targeted Mutation in
the Granulocyte Colony-Stimulating Factor Receptor Gene Associated
With Severe Chronic Neutropenia
By
Mirjam H.A. Hermans,
Alister C. Ward,
Claudia Antonissen,
Alar Karis,
Bob Löwenberg, and
Ivo P. Touw
From the Institute of Hematology, Daniel den Hoed Cancer Center and
Erasmus University Rotterdam; and the Department of Cell Biology and
Genetics, Erasmus University Rotterdam, Rotterdam, The Netherlands.
 |
ABSTRACT |
Mutations in the granulocyte colony-stimulating factor
(G-CSF) receptor gene are found in a number of
patients with severe chronic neutropenia predisposed to acute myeloid
leukemia. These mutations result in the absence of the C-terminal
domain of the G-CSF-R, a region which has been implicated in
differentiation signaling. We generated mice with an equivalent
mutation (gcsfr- 715) by homologous and Cre-mediated
recombination in embryonic stem cells. Both wt/715 and
715/715 mice have significantly reduced numbers of blood
neutrophils compared with their wt/wt littermates. However,
under continuous G-CSF administration mutant mice develop peripheral
neutrophil counts that significantly exceed those of wild-type
littermates. These findings indicate that depending on G-CSF levels in
mice, the 715 mutation can contribute both to neutropenia
and to neutrophilia.
| |
INTRODUCTION |
THE PRODUCTION of neutrophilic
granulocytes is regulated by a range of cytokines, including stem cell
factor (SCF), interleukin-3 (IL-3), granulocyte-macrophage
colony-stimulating factor (GM-CSF), IL-6 and G-CSF. Studies in mice
deficient for these cytokines have established that G-CSF is the major
regulator of neutrophil production.1-3 G-CSF mediates its
effects through activation of its cognate receptor (G-CSF-R), a
single-transmembrane protein of the hematopoietin or cytokine receptor
class I superfamily.4-6 Whereas the membrane-proximal
cytoplasmic region of G-CSF-R is essential for transduction of
mitogenic signals in murine cell lines,6,7 induction of
neutrophilic differentiation requires the integrity of the
membrane-distal C-terminal region.7-9
Like all members of the hematopoietin receptor superfamily, G-CSF-R
lacks intrinsic tyrosine kinase activity but activates tyrosine kinases
of the JAK family that associate to the membrane proximal cytoplasmic
region of the receptor.10,11 The JAKs then tyrosine
phosphorylate STAT (signal transducer and activator of transcription)
proteins, which form dimeric or oligomeric complexes and translocate to
the nucleus, where they induce gene transcription.12
Severe chronic neutropenia (SCN) is a disease with a variable
inheritance, characterized by a profound shortage of circulating neutrophils (<0.2 × 109 neutrophils/L compared with
4 × 109/L in normal individuals).13
Consequently, SCN patients suffer from frequent episodes of
opportunistic bacterial infections. In the majority of SCN patients,
treatment with G-CSF results in increased peripheral neutrophil counts
and a reduction of infection-related events.13 The
molecular defects underlying SCN are largely unknown but are thought to
affect the G-CSF responsiveness of neutrophilic progenitor cells rather
than G-CSF production.14 Importantly, approximately 10% to
15% of SCN patients develop acute myeloid leukemia
(AML).15 Recently, cases of SCN have been identified with
acquired mutations in the GCSFR gene.16,17 These
mutations introduce stop codons in a critical region between codons 714 and 732, resulting in the truncation of 82 to 98 C-terminal amino acids. Upon enforced expression in murine
myeloid cell lines, these truncated G-CSF-R consistently fail to
transduce differentiation signals and interfere with differentiation
induced via the wild-type G-CSF-R in a dominant negative
manner.16,17 In contrast, proliferation signaling by
G-CSF-R is enhanced as a result of the truncation. To date, of 59 SCN
patients investigated, 16 harbored GCSFR point mutations.18 Importantly, all eight patients from this
series who developed AML had GCSFR mutations, which were
invariably present in the leukemic cells.
To study the contribution of GCSFR mutations to the
pathogenesis of SCN and AML, and to gain further insight in the role of the G-CSF-R C-terminus on neutrophil development, we have generated an
in vivo model by introducing a nonsense mutation at codon 715 (gcsfr- 715) in mice. We show that
wt/715 and 715/715 mice have
reduced numbers of circulating neutrophils as compared with their
wt/wt littermates. However, after daily administration
of pharmacological doses of G-CSF, the numbers of circulating
neutrophils in mutant mice increase and significantly exceed those of
the wild-type littermates. Thus, in mice, the gcsfr-715
mutation contributes to a neutropenic state under basal G-CSF levels
and to neutrophilia at pharmacological dosages of G-CSF.
| |
MATERIALS AND METHODS |
Cells and culture.
Embryonic stem (ES) cells (ES-E14), a gift from M. Hooper (Edinburgh,
UK), were cultured as described.19 In short, cells were
kept in culture medium consisting of Dulbecco's Modified Eagle's
Medium (DMEM; GIBCO-BRL, Breda, The Netherlands), 50% Buffalo rat
liver-conditioned medium, 10% fetal calf serum (FCS) (ES-qualified;
GIBCO-BRL) supplemented with 1% nonessential amino acids (GIBCO-BRL),
0.1 mmol/L 2-mercaptoethanol (Sigma Chemical Co, St Louis, MO), 100 U/mL penicillin, 100 µg/mL streptomycin (GIBCO-BRL), and 1,000 U/mL
leukemia inhibitory factor (LIF; GIBCO-BRL) in dishes coated with 0.1%
gelatin (Sigma G-1890). The cells were passaged every 2 to 3 days.
Targeting constructs and probes.
Isolation, cloning, and sequencing of genomic DNA were done according
to standard procedures.20 Genomic DNA was isolated from a
mouse 129SV/Cosmid library (Cosmid SC1-6 SuperCos 1; Stratagene Cloning
Systems, La Jolla, CA). Using a mouse exon 17 cDNA probe, a clone
spanning a genomic fragment from exon 5 to 17 of gcsfr was
isolated.21 To introduce a stop codon at Gln715 and an
EcoRV site in exon 17, a 300-bp EcoNI-Xba I
fragment of exon 17 was synthesized by polymerase chain reaction (PCR)
using standard site-directed mutagenesis (CCA AGA GAA ATT TCC AAC CAG
TCC CAG = amino acids PREISNQSQ to CCA AGA GAG ATA TCC AAC TAG TCC CAG = amino acids PREISNstopSQ). This mutated fragment was cloned into
pBluescript (pBs), confirmed by sequence analysis, and enlarged to 6.2 kb by insertion of a 1.4-kb Sma I-EcoNI fragment at the 5 end and a 4.5-kb Xba I fragment at the 3 end to
produce pEUR9. A cassette, containing a thymidine kinase (TK) gene
driven by a herpes simplex virus promoter (HSV-TK) and a neomycin
(PGK-Neo) gene driven by a phosphoglycerate kinase promoter (gifts from B. Malissen, Marseille, France), was flanked by LoxP sites and introduced into the Spe I site of pEUR9,
generating pEUR10 (Fig 1A). A unique
Not I site in the vector backbone was used for linearization before transfection. The Cre-expressing vector (pMC-Cre) was a gift
from K. Rajewsky (Institute for Genetics, University of Cologne, Germany). Probes to screen for homologous recombination were obtained by PCR from genomic DNA using the primers CTCCTCCTCATGCTCCAGCGCTG and CTAGGGTCCTCAGGGTAAGGCCTG (Fig 1, probe a), and
CCAGACCCAGCCCACAGTAGC and GGCAGGGTCTTCAAGATACAAGG (Fig 1, probe b).
View larger version (21K):
[in this window]
[in a new window]
| Fig 1.
Introduction of the 715 mutation in the
gcsfr gene by homologous and Cre-mediated recombination. (A)
Genomic constructs and targeting strategy. Shown from top to bottom are
DNA structures of the germ line gene to be mutated, the targeting
construct, the predicted homologous recombinant, and the deletion
product generated by the Cre enzyme. For the first targeting event, an external probe covering exon 13 and 14 (probe a) was used to screen colonies. Southern analysis of EcoRV digests of genomic DNA
detects an 8-kb band from the wild-type allele and a 5-kb
band from the targeted allele. A 13-kb band derived from an intronless
gcsfr-pseudogene present in the murine genome21 was
also observed. For the second targeting event, a probe covering exon 17 (probe b) was used to screen colonies which gives bands of 13 kb, 8 kb,
4.8 kb, and 3.2 kb for the pseudogene, wild-type allele, targeted
allele and Cre-recombined allele, respectively. B, BamHI; E,
EcoRV; H, HindIII; S, Sma I; X, Xba I. (B) Southern blot analysis of EcoRV digests of genomic DNA from
ES cells using probe b on a wild-type clone (lane 1), a homologous
recombined clone (lane 2), and a subsequent Cre-recombined clone (lane
3), showing the predicted sizes.
|
|
Introduction of gcsfr-715 by homologous
recombination.
E14 ES cells (107) were transfected with 25 µg linearized
pEUR10 by electroporation using a Progenetor II, PG200 Hoefer Gene pulser (Hoefer Scientific Instruments, San Francisco, CA) set at 350 V/cm, 1,200 µF, 10 ms. The next day, cells were transferred to
culture medium containing 200 µg/mL G418 (GIBCO-BRL), with G418-resistant colonies picked on day 6 or 7 after electroporation. Genomic DNA of these colonies was digested with EcoRV,
transferred to nylon membranes, and hybridized to probes a and b and
neo. Correctly targeted clones were subjected to cytogenetic
analysis and clones with a normal karyotype were used for the second
targeting step to remove the Neo-Tk cassette. To this end,
107 cells were transfected with 25 µg of Cre-encoding
plasmid DNA by electroporation as described above. Two days later, the
cells were resuspended at densities of 1 to 5 × 106
cells per plate. From day 6 to 10, cells were cultured in the presence
of 2 µmol/L ganciclovir (Syntex, Puteaux, France), and resistant
colonies were picked on day 13. Genomic DNA, digested with
EcoRV and BamHI, was analyzed by Southern blot using
probe a, b, and neo to select clones in which the Neo-Tk
cassette had been excised correctly.
Generation of gcsfr mutant mice.
ES cell clones with the gcsfr-715 mutation showing a
normal karyotype were injected into blastocysts of C57BL/6 mice. The resulting male chimeras were mated to FVB females to generate heterozygous mutant and wild-type F1 mice. Heterozygous
wt/715 mice were intercrossed to obtain
gcsfr-715/715 mice. DNA was isolated from
tail segments and analyzed on Southern blots as described above.
Blood and bone marrow (BM) sampling.
Blood samples were collected either from the tail vein or from the
retro-orbital venous plexus at fixed time points to avoid variation due
to circadian rhythms.22 Blood cell counts were performed on
a Sysmex-K1000X automated counter (Toa Medical Electronics Co Ltd,
Kobe, Japan). To obtain enriched white blood cell suspensions, erythrocytes were lyzed in ice-cold isotonic NH4Cl solution
(0.15 mol/L NH4Cl, 10 mmol/L KHCO3, 0.1 mmol/L
EDTA pH 7.4) for 10 minutes, spun down, and resuspended in Hanks'
balanced salt solution (HBSS)/10% FCS. To obtain BM cell suspensions,
femurs and tibias were crushed in a mortar in HBSS/10% FCS. Cells were
passed through a 100-µm sieve, spun down, and resuspended, resulting
in monocellular suspensions containing 98% to 99% viable cells, as
determined by trypan blue exclusion. For differential countings, blood
and BM smears or cytospins were fixed in methanol,
May-Grünwald-Giemsa (MGG) stained. Three hundred blood cells or
500 BM cells were analyzed in a Zeiss Axioscope microscope (Carl Zeiss
B.V., Weesp, The Netherlands).
Progenitor cell assays.
BM cells were prepared as described above. Cells were plated at a
density of 2 × 104 cells per mL per dish in
triplicate in methyl cellulose medium (Methocult M3230; StemCell
Technologies Inc,Vancouver, BC, Canada) containing 30% fetal bovine
serum (FBS), 1% bovine serum albumin (BSA), 0.1 mmol/L
2-mercaptoethanol, 2 mmol/L L-glutamine with increasing
concentrations of G-CSF (Amgen, Thousand Oaks, CA). Colony formation
was monitored on days 7-8 of culture. Colonies containing 30 cells or
more were scored. Cytological examination of colony cells was performed
on MGG-stained cytospins.
Flow cytometric and Western blot analysis of G-CSF-R.
Expression levels of G-CSF-R on neutrophilic cells were measured by
flow cytometry. To this end, G-CSF was biotinylated using D-biotinoyl- -aminocaproic acid-N-hydroxysuccinimide ester
(Biotin-7-NHS; Boehringer, Mannheim, Germany). Free biotin was removed
by gel-filtration on Sephadex G-25. BM cells (106) were
incubated in 96-well plates for 60 minutes at room temperature in 25 µL PBA (phosphate-buffered saline with 1% BSA and 0.1%
NaN3) and 0.2 µg/mL biotinylated G-CSF, either in the
absence or the presence of a 100-fold molar excess of nonbiotinylated
G-CSF. Subsequently, cells were incubated for 30 minutes at 4°C
with phycoerythrin-conjugated streptavidin (SA-PE; Caltag Laboratories, Burlingame, CA). Cells were subjected to flow cytometric analysis on a
FACScan (Becton Dickinson, Sunnyvale, CA). A window was set on the
basis of forward and sideward light scatter to restrict the analysis to
neutrophilic cells. Western blot analysis was performed according to
established procedures, using rabbit antisera against the C-terminal
region of murine G-CSF-R (sc-694; Santa Cruz Biotechnology Inc, Santa
Cruz, CA) and STAT3 (sc-482; Santa Cruz).
BrdU incorporation in blood neutrophils.
Mice were injected subcutaneously with 250 µg/kg G-CSF for 6 days. On
day 4, 150 µL of 5-bromo-2'-deoxyuridine (BrdU) (Sigma; 10 µg/mL
in phosphate-buffered saline [PBS]) was injected intraperitoneally. Blood smears were made at various times and stained for BrdU according to standard procedures using a mouse monoclonal antibody (MoAb) against
BrdU (kindly provided by W. Dinjens, Department of Pathology, Erasmus
University, Rotterdam, The Netherlands) and fluorescein isothiocyanate
(FITC)-conjugated goat-anti-mouse-Ig(H+L). The percentage of
BrdU+ neutrophils was determined on a Zeiss Axioscope
microscope using combined phase contrast illumination to recognize
neutrophils on the basis of their segmented nuclei and fluorescence
microscopy using a filter-set for FITC-detection.
| |
RESULTS |
Generation of gcsfr-715 mice.
The region of GCSFR subject to mutations in SCN is located in
exon 17 and contains 5 Gln residues (716, 718, 720, 726, and 731), the
codons of which (CAA or CAG) are changed into stop codons by C-to-T
substitutions (TAA or TAG).17 The most frequent mutation in
SCN involves Gln 716, which is equivalent to Gln715 in mice. A
gcsfr-715 mutation to change Gln715 into a stop
codon was generated using PCR, with an additional EcoRV site
created by two silent mutations to facilitate analysis. To introduce
the gcsfr-715 mutation into ES cells, and to
subsequently remove the Neo-Tk selection cassette, we used a two-step
gene-targeting strategy as outlined in Fig 1A. In the first step, about
one in three clones showed homologous recombination (Fig 1B, lane 2),
and after Cre-excision, 90% of the clones were recombined (Fig 1B,
lane 3). Two independently isolated ES cell clones were injected into
blastocysts and the resulting chimeric mice were crossed with FVB-mice.
Germ line transmission of the mutant allele was detected for one of the two clones. When heterozygous wt/715 mice were
intercrossed, about 25% of the F2 animals carried the mutation on both
alleles, indicating that viability was not compromised by the mutation. Both wt/715 and 715/715
animals developed normally, and no differences in weight, size, or
fertility were observed. Southern blot analysis of tail-DNA from mice
(Fig 2A) and nucleotide sequence analysis
(Fig 2B) showed the presence and correct positioning of the mutation.
Flow cytometric analysis of BM neutrophils using biotinylated G-CSF
(Fig 2C) indicated that full-length and truncated G-CSF-R proteins are
expressed at equal densities. Western blot analysis with antibodies
reactive with the G-CSF-R C-terminus (Fig 2D) confirmed the absence of
the C-terminus in 715/715 mice.
View larger version (50K):
[in this window]
[in a new window]
View larger version (28K):
[in this window]
[in a new window]
View larger version (15K):
[in this window]
[in a new window]
| Fig 2.
Transmission and expression of mutant G-CSF-R. (A)
Southern blot of EcoRV digests of tail DNA from a
wt/wt mouse (lane 1), a wt/715 mouse
(lane 2), and a 715/715 mouse (lane 3) hybridized with probe b (Fig 1). (B) Nucleotide sequence analysis of PCR-amplified genomic DNA from a wt/wt and a
715/715 mouse cloned in pBs. The sequence of the
715-derived clone shows the C-to-T substitution changing CAG
(Gln715) into TAG (stop715) and the silent base pair substitutions that
generated the EcoRV site (GATATC). (C) Flow cytometry analysis
of biotinylated G-CSF binding to BM cells from wt/wt,
wt/715, and 715/715 mice.
Cells were incubated in the absence (solid line) or presence (broken
line) of a 100-fold molar excess of nonlabeled G-CSF followed by
incubation with PE-conjugated streptavidin. (D) Western blot analysis
of 1 × 106 BM cells from wt/wt and
715/715 mice using a rabbit antiserum raised
against the 20 C-terminal amino acids of the murine G-CSF-R. The three
bands indicated with arrows represent the different glycosylation forms
of murine G-CSF-R5; their absence in the
715/715 lanes indicates that the C-terminus is
truncated in the mutant mice. Reprobing with anti-STAT3 confirms equivalent loading in both lanes.
|
|
Numbers of circulating neutrophils are reduced in
gcsfr-715 mice.
Analysis of peripheral blood samples showed that the average number of
circulating neutrophils was significantly reduced in both homozygous
and heterozygous mutant mice, ie, approximately 60% lower in
715/715 mice and 30% to 40% lower in
wt/715 as compared to wt/wt animals
(Fig 3). In contrast, other blood cell lineages were not affected by the mutation. Cellularity per bone and
the frequencies myelomonocytic cells at various stages of maturation
(Table 1) were similar in all genotypes,
suggesting that the C-terminal truncation of G-CSF-R does not result in
an early block of myeloid maturation in BM. Granulocyte colony-forming cells (CFU-G) were not reduced but slightly elevated in
715/715 mice as compared with
wt/wt animals, and G-CSF concentrations required to
reach maximal colony formation were similar
(Fig 4). The CFU-G colonies of all
genotypes contained morphologically mature neutrophils (data not
shown).
View larger version (27K):
[in this window]
[in a new window]
| Fig 3.
Numbers of circulating blood cells. Blood was collected
from tail veins of 5- to 6-week-old mice and analyzed. Data are the means of 27 wt/wt ( ), 40 wt/715
( ), and 29 715/715 ( ) mice and error bars
indicate standard error of mean. eo, eosinophils × 107/L;
mo, monocytes × 107/L; ly, lymphocytes × 109/L; neu, neutrophils × 108/L; plt,
platelets × 1011/L; ery, erythrocytes × 1012/L.
|
|
View larger version (21K):
[in this window]
[in a new window]
| Fig 4.
G-CSF-induced colony growth in vitro. BM cells were
plated in methylcellulose-containing media supplemented with various
quantities of G-CSF. Hematopoietic colonies containing 30 cells or more
were scored after 7 to 8 days. Data are the means of four animals for each genotype and error bars represent standard deviation.
gcsfr-wt/wt, (); gcsfr-wt/715, ( );
gcsfr-715/715, ().
|
|
G-CSF treatment induces a hyperproliferative response in
gcsfr-715 mice.
We then evaluated the in vivo responses of the mutant mice to daily
injections of G-CSF (250 µg/kg) for 7 days
(Fig 5). On day 2, blood neutrophil numbers
of the mutant mice reached levels comparable to wt/wt
mice. Thereafter, the numbers of blood neutrophils began to
significantly exceed those of wild-type controls. On day 7, average
peripheral neutrophil counts of wt/715 and
715/715 mice were threefold to fourfold higher
than those of wt/wt animals (Fig 5). In a separate
experiment, in which 715/715 (n = 4) and
wt/wt mice (n = 4) received G-CSF daily for 21 days,
the average peripheral blood neutrophil counts in mutant mice increased
to 200 × 106/mL versus 22 × 106/mL
in wild-type mice.
View larger version (20K):
[in this window]
[in a new window]
| Fig 5.
Neutrophil counts in mice treated with G-CSF. Mice were
injected subcutaneously with G-CSF (250 µg/kg/d) for 7 days. Blood was collected daily and analyzed as described in Materials and Methods.
Data are from 7 to 11 animals for each genotype. Error bars represent
standard error of mean. gcsfr-wt/wt, ();
gcsfr-wt/715, (); gcsfr-715/715, ().
|
|
In the BM, an overall increase was seen in the percentage of
neutrophilic cells after G-CSF treatment (Table 1), as has been described before.23 In contrast to wt/wt mice,
which were similar to wt/715 mice, 715/715
mice showed a clear elevation in the early stages of neutrophilic
development.
To investigate whether increased production of neutrophils could be the
cause of the neutrophilia in G-CSF-treated mutant mice, we measured
proliferative responses in vivo by means of BrdU. The numbers of
BrdU-labeled neutrophils generated in G-CSF-treated wt/715 and 715/715 mice
significantly exceeded those of the wild-type controls
(Fig 6). These data indicate that myeloid
precursors of both heterozygous and homozygous mutant animals show a
hyperproliferative response to G-CSF.
View larger version (21K):
[in this window]
[in a new window]
| Fig 6.
In vivo BrdU incorporation in blood neutrophils of
G-CSF-treated mice. Mice (n = 3 for each genotype) were injected
daily with G-CSF. After 4 days, 150 µL of BrdU (10 µg/mL in PBS)
was injected intraperitoneally and blood was collected and analyzed at
various times. Smears were made for May-Grünwald Giemsa and BrdU
staining. Error bars represent standard deviation. gcsfr-wt/wt, (); gcsfr-wt/715, (); gcsfr-715/715,
().
|
|
| |
DISCUSSION |
Mutations in the GCSFR gene truncating the C-terminal region of
the receptor protein are found in a minority (about 15% to 20%) of
SCN patients. However, because cases with disease progression to AML
almost invariably harbor GCSFR mutations, this category of
patients is of particular clinical importance. In addition, while
previous studies have established that the C-terminal region of the
G-CSF-R is required for G-CSF-induced neutrophilic differentiation in
cell lines, the functional consequences of the mutations for neutrophil
development in vivo and their potential role in leukemogenesis have
remained unclear. To directly address these issues, we developed a
mouse model in which we introduced an equivalent gcsfr
mutation (715) by homologous and Cre-mediated
recombination.
The gcsfr-715 mutation resulted in reduced basal neutrophil
levels, but there was no significant reduction in numbers of band and
segmented neutrophils, neutrophil precursors, and in vitro
colony-forming progenitor cells in the BM. This suggests that
truncation of the G-CSF-R C-terminus affects neutrophil development at
a late stage of maturation, resulting in an impaired transit from BM
segmented cell to circulating neutrophil. In contrast to the full
gcsfr-knock out, in which heterozygous mice have normal neutrophil levels in the blood, mice heterozygous for the
715 mutation had numbers of circulating neutrophils
intermediate to homozygous and wild-type animals. These findings show
that truncated G-CSF-R proteins interfere with the
differentiation-inducing function of wild-type G-CSF-R in a
dominant-negative manner. In myeloid cell lines (32D or L-GM),
mitogenic signaling from G-CSF-R is greatly enhanced as a result of
truncation of the C-terminal region.7 Our in vivo data of
mice treated with G-CSF essentially show a similar phenomenon. The
observation that continuous G-CSF administration induced a
hyperproliferation in both heterozygous and homozygous mice indicates
that truncated receptors also here dominate over wild-type receptors.
In view of the increased neutrophil production in G-CSF-treated mutant
mice, it remains somewhat puzzling as to why nontreated mutant mice
have reduced levels of mature neutrophils in their blood. A possible
explanation is that in vivo the absence of the C-terminal domain
impairs differentiation only at low concentrations of G-CSF. The fact
that no difference between 715/715 and wt/wt mice
is found in the neutrophilic compartment in BM suggests that a late
maturation defect or an impaired transition of BM neutrophils to blood
is responsible for the neutropenia. However, when more receptors are
crosslinked, a threshold might be reached by which a differentiation
signal overcomes other signaling events so that the BM neutrophils
enter the bloodstream. Alternatively, high levels of G-CSF might be
responsible for the transition of relatively immature BM neutrophils to
blood.
Much effort is currently being directed at the elucidation of the
signal transduction mechanisms activated by hematopoietin receptors and
their contribution to different cellular responses, such as
proliferation, differentiation, and cell survival. Multiple signaling
events are activated via distinct intracellular subdomains of these
receptors. An important question that arises is whether these signaling
mechanisms exert instructive functions in the regulation of
differentiation or merely control proliferation and survival of cells
that are already programmed to differentiate.24 Evidence in
support of a differentiation regulatory function of hematopoietin
receptors has come from a variety of in vitro studies demonstrating
that in certain receptors distinct cytoplasmic subdomains exist that
are indispensable for induction of differentiation but not for
transduction of mitogenic signals.7,8,25,26 32D cells with
truncated G-CSF-R, in the absence or presence of wild-type receptors,
do not differentiate in response to G-CSF, but continue proliferation,
while 32D cells with only wild-type receptors mature into segmented
neutrophil. We found that BM cells expressing truncated G-CSF-R
differentiated in vitro to morphologically mature neutrophils in
response to G-CSF. This difference could be linked to the fact that 32D
cells are immortilized and that some mechanisms inducing
differentiation are not strong enough in these cells to overcome the
proliferation signal. Alternatively, primary cells lacking the
C-terminus of G-CSF-R may have alternative stimuli driving their
differentiation into neutrophil which are not present in 32D cells.
Our model has established that, under basal conditions, truncation of
the G-CSF-R does give rise to neutropenia. Importantly, in view of the
fact that only one allele is affected in SCN patients, heterozygous
mice also showed reduced neutrophil levels. However, the neutropenia
seen in these mice is not as severe as in SCN. A possible explanation
for this is that the alternative mechanisms controlling neutrophil
development in mice are not, or less efficiently, operational in
humans. A similar discrepancy has been noted in X-linked immune disease
involving the Bruton's tyrosine kinase gene.27
Alternatively, the GCSFR mutation by itself may not be
sufficient to cause a severe neutropenia because multiple genetic defects are required to attain the full SCN phenotype.
In the SCN patients evaluated to date, GCSFR mutations had been
acquired and were restricted to the granulocytic lineage. Thus,
neutrophilic progenitor cells harboring GCSFR mutations attained the ability to clonally expand, which likely reflects an early
step in leukemogenesis. The hyperproliferation of neutrophil precursor
cells in 715 mice may explain the vast clonal expansion of
mutant cells in patients. The majority of patients with neutropenia, including those harboring GCSFR mutations, are now routinely
treated with G-CSF to reduce the risk of bacterial infections. An
important question that can now be addressed in our mouse model is
whether G-CSF treatment accelerates leukemic progression. If so, it
will become important to routinely identify SCN patients with
GCSFR mutations and to consider alternative treatment
strategies, for instance allogeneic BM transplantation, for this group
of patients.
| |
FOOTNOTES |
Submitted February 19, 1998;
accepted April 9, 1998.
Supported by a PIONEER grant from the Netherlands Organization for
Scientific Research NWO (M.H.A.H., C.A., I.P.T.), an EMBO Long Term
Fellowship (A.C.W.), and the Dutch Cancer Society (I.P.T.).
Address reprint requests to Ivo P. Touw, PhD, Institute of Hematology,
Erasmus University Rotterdam, PO Box 1738, 3000 DR Rotterdam, The
Netherlands; e-mail: touw{at}hema.fgg.eur.nl.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.
| |
ACKNOWLEDGMENT |
We are grateful to Pim van Schalkwijk and Ton Boijmans for technical
assistance; Jan de Wit and Winand Dinjens for technical advice; Kirsten
van Lom for differential BM and blood counts; Annelies van `t Hof, Els
van Bodegom, and Helen Koek for assistance in the animal house; and
Karola van Rooyen for graphical assistance. Frank Grosveld is
gratefully acknowledged for support and advice, and Marieke Von Lindern
for critical reading of the manuscript.
| |
REFERENCES |
1.
Lieschke GJ,
Grail D,
Hodgson G,
Metcalf D,
Stanley E,
Cheers C,
Fowler KJ,
Basu S,
Zhan YF,
Dunn AR:
Mice lacking granulocyte colony-stimulating factor have chronic neutropenia granulocyte and macrophage progenitor cell deficiency and impaired neutrophil mobilization.
Blood
84:1737,
1994[Abstract/Free Full Text]
2.
Liu F,
Wu HY,
Wesselschmidt R,
Kornaga T,
Link DC:
Impaired production and increased apoptosis of neutrophils in granulocyte colony-stimulating factor receptor-deficient mice.
Immunity
5:491,
1996[Medline]
[Order article via Infotrieve]
3.
Lieschke J:
CSF-deficient mice What have they taught us?
, in Bock GB,
Goode JA
(eds):
The Molecular Basis of Cellular Defense Mechanisms.
West Sussex, UK, Wiley
, 1997
4.
Demetri GD,
Griffin JD:
Granulocyte colony-stimulating factor and its receptor.
Blood
78:2791,
1991[Free Full Text]
5.
Fukunaga R,
Ishizaka-Ikeda E,
Seto YS,
Nagata S:
Expression cloning of a receptor for murine granulocyte colony-stimulating factor.
Cell
61:341,
1990[Medline]
[Order article via Infotrieve]
6.
Fukunaga R,
Ishizaka-Ikeda E,
Pan C-I,
Seto Y,
Nagata S:
Functional domains of the granulocyte-colony-stimulating factor receptor.
EMBO J
10:2855,
1991[Medline]
[Order article via Infotrieve]
7.
Dong F,
Van Buitenen C,
Pouwels K,
Hoefsloot LH,
Löwenberg B,
Touw IP:
Distinct cytoplasmic regions of the granulocyte colony-stimulating factor receptor involved in induction of proliferation and maturation.
Mol Cell Biol
13:7774,
1993[Abstract/Free Full Text]
8.
Fukunaga R,
Ishizaki-Ikeda E,
Nagata S:
Growth and differentiation signals mediated by different regions in the cytoplasmic domain of granulocyte colony-stimulating factor receptor.
Cell
74:1079,
1993[Medline]
[Order article via Infotrieve]
9.
Yoshikawa A,
Murakami H,
Nagata S:
Distinct signal transduction through the tyrosine-containing domains of the granulocyte colony-stimulating factor receptor.
EMBO J
14:5288,
1995[Medline]
[Order article via Infotrieve]
10.
Tian S-S,
Lamb P,
Seidel HM,
Stein RB,
Rosen J:
Rapid activation of the STAT3 transcription factor by granulocyte colony-stimulating factor.
Blood
84:1760,
1994[Abstract/Free Full Text]
11.
Dong F,
Van Paassen M,
Van Buitenen C,
Hoefsloot LH,
Löwenberg B,
Touw IP:
A point mutation in the granulocyte colony-stimulating factor receptor G-CSF-R gene in a case of acute myeloid leukemia results in the overexpression of a novel G-CSF-R isoform.
Blood
85:902,
1995[Abstract/Free Full Text]
12.
Ihle JN,
Kerr IM:
Jaks and Stats in signaling by the cytokine receptor superfamily.
Trends Genet
11:69,
1995[Medline]
[Order article via Infotrieve]
13.
Dale DC,
Bonilla MA,
Davis MW,
Nakanshi AM,
Hammond WP,
Kurtzberg J,
Wang W,
Jubowski A,
Winton E,
Lalezari P,
Robinson W,
Glaspy JA,
Emerson S,
Gabrilove J,
Vincent M,
Boxer LA:
A randomized controlled phase III trial of recombinant human granulocyte colony-stimulating factor Filgrastim for treatment of severe chronic neutropenia.
Blood
81:2496,
1993[Abstract/Free Full Text]
14.
Guba SC,
Sartor CA,
Hutchinson R,
Boxer LA,
Emerson SG:
Granulocyte colony-stimulating factor G-CSF production and G-CSF receptor structure in patients with congenital neutropenia.
Blood
83:1486,
1994[Abstract/Free Full Text]
15.
Kalra R,
Dale D,
Freedman M,
Bonilla MA,
Weinblatt M,
Ganser A,
Bowman P,
Abish S,
Priest J,
Oseas RS,
Olson K,
Paderanga D,
Shannon K:
Monosomy 7 and activating RAS mutations accompany malignant transformation in patients with congenital neutropenia.
Blood
86:4579,
1995[Abstract/Free Full Text]
16.
Dong F,
Hoefsloot LH,
Schelen AM,
Broeders LCAM,
Meijer Y,
Veerman AJP,
Touw IP,
Löwenberg B:
Identification of a nonsense mutation in the granulocyte-colony-stimulating factor receptor in severe congenital neutropenia.
Proc Natl Acad Sci USA
91:4480,
1994[Abstract/Free Full Text]
17.
Dong F,
Brynes RK,
Tidow N,
Welte K,
Löwenberg B,
Touw IP:
Mutations truncating the C-terminal maturation region of the G-CSF receptor in acute myeloid leukemia preceded by severe congenital neutropenia.
N Engl J Med
333:487,
1995[Abstract/Free Full Text]
18. (abstr, suppl 1)
Welte K,
Touw IP:
G-CSF receptor mutations in patients with severe chronic neutropenia: A step in leukemogenesis?
Blood
90:433a,
1997
19.
Smith AG,
Hooper M:
Buffalo rat liver cells produce a diffusible activity which inhibits the differentiation of murine embryonal carcinoma and embryonic stem cells.
Devel Biol
121:1,
1987[Medline]
[Order article via Infotrieve]
20.
Sambrook J,
Fritsch EF,
Maniatis T:
Molecular Cloning:
A Laboratory Manual.
Cold Spring Harbor, NY, Cold Spring Harbor Laboratory
, 1989
21.
Ito Y,
Seto Y,
Brannan CI,
Copeland NG,
Jenkins NA,
Fukunaga R,
Nagata S:
Structural analysis of the functional gene and pseudogene encoding the murine granulocyte colony-stimulating-factor receptor.
Eur J Biochem
220:881,
1994[Medline]
[Order article via Infotrieve]
22.
Aardal NP,
Laerum OD:
Circadian variations in mouse bone marrow.
Exp Hematol
11:792,
1983
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
M. J. Parker, S. Xue, J. J. Alexander, C. H. Wasserfall, M. L. Campbell-Thompson, M. Battaglia, S. Gregori, C. E. Mathews, S. Song, M. Troutt, et al.
Immune Depletion With Cellular Mobilization Imparts Immunoregulation and Reverses Autoimmune Diabetes in Nonobese Diabetic Mice
Diabetes,
October 1, 2009;
58(10):
2277 - 2284.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. C. Link, G. Kunter, Y. Kasai, Y. Zhao, T. Miner, M. D. McLellan, R. E. Ries, D. Kapur, R. Nagarajan, D. C. Dale, et al.
Distinct patterns of mutations occurring in de novo AML versus AML arising in the setting of severe congenital neutropenia
Blood,
September 1, 2007;
110(5):
1648 - 1655.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. H. Mermel, M. L. McLemore, F. Liu, S. Pereira, J. Woloszynek, C. A. Lowell, and D. C. Link
Src family kinases are important negative regulators of G-CSF-dependent granulopoiesis
Blood,
October 15, 2006;
108(8):
2562 - 2568.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. S. Rosenberg, B. P. Alter, A. A. Bolyard, M. A. Bonilla, L. A. Boxer, B. Cham, C. Fier, M. Freedman, G. Kannourakis, S. Kinsey, et al.
The incidence of leukemia and mortality from sepsis in patients with severe congenital neutropenia receiving long-term G-CSF therapy
Blood,
June 15, 2006;
107(12):
4628 - 4635.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Wolfler, S. J. Erkeland, C. Bodner, M. Valkhof, W. Renner, C. Leitner, W. Olipitz, M. Pfeilstocker, C. Tinchon, W. Emberger, et al.
A functional single-nucleotide polymorphism of the G-CSF receptor gene predisposes individuals to high-risk myelodysplastic syndrome
Blood,
May 1, 2005;
105(9):
3731 - 3736.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. J. Druhan, J. Ai, P. Massullo, T. Kindwall-Keller, M. A. Ranalli, and B. R. Avalos
Novel mechanism of G-CSF refractoriness in patients with severe congenital neutropenia
Blood,
January 15, 2005;
105(2):
584 - 591.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G.-J. M. van de Geijn, J. Gits, L. H. J. Aarts, C. Heijmans-Antonissen, and I. P. Touw
G-CSF receptor truncations found in SCN/AML relieve SOCS3-controlled inhibition of STAT5 but leave suppression of STAT3 intact
Blood,
August 1, 2004;
104(3):
667 - 674.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G.-J. M. van de Geijn, J. Gits, and I. P. Touw
Distinct activities of suppressor of cytokine signaling (SOCS) proteins and involvement of the SOCS box in controlling G-CSF signaling
J. Leukoc. Biol.,
July 1, 2004;
76(1):
237 - 244.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Kimura, I. Kinjyo, Y. Matsumura, H. Mori, R. Mashima, M. Harada, K. R. Chien, H. Yasukawa, and A. Yoshimura
SOCS3 Is a Physiological Negative Regulator for Granulopoiesis and Granulocyte Colony-stimulating Factor Receptor Signaling
J. Biol. Chem.,
February 20, 2004;
279(8):
6905 - 6910.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. H. J. Aarts, O. Roovers, A. C. Ward, and I. P. Touw
Receptor activation and 2 distinct COOH-terminal motifs control G-CSF receptor distribution and internalization kinetics
Blood,
January 15, 2004;
103(2):
571 - 579.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
V. Santini, B. Scappini, Z. K. Indik, A. Gozzini, P. Rossi Ferrini, and A. D. Schreiber
The carboxy-terminal region of the granulocyte colony-stimulating factor receptor transduces a phagocytic signal
Blood,
June 1, 2003;
101(11):
4615 - 4622.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Mitsui, S. Watanabe, Y. Taniguchi, S. Hanada, Y. Ebihara, T. Sato, T. Heike, M. Mitsuyama, T. Nakahata, and K. Tsuji
Impaired neutrophil maturation in truncated murine G-CSF receptor-transgenic mice
Blood,
April 15, 2003;
101(8):
2990 - 2995.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. H. A. Hermans, G.-J. van de Geijn, C. Antonissen, J. Gits, D. van Leeuwen, A. C. Ward, and I. P. Touw
Signaling mechanisms coupled to tyrosines in the granulocyte colony-stimulating factor receptor orchestrate G-CSF-induced expansion of myeloid progenitor cells
Blood,
April 1, 2003;
101(7):
2584 - 2590.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Kawaguchi, M. Kobayashi, K. Nakamura, N. Konishi, S.-i. Miyagawa, T. Sato, H. Toyoda, Y. Komada, S. Kojima, Y. Todoroki, et al.
Dysregulation of transcriptions in primary granule constituents during myeloid proliferation and differentiation in patients with severe congenital neutropenia
J. Leukoc. Biol.,
February 1, 2003;
73(2):
225 - 234.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. J. Erkeland, M. Valkhof, C. Heijmans-Antonissen, R. Delwel, P. J. M. Valk, M. H. A. Hermans, and I. P. Touw
The gene encoding the transcriptional regulator Yin Yang 1 (YY1) is a myeloid transforming gene interfering with neutrophilic differentiation
Blood,
February 1, 2003;
101(3):
1111 - 1117.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. S. Grenda, S. E. Johnson, J. R. Mayer, M. L. McLemore, K. F. Benson, M. Horwitz, and D. C. Link
Mice expressing a neutrophil elastase mutation derived from patients with severe congenital neutropenia have normal granulopoiesis
Blood,
October 16, 2002;
100(9):
3221 - 3228.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F. Dong, Y. Qiu, T. Yi, I. P. Touw, and A. C. Larner
The Carboxyl Terminus of the Granulocyte Colony- Stimulating Factor Receptor, Truncated in Patients with Severe Congenital Neutropenia/Acute Myeloid Leukemia, Is Required for SH2-Containing Phosphatase-1 Suppression of Stat Activation
J. Immunol.,
December 1, 2001;
167(11):
6447 - 6452.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. D. Car and V. M. Eng
Special Considerations in the Evaluation of the Hematology and Hemostasis of Mutant Mice
Vet. Pathol.,
January 1, 2001;
38(1):
20 - 30.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Nakamura, M. Kobayashi, N. Konishi, H. Kawaguchi, S.-i. Miyagawa, T. Sato, H. Toyoda, Y. Komada, S. Kojima, O. Katoh, et al.
Abnormalities of primitive myeloid progenitor cells expressing granulocyte colony-stimulating factor receptor in patients with severe congenital neutropenia
Blood,
December 15, 2000;
96(13):
4366 - 4369.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. M. White, M. H. Alarcon, and D. J. Tweardy
Inhibition of granulocyte colony-stimulating factor-mediated myeloid maturation by low level expression of the differentiation-defective class IV granulocyte colony-stimulating factor receptor isoform
Blood,
June 1, 2000;
95(11):
3335 - 3340.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. G. Hunter and B. R. Avalos
Granulocyte colony-stimulating factor receptor mutations in severe congenital neutropenia transforming to acute myelogenous leukemia confer resistance to apoptosis and enhance cell survival
Blood,
March 15, 2000;
95(6):
2132 - 2137.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. C. Ward, I. Touw, and A. Yoshimura
The Jak-Stat pathway in normal and perturbed hematopoiesis
Blood,
January 1, 2000;
95(1):
19 - 29.
[Full Text]
[PDF]
|
|
|
|
|
|
|
N. Konishi, M. Kobayashi, S.-i. Miyagawa, T. Sato, O. Katoh, and K. Ueda
Defective Proliferation of Primitive Myeloid Progenitor Cells in Patients With Severe Congenital Neutropenia
Blood,
December 15, 1999;
94(12):
4077 - 4083.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. Lowenberg, J. R. Downing, and A. Burnett
Acute Myeloid Leukemia
N. Engl. J. Med.,
September 30, 1999;
341(14):
1051 - 1062.
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. C. Ward, Y. M. van Aesch, J. Gits, A. M. Schelen, J. P. de Koning, D. van Leeuwen, M. H. Freedman, and I. P. Touw
Novel Point Mutation in the Extracellular Domain of the Granulocyte Colony-Stimulating Factor (G-Csf) Receptor in a Case of Severe Congenital Neutropenia Hyporesponsive to G-Csf Treatment
J. Exp. Med.,
August 16, 1999;
190(4):
497 - 508.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. H.A. Hermans, C. Antonissen, A. C. Ward, A. E.M. Mayen, R. E. Ploemacher, and I. P. Touw
Sustained Receptor Activation and Hyperproliferation in Response to Granulocyte Colony-stimulating Factor (G-CSF) in Mice with a Severe Congenital Neutropenia/Acute Myeloid Leukemia-derived Mutation in the G-CSF Receptor Gene
J. Exp. Med.,
February 15, 1999;
189(4):
683 - 692.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. G. Hunter and B. R. Avalos
Deletion of a Critical Internalization Domain in the G-CSFR in Acute Myelogenous Leukemia Preceded by Severe Congenital Neutropenia
Blood,
January 15, 1999;
93(2):
440 - 446.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. C. Ward, Y. M. van Aesch, A. M. Schelen, and I. P. Touw
Defective Internalization and Sustained Activation of Truncated Granulocyte Colony-Stimulating Factor Receptor Found in Severe Congenital Neutropenia/Acute Myeloid Leukemia
Blood,
January 15, 1999;
93(2):
447 - 458.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. C. Ward, M. H.A. Hermans, L. Smith, Y. M. van Aesch, A. M. Schelen, C. Antonissen, and I. P. Touw
Tyrosine-Dependent and -Independent Mechanisms of STAT3 Activation by the Human Granulocyte Colony-Stimulating Factor (G-CSF) Receptor Are Differentially Utilized Depending on G-CSF Concentration
Blood,
January 1, 1999;
93(1):
113 - 124.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Abstract
Introduction
Abstract