|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 92 No. 10 (November 15), 1998:
pp. 3529-3536
RAPID COMMUNICATION
The Fetal Origin of B-Precursor Leukemia in the Eµ-ret Mouse
By
Xiang-Xing Zeng,
Haige Zhang,
Richard R. Hardy, and
Robert Wasserman
From the Division of Oncology, The Children's Hospital of
Philadelphia, and Department of Pediatrics, The University of
Pennsylvania School of Medicine, Philadelphia, PA; and the Institute
for Cancer Research, Fox Chase Cancer Center, Philadelphia, PA.
 |
ABSTRACT |
Before the clinical onset of B-precursor lymphoblastic leukemia,
Eµ-ret mice have an expansion of late pro-B cells
(CD45R+CD43+CD24+BP-1+)
within the bone marrow. To characterize the early effects of the
transgene product on lymphopoiesis, we initially sequenced the Ig heavy
chain (IgH) rearrangements within the late pro-B cells in 24-day-old
Eµ-ret and transgene negative mice. In both mouse populations, the
IgH rearrangements were polyclonal, predominately nonproductive, and
exhibited similar V, D, and J gene usage. However, the frequency of N
regions, a marker of postnatal lymphopoiesis, was notably different. At
the VD junction, N regions were found in 25 of 25 (100.0%)
rearrangements from transgene-negative mice compared with 12 of 36 (33.3%) rearrangements from Eµ-ret mice. At the DJ junction, N
regions were found in 21 of 25 (84.0%) rearrangements from transgene
negative mice compared with 4 of 36 (11.1%) rearrangements from
Eµ-ret mice. Subsequently, we sequenced the clonal IgH rearrangements from 9 leukemias that developed in 10-to 38-week-old mice and found
that 7 leukemias had a least 1 rearrangement that lacked N regions at
the DJ junction. In addition, V replacement events were observed in the
1 leukemia studied in detail. Terminal deoxynucleotidyl transferase,
the enzyme responsible for N region addition, was expressed at markedly
lower levels in late pro-B cells from 7- to 10-day-old Eµ-ret mice
compared with transgene-negative mice. Examination of fetal
lymphopoiesis in Eµ-ret mice identified a relative increase in early
(CD45R+CD43+CD24+BP-1 )
and late pro-B cells and a decrease in more differentiated
CD43 B-lineage cells. Fetal early pro-B cells from
Eµ-ret mice proliferated threefold to fivefold greater but
differentiated to a lesser extent than those from transgene negative
mice when cultured in vitro with interleukin-7. These data suggest that
the B precursor leukemias in adult Eµ-ret mice arise from the progeny
of pro-B cells generated in utero.
© 1998 by The American Society of Hematology.
| |
INTRODUCTION |
IT HAS BEEN HYPOTHESIZED that childhood
B-precursor acute lymphoblastic leukemia (ALL) may originate from an in
utero initiating event, because the peak incidence occurs in young
children.1 However, the lack of a clinically identifiable
preleukemic state has made it difficult to determine when the first
abnormality arises in lymphopoiesis. Recently, it was shown that
infants and children who develop ALL with t(4;11)(q21;q23), fusion of
the MLL-AF4 genes, have molecular evidence of the translocation on neonatal blood spots.2 More strikingly, the ALLs from
monozygotic twins diagnosed at age 3 years and 6 months and at age 4 years and 10 months were shown to share the same TEL-AML1 fusion gene from a t(12;21)(p13;q22) and an identically rearranged Ig heavy chain
(IgH).3 These observations not only implicate the
translocation as an initiating event, but also prove that the
abnormality first arose in utero. Other evidence suggestive of an in
utero origin of B-precursor leukemia comes from analyses of the
rearranged IgH alleles in childhood ALL. N regions,
non-template-derived nucleotides added to the ends of recombining gene
segments by the action of terminal deoxynucleotidyl transferase (TdT),
were not found at the DJ junction in the majority of B-precursor ALLs diagnosed in children less than 3 years of age.4 A
subsequent study not only confirmed the above-noted observation, but
also found a decrease in N region frequency at the DJ junction in older children with ALL.5 These findings are notable, because TdT expression and N region addition, although not initially present in
fetal lymphopoiesis, have been observed by the end of the first trimester of gestation in humans.6-8
We previously identified the Eµ-ret mouse as a transgenic model of
B-precursor ALL.9 In the bone marrow of 1-month-old Eµ-ret mice, we found that the late pro-B-cell population was selectively expanded and that the proportion of VDJ IgH rearrangements within this population was increased compared with transgene-negative mice.9 Consequently, we hypothesized that the initial
lesion in the Eµ-ret mouse might arise from the failure of late pro-B cells with nonproductive IgH rearrangements to undergo apoptosis. In
this study, we found that the majority of IgH rearrangements were
indeed nonproductive and polyclonal; however, an unexpected finding was
that the rearrangements had a paucity of N regions compared with
transgene-negative mice. In the mouse, N regions are first identified
in the newborn period, because TdT is not expressed in fetal B-lineage
cells.10-12 Thus, the expanded late pro-B-cell population
seen in the young Eµ-ret mice appears to have originated from fetal
pro-B cells. We also report other evidence to suggest that the
B-precursor leukemias in Eµ-ret mice are derived from pro-B cells
generated in utero.
| |
MATERIALS AND METHODS |
Mice and cell preparation.
Eµ-ret mice were generated as previously described.9 A
single-cell suspension of bone marrow (femur and tibia) was prepared by
injecting ice-cold staining medium (deficient RPMI (Irvine Scientific,
Santa Ana, CA) containing 10 mmol/L HEPES, 3% fetal calf serum
[FCS], and 0.1% NaN3) into the bone to flush out cells, followed by gentle mixing with a 1-mL syringe. Fetal liver was obtained
from timed matings of an Eµ-ret male with a BALB/c female. Fetal
liver cells were prepared by dissociation between frosted glass slides
and a single-cell suspension was prepared in staining medium. Bone
marrow and fetal liver cells were treated with 0.165 mol/L
NH4Cl to eliminate erythrocytes before staining with
antibodies.
Cell surface staining and flow cytometry.
Bone marrow and fetal liver cells were stained as described previously
with a four-color combination of fluorescent monoclonal antibodies:
anti-CD45R(B220) (allophycocyanin-6B2), anti-CD43 (fluorescein-S7),
anti-BP-1 (phycoerythrin-BP-1), and anti-CD24/HSA (biotin-30F1/Texas
Red [or Red-613]-avidin).13 Cultured fetal livers cells
were stained simultaneously with the above-noted four-color combination
or a two-color combination of anti-CD45R and anti-IgM
(fluorescein-331.12). Four-color flow cytometry analysis and sorting of
bone marrow was performed using a dual-laser (FACSVantage; Becton
Dickinson Immunocytometry Systems, San Jose, CA) or a
dual-laser/dye-laser flow cytometer (FACStarPLUS;
Becton Dickinson) equipped with appropriate filters for four-color immunofluorescence. Reanalysis of sorted fractions consistently showed
purities in excess of 98%. Two-color analyses were performed on a
FACSCaliber (Becton Dickinson).
Cell culture conditions.
Sorted fetal early pro-B cells were initially cultured in 24-well
plates for 4 days in 1 mL of standard medium (RPMI-1640 supplemented
with 5% FCS, 2 mmol/L L-glutamine, 25 mmol/L HEPES, and 50 µmol/L
2-mercaptoethanol). Interleukin-7 (IL-7; Genzyme, Cambridge, MA) at 100 U/mL was added at time 0. The cultures maintained for 17 days were
split approximately every fourth day with 100 U/mL of IL-7 added.
RNA extraction and reverse transcription-polymerase chain reaction
assay (RT-PCR).
Pro-B cells (104 to 105) were sorted directly
into microcentrifuge tubes containing 350 µL of RNA lysis buffer for
RNA extraction and cDNA synthesis following our previously published
protocol.9 PCR reactions were performed in a 50 µL
reaction mixture containing 1 to 2 µL of cDNA with final
concentrations of 1× PCR buffer II (Perkin Elmer Roche,
Branchburg, NJ), 2.5 mmol/L MgCl2, 0.1 mmol/L dNTPs, 1 µmol/L of primers, and 2.5 U of Taq polymerase (Perkin Elmer Roche).
Primer sequences (5 -3) were as follows:  -actin (623 bp): sense, CCTAAGGCCAACCGTGAAAAG and antisense, TCTTCATGGTGCTAGGAGCCA; TdT (313 bp): sense, GAAGATGGGAACAACTCGAAGAG, and antisense,
CAGGTGCTGGAACATTCTGGGAG; primer pairs spanned introns to discriminate
signals resulting from contaminating DNA. After an initial 10 minutes
of incubation at 80°C, the PCR conditions were 95°C for 30 seconds, 62°C (for the first 5 cycles) or 58°C (for subsequent
cycles) for 30 seconds, and 72°C for 45 seconds for the indicated
number of cycles. PCR was performed on a PTC-100 thermal cycler (MJ
Research, Watertown, MA). Ten microliters of amplified reaction
mixtures was run on 1.5% agarose gels and visualized by ethidium
bromide staining.
DNA preparation and VDJ-PCR.
Pro-B cells were sorted directly into standard media and then DNA was
recovered following our previously published protocol.9 For
the first PCR round with IgH V family specific and a mixture of J
intron primers, 1 to 2 µL of lysate was amplified using the above-noted PCR reaction mixtures. The PCR conditions for 30 cycles of
amplification were 95°C for 60 seconds, 60°C for 30 seconds, and 72°C for 45 seconds. For the second 30-cycle PCR round, 2 µL
of amplified products was reamplified with the same V family-specific primers and a mixture of nested J exon primers. Sense V family primer
sequences were as follows: J558, GGCCTGGGA/GCTTCAGTGAAG; Q52,
GTCACAGAGCCTGTCCATCAC; 7183, GTGGAGTCTGGGGGAGGCTTA; J606, GCTGGAGGAGGCTTGGTGCAA; and 3660, GCTCAGTCTCTGTCC/TCTCACC. Antisense J
intron primers were as follows: J1, GCCTCTTTTCCTGGGAGTGA; J2, GTCTGCATCAGCTAGGGCTC; J3, GACCAGCAGGCAGAGAGTCC; and J4,
GTCCTAAAGGCTCTGAGATC. Antisense J exon primers were as follows: J1,
GCTTACCTGAGGAGACGGTG; J2, GTGGTGCCTTGGCCCCAGTA; J3,
GCTGCAGAGACAGTGACCAG; and J4, GTGACCCCAGTAGTCCATAGC
Cloning, sequencing, and IgH sequence assignments.
VDJ-PCR products were electrophoresed on a 1.5% agarose gel and smear
bands (day-24 sorted pro-B-cell samples) or distinct bands (leukemic
bone marrow) were excised, purified with the QIAquick gel extraction
kit (Qiagen, Santa Clarita, CA), and cloned using the TA cloning system
kit (Invitrogen, Carlsbad, CA). Plasmids were purified with the Qiaprep
spin miniprep kit (Qiagen) and sequenced using the Prism dye terminator
cycle sequencing kit (Applied Biosystems, Foster City, CA) with a T7
primer on an Applied Biosystems 373 or 377 DNA sequencer. V sequence
assignments were based on Blast search results (National Center for
Biotechnology Information, Bethesda, MD) and alignment with published
sequences in Kabat et al.14 D sequence assignments were
based on the best match against the 13 known D genes using a minimum
homology of 5 nucleotides.15,16 J sequence assignments were
based on the best match against the 4 J genes.17
Nucleotides adjacent to germline 5 or 3 ends of the V, D,
or J genes were assigned as P nucleotides according to the criteria of
Lafaille et al.18
| |
RESULTS |
To characterize the expanded late pro-B-cell population in the
Eµ-ret mouse, we examined the structure of the IgH rearrangements. We
sorted
CD45R+CD43+CD24+BP-1+
late pro-B cells (as defined in Hardy et al13) from the
bone marrow of 2 Eµ-ret and 3 transgene-negative 24-day-old mice. In both populations, the majority of VDJ rearrangements were
nonproductive: 17 of 25 (68.0%) of the VDJ joinings in the
transgene-negative mice compared with 29 of 36 (80.6%) of the VDJ
joinings in the Eµ-ret mice. In both populations, the most frequent
cause for a nonproductive rearrangement was that the J gene was
out-of-frame.
We next quantitated the proportion of VDJ joinings containing N regions
in the two late pro-B-cell populations
(Fig 1, upper panel). We found a striking
difference in the incidence of N regions at both the VD and DJ junction
in the two populations. Specifically, at the VD junction, 25 of 25 (100.0%) joinings had N regions in the transgene-negative late pro-B
cells, whereas only 12 of 36 (33.3%) VD joinings from the Eµ-ret
late pro-B cells had N regions. At the DJ junction, 21 of 25 (84.0%)
joinings had N regions in the transgene-negative late pro-B cells,
whereas only 4 of 36 (11.1%) DJ joinings from the Eµ-ret late pro-B
cells had N regions. In the VDJ joinings that lacked N regions in the
Eµ-ret mice late pro-B cells, nucleotides that could be derived from
either adjoining V, D, or J segment were frequently found at both the
VD (11/24 [45.8%]) and DJ junction (27/32 [84.3%]). These
rearrangements likely occurred by homology-directed recombination, the
process by which rearrangement is targeted to short stretches of
sequence homology near the ends of the segments to be joined, as is
commonly observed in the Ig rearrangements of fetal and newborn
mice.11,19
View larger version (20K):
[in this window]
[in a new window]
| Fig 1.
The structure of the rearranged IgH in sorted late pro-B
cells from 24-day-old Eµ-ret (Tg+) and transgene-negative (Tg )
mice. Twenty-five and 36 unique VDJ joinings were PCR-amplified from
DNA obtained from the bone marrow of Tg and Tg+ mice,
respectively. In the upper graph, N regions are defined as nontemplate
derived nucleotides that are found at the VD or DJ junction. In the
lower graphs, V and D gene family and J gene usage within the VDJ
joinings was assigned as detailed in Materials and Methods.
|
|
We also analyzed the V, D, and J gene usage in the VDJ joinings of the
two late pro-B-cell populations (Fig 1, bottom panel). The only
notable differences were that the DQ52 gene was found less frequently
in the rearrangements from the transgene-negative mice (1/25 [4.0%]
v 7/36 [19.4%]) and that J2 (13/25 [52.0%]) was the
predominate J gene found followed by J4 (7/25 [28.0%]) in the
transgene-negative mice, whereas J4 was the predominate gene (14/36
[38.9%]) used followed by J2 (13/46 [36.1%]) in the Eµ-ret
mice.
To substantiate whether the leukemias that emerge in older Eµ-ret
mice might arise from this abnormal pool of polyclonal late pro-B cells
with infrequent N regions, we sequenced the IgH rearrangements from 9 different leukemias obtained from mice who developed lymphadenopathy at
10 to 38 weeks of age. The repetitive VDJ joinings sequenced from these
bands are shown in Table 1. Of note, N
regions were found at the VD junction in 11 of 13 (84.6%) of the IgH
rearrangements with identifiable D regions, but in only 3 of 13 (23.1%) DJ joints. Homology-directed recombination in the VDJ joinings
that lacked N regions was found in 1 of 2 (50%) VD and 7 of 10 (70%)
DJ joints. Most strikingly, the oldest mouse (5/9) to develop leukemia,
at 38 weeks of age, had two VDJ rearrangements identified, both of which lacked N regions at the DJ joining and 1 that lacked an N region
at the VD joint. In addition, 8 of the 9 leukemias were composed of IgH
rearrangements that were nonproductive, consistent with their origin
from late pro-B cells.
The marked disparity in N region frequency between the VD and DJ
junction in the leukemic IgH rearrangements led us to consider the
possibility that the leukemias may have originated in fetal pro-B cells
that subsequently upregulated TdT over time. In the late pro-B-cell
population from the 24-day-old Eµ-ret mice analyzed above and in the
majority of leukemias, we found TdT expression to be comparable to the
level expressed in transgene-negative late pro-B cells (data not
shown). We then determined whether TdT expression was absent or reduced
in the late pro-B cells of Eµ-ret mice younger than 24 days. In
Fig 2, we sorted
CD45R+CD43+CD24+BP-1
early pro-B cells (B) and
CD45R+CD43+CD24+BP-1+
late pro-B cells (C) from postnatal day-1 liver, day-7 liver and
spleen, and day-10 bone marrow and measured TdT levels. In day-1 liver,
TdT expression is detectable in early pro-B cells but not in late pro-B
cells in both transgene-negative and Eµ-ret mice, likely indicating
that newly generated early pro-B cells are upregulating TdT in this
postnatal environment. By day 7 in the liver and spleen and day 10 in
the bone marrow, TdT expression is prominent in both the early and late
pro-B cells from the transgene-negative mice, as well as in the early
pro-B cells from Eµ-ret mice. In contrast, TdT expression is markedly
reduced in the late pro-B cells from Eµ-ret mice.
View larger version (30K):
[in this window]
[in a new window]
| Fig 2.
RT-PCR analysis of TdT expression in sorted early (B) and
late (C) pro-B cells from neonatal Eµ-ret (Tg+) and
transgene-negative (Tg) mice. Shown are ethidium bromide staining
patterns of 26 (-actin) or 30 cycles (TdT) of amplification resolved
on a 1.5% agarose gel.
|
|
Another mechanism that could account for the higher N region frequency
at the VD junction is V replacement, in which a 5 unrearranged V
gene replaces the downstream recombined V gene, as has been described
in both mouse B-precursor lines and childhood ALL.20-25
Thus, a VDJ rearrangement that lacked N regions at the VD junction
could have undergone a V replacement event in the presence of TdT. To
determine whether V replacement events occur in the leukemias of the
Eµ-ret mice, we analyzed the PCR products generated with the J558 V
family-specific primer (and the 4 J gene primers) from the bone marrow
DNA of mouse 6/26. The J558 V genes are upstream to the 7183 and the
Q52 V genes used in the leukemic rearrangements.26 We
observed a faint smear band after gel electrophoresis and subsequently
cloned and sequenced 14 unique VDJ rearrangements. Five of these
rearrangements appeared to be derived from the leukemic sequences, as
shown in Table 2. V replacement events
involving the Q52 rearrangement added new N nucleotides to the original
N region (CCC) at the VD junction and left the D region unmodified. In
regards to the 7183 rearrangement, V replacement events preserved the
original nucleotides found between the V and J genes as well as the
3 end of the 7183 V gene.
We then investigated whether fetal lymphopoiesis in Eµ-ret mice was
abnormal compared with transgene-negative mice. We studied B-lineage
development in the later stages of fetal development when both
CD43+ and CD43 populations are present.
As shown in Table 3, the mean percentage of
residual CD45R+CD43+ cells (pro-B and early
pre-B cells) was only slightly increased in the fetal livers from the
Eµ-ret mice at days 18 and 19 of gestation. In addition, the mean
percentage of CD45R+CD43 cells (pre-B,
immature B, and mature B cells) was reduced in the fetal livers from
the Eµ-ret mice at both days. Most notably, at day 18 of gestation, 5 of the 8 Eµ-ret fetal livers contained more
CD45R+CD43+ cells than
CD45R+CD43 cells, whereas all 5 trangene-negative fetal livers contained more
CD45R+CD43 cells.
To determine whether the CD45R+CD43+ population
was different in the Eµ-ret fetal livers, we compared the BP-1 and
CD24 expression patterns of these cells to distinguish early pro-B,
late pro-B, and early pre-B subsets. Figure
3 provides a flow cytometry analysis of the fetal livers from the
Eµ-ret mouse and the transgene littermate with the highest
percentages of CD45R+CD43+ cells at day 19 of
gestation. Specifically, the CD45R+CD43+
population (right upper quadrant, top panels) was gated for BP-1 and
CD24 expression (lower panels). The increased percentage of CD45R+CD43+ cells in the fetal liver in the
Eµ-ret mouse relative to the transgene-negative mouse is accounted
for by an increase in both the BP-1 early pro-B cell
(1.6% vs. 0.7%) and BP-1+CD24+ late pro-B
cell (1.9% vs.1.2%) population. The percentage of the more
differentiated BP-1+CD24++ early pre-B cell
population is the same (1.1%). Similarly, when we compared the BP-1
and CD24 expression patterns from the Eµ-ret mouse and the transgene
littermate with the lowest percentages of
CD45R+CD43+ cells at day 19 of gestation (both
with 1.5%), the Eµ-ret mouse had a higher percentage of early pro-B
cells (0.5% v 0.3%) and late pro-B cells (0.7% v
0.5%), but had a lower percentage of early pre-B cells (0.3%
v 0.6%). These data indicate that Eµ-ret mice retain a
higher proportion of early and late pro-B cells among the residual
CD43+ population late in gestation.
View larger version (66K):
[in this window]
[in a new window]
| Fig 3.
Flow cytometry of day 19 fetal livers showing separation
of B-lineage subsets in Eµ-ret (Tg+) and transgene-negative (Tg)
mice. In the upper diagrams, B-lineage cells (CD45R+) are
resolved from total liver cells into less differentiated
(CD43+) and more differentiated subsets
(CD43). The percentages of
CD45R+CD43 (left upper quadrant) and
CD45R+CD43+ (right upper quadrant)
cells among total liver cells are shown in the
corresponding quadrant. In the lower diagrams,
CD45R+CD43+ cells are further resolved into
BP-1 early pro-B (bottom region),
CD24+BP-1+ late pro-B (upper left region),
and CD24++ BP-1+ early pre-B cells (upper
right region) and their percentages are shown in their corresponding
region. An arrow points to a population of late pro-B cells that
expresses high levels of BP-1, as previously observed in the bone
marrow of 3-to 5-week-old Eµ-ret mice.
|
|
We did not previously observe notable differences in the proliferation
and differentiation of the early pro-B cell population in the bone
marrow of 3- to 5-week-old Eµ-ret mice compared with transgene-negative mice9 (and unpublished observations).
Moreover, from the TdT expression data given above, it appears that the early pro-B cells seen in the bone marrow of young Eµ-ret mice are
predominately derived after birth. Thus, the RFP/RET transgene product
might exert its effect preferentially on fetal-derived pro-B cells.
Consequently, we sorted early pro-B cells
(CD45R+CD43+CD24+BP-1)
from day-17 fetal livers and cultured the cells in RPMI-based media
supplemented with IL-7 and 5% FCS. After 4 days in culture, the
Eµ-ret early pro-B cells proliferated threefold to fivefold greater
(mean, 3.9; n = 3 livers) than the transgene-negative cells. However,
the percentage of viable cells was only slightly greater in the
Eµ-ret cultures (mean, 59.4%) compared with the transgene-negative
cultures (mean, 51.3%). Although the cultures from both populations
were composed of predominately sIg cells, the
Eµ-ret cultures had less than 1% of the cells differentiating to the
sIg+ stage compared with about 7% for the
transgene-negative cultures (data not shown). Unlike the pro-B cells
from transgene-negative mice, the Eµ-ret cells continued to
proliferate in IL-7. As shown in Fig
4, the Eµ-ret cells recovered after 17 days are
uniformly CD45R+CD43+ and are composed of both
an early pro-B (BP-1 ~40%) and late pro-B
(BP-1+ ~60%) population. Similarly, we found that
Eµ-ret early pro-B cells sorted from day-16 fetal livers had a mean
4.5-fold greater proliferation (n = 3) and less differentiation than
transgene-negative cells when cultured for 4 days in IL-7 (data not
shown).
View larger version (20K):
[in this window]
[in a new window]
| Fig 4.
Flow cytometry analysis of an Eµ-ret (Tg+) early
pro-B cell culture. Early pro-B cells from the day-17 fetal liver of an
Eµ-ret mouse were sorted and cultured for 17 days in standard media
with IL-7 (100 U/mL). The shaded histogram represents the Tg+
culture, whereas the bold outline represents a bone marrow control. In
the left histogram, the bone marrow control was resolved into
CD45R and CD45R+ (B-lineage) populations.
In the middle histogram, the bone marrow CD45R+ B-lineage
cells were gated and resolved into a CD43 (late pre-B
and B cell) and a CD43+ (pro and early pre-B) population.
In the right histogram, the bone marrow
CD45R+CD43+ B-lineage cells were gated and
resolved into a BP-1 (early pro-B) and
BP-1+ (late pro-B and early pre-B) population.
|
|
| |
DISCUSSION |
We characterized the rearranged IgH chain in the expanded late
pro-B-cell population of 24-day-old Eµ-ret mouse and found that the
rearrangements were predominately nonproductive and polyclonal. Most
notably, the rearrangements at both the VD and DJ junction had a low
frequency of N regions when compared with those from transgene-negative
mice. When we examined the rearranged IgH alleles in the leukemias from
adult Eµ-ret mice, we found that the majority of VD junctions had N
regions, whereas the majority of DJ junctions lacked N regions.
Consequently, we hypothesize that the majority of leukemias occurred in
fetal-derived pro-B cells with upregulated TdT, rather than from pro-B
cells originating in the postnatal bone marrow, liver, or spleen. In
support, we found normal levels of TdT gene expression in the late
pro-B cells from the 24-day-old Eµ-ret mice, but late pro-B cells
from 7- to 10-day-old Eµ-ret mice had markedly reduced levels of TdT
compared with transgene-negative mice. In addition, early pro-B cells
from the fetal liver of Eµ-ret mice upregulated TdT when cultured in
vitro (data not shown), as has been recently observed for normal fetal
multipotent hematopoietic cells and B-lineage-committed
progenitors.27 In this latter study, N regions were found
about fourfold more frequently at the VD junction compared with the DJ
junction when these fetal B precursors were cultured for greater than
14 days.27 Thus, N regions in the Eµ-ret leukemic IgH
alleles may have been generated during D to J joining, V to DJ joining,
or V replacement in the presence of upregulated TdT activity. In
childhood ALL, N regions are found less frequently at the DJ
junctions,4,5 and V replacement events as well as ongoing D
to J and V to DJ joining of the IgH chain have been
observed.22-25,28-30
We next examined fetal lymphopoiesis in the Eµ-ret mouse. Unlike the
bone marrow of young Eµ-ret mouse, where there is typically a 10- to
20-fold increase in the percentage of the late pro-B-cell population,9 we did not find such a marked difference in
fetal liver. However, the Eµ-ret fetal livers retained a greater
proportion of B-lineage cells in both the early pro-B- and late
pro-B-cell stages than their transgene-negative counterparts. More
notably, there was a marked difference in the growth of early pro-B
cells from Eµ-ret and transgene-negative fetal livers when cultured in IL-7 alone. These later observations suggest a mechanism that could
explain how an apparent mild quantitative abnormality in fetal
lymphopoiesis could produce a marked abnormality within the first
postnatal month. Consequently, we hypothesize that the residual fetal
pro-B cells in the Eµ-ret mice are stimulated to proliferate and
differentiate in the immediate postnatal period. During this time,
fetal pro-B cells with nonproductive VDJ rearrangements fail to undergo
apoptosis but continue to proliferate, and thus accumulate and expand
in the late pro-B-cell pool.
We previously found that early pro-B cells from the bone marrow of 3- to 5-week-old Eµ-ret mice proliferated and differentiated similarly
to transgene-negative controls in culture media supplemented with
IL-7.9 These observations were surprising considering the
inhibition in differentiation that was seen in the late pro-B cells
from these Eµ-ret mice. Most notably, the early pro-B cells differentiated to a greater extent than the late pro-B cells sorted from the same Eµ-ret mice. However, we have now observed that TdT
levels are normal in the early pro-B cells from 7- to 10-day-old Eµ-ret mice, in contrast to the reduced levels observed in the late
pro-B cells from the same mice. Thus, it appears that the majority of
early pro-B cells in the previously studied Eµ-ret mice were derived
in the postnatal bone marrow, whereas the late pro-B cells were of
fetal origin. Consequently, we propose that the RFP/RET transgene
product preferentially affects fetal pro-B cells, perhaps by
interacting with a pathway accessible primarily in fetal B-lineage
cells.
The chimeric protein, RFP/RET, produced from the Eµ-ret transgene is
predominately membrane bound and has constitutive tyrosine kinase
activity.31,32 The in vitro culture results suggest that
the transgene product may substitute for a stromal cell signal, because
early pro-B cells from the fetal livers of Eµ-ret mice could be
maintained long-term in IL-7 alone.33 It is unknown whether
RET plays a role in human ALL. In one study, RET expression was
detected in only 2 of 7 cases of B-precursor ALL.34 An
increase in ALL has not been reported in patients with constitutional
activating mutations in RET (multiple endocrine neoplasia 2 syndromes),
but the malignancies develop in tissues with the highest levels of RET
expression.35-37 The RET tyrosine kinase has the most
homology with the fibroblast growth factor receptor (FGFR) family.
Mutations and translocations involving members of the FGFR family have
been found in hematopoietic abnormalities including T- and B-cell
lymphoid malignancies.38-40 However, patients with skeletal
abnormalities carrying constitutional activating mutations in FGFR
members are not at increased risk for hematopoietic malignancies,
suggesting that the level of tyrosine kinase activity in the
hematopoietic cells of these patients is insufficient to induce
transformation.39 Thus, the ability of the RFP/RET product
to transform B-precursor cells in Eµ-ret mice likely reflects its
high kinase activity and could occur through the constitutive
activation of signaling pathways normally stimulated by other related
tyrosine kinases. As an additional mechanism, the RFP/RET chimeric
protein could bind the normal RFP transcriptional activator and inhibit
its action.41
Greaves1 originally proposed a two-step model of childhood
ALL. During the initial expansion of B-lineage cells in utero, a
spontaneous mutation arises in a B-precursor cell. Subsequently, as a
result of the proliferative drive to make antibody-producing B cells
against exogenous antigens in infancy and early childhood, a
leukemia-inducing secondary mutation occurs in a fetal-derived B-precursor cell carrying the initial mutation. In the Eµ-ret mouse,
the RFP/RET transgene acts as the first mutation in utero, producing
only a mild perturbation in fetal lymphopoiesis. However, the expansion
of the residual fetal pro-B cells in the immediate postnatal period
does not appear to be leukemogenic, but may serve to produce a
sufficient number of target cells in which leukemia-inducing secondary
mutations will subsequently occur. In support, we previously did not
observe changes in CYCLIN D1 and CASPASE-1 expression in healthy
Eµ-ret mice until several months after this initial expansion.9 Surprisingly, BCL-XL transgenic
mice do not develop B-lineage malignancies despite markedly expanding
the bone marrow with late pro-B cells.42 Thus, the RET/RFP
product may also play a role in inducing secondary mutations as a
consequence of its ability to enhance both proliferation and survival.
In conclusion, with its predisposition for developing leukemia with
features similar to childhood B-precursor ALL, the Eµ-ret mouse
provides a model of an in utero initiating event in the pathogenesis of leukemia.
| |
ACKNOWLEDGMENT |
The authors thank C.H. Pletcher and J.S. Moore for their technical
assistance and the use of the Flow Cytometry and Cell Sorter Facility
of the University of Pennsylvania Cancer Center; and S. Shinton for
technical assistance at the Fox Chase Cancer Center.
| |
FOOTNOTES |
Submitted July 15, 1998;
accepted August 26, 1998.
Supported by Grant No. DHP 176 from the American Cancer Society and by
the University of Pennsylvania Cancer Center Core Support Grant.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Robert Wasserman, MD, Division of Oncology,
The Children's Hospital of Philadelphia, 34th and Civic Center Blvd,
Philadelphia, PA 19104.
| |
REFERENCES |
1.
Greaves MF:
Speculations on the cause of childhood acute lymphoblastic leukemia.
Leukemia
2:120, 1988[Medline]
[Order article via Infotrieve]
2.
Gale KB, Ford AM, Repp R, Borkhardt A, Keller C, Eden OB, Greaves MF:
Backtracking leukemia to birth: Identification of clonotypic gene fusion sequences in neonatal blood spots.
Proc Natl Acad Sci USA
94:13950, 1997[Abstract/Free Full Text]
3.
Ford AM, Bennett CA, Price CM, Bruin MC, Van Wering ER, Greaves M:
Fetal origins of the TEL-AML1 fusion gene in identical twins with leukemia.
Proc Natl Acad Sci USA
95:4584, 1998[Abstract/Free Full Text]
4.
Wasserman R, Galili N, Ito Y, Reichard BA, Shane S, Rovera G:
Predominance of fetal type DJH joining in young children with B precursor lymphoblastic leukemia as evidence for an in utero transforming event.
J Exp Med
176:1577, 1992[Abstract/Free Full Text]
5.
Steenbergen EJ, Verhagen OJ, van Leeuwen EF, Behrendt H, Merle PA, Wester MR, von dem Borne AE, van der Schoot CE:
B precursor acute lymphoblastic leukemia third complementarity-determining regions predominantly represent an unbiased recombination repertoire: Leukemic transformation frequently occurs in fetal life.
Eur J Immunol
24:900, 1994[Medline]
[Order article via Infotrieve]
6.
Bodger MP, Janossy G, Bollum FJ, Burford GD, Hoffbrand AV:
The ontogeny of terminal deoxynucleotidyl transferase positive cells in the human fetus.
Blood
61:1125, 1983[Abstract/Free Full Text]
7.
Raaphorst FM, Timmers E, Kenter MJ, Van Tol MJ, Vossen JM, Schuurman RK:
Restricted utilization of germ-line VH3 genes and short diverse third complementarity-determining regions (CDR3) in human fetal B lymphocyte immunoglobulin heavy chain rearrangements.
Eur J Immunol
22:247, 1992[Medline]
[Order article via Infotrieve]
8.
Cuisinier AM, Gauthier L, Boubli L, Fougereau M, Tonnelle C:
Mechanisms that generate human immunoglobulin diversity operate from the 8th week of gestation in fetal liver.
Eur J Immunol
23:110, 1993[Medline]
[Order article via Infotrieve]
9.
Wasserman R, Zeng XX, Hardy RR:
The evolution of B precursor leukemia in the Eµ-ret mouse.
Blood
92:273, 1998[Abstract/Free Full Text]
10.
Gregoire KE, Goldschneider I, Barton RW, Bollum FJ:
Ontogeny of terminal deoxynucleotidyl transferase-positive cells in lymphohemopoietic tissues of rat and mouse.
J Immunol
123:1347, 1979[Abstract/Free Full Text]
11.
Feeney AJ:
Lack of N regions in fetal and neonatal mouse immunoglobulin V-D-J junctional sequences.
J Exp Med
172:1377, 1990[Abstract/Free Full Text]
12.
Li Y-S, Hayakawa K, Hardy RR:
The regulated expression of B lineage associated genes during B cell differentiation in bone marrow and fetal liver.
J Exp Med
178:951, 1993[Abstract/Free Full Text]
13.
Hardy RR, Carmack CE, Shinton SA, Kemp JD, Hayakawa K:
Resolution and characterization of pro-B and pre-pro-B cell stages in normal mouse bone marrow.
J Exp Med
173:1213, 1991[Abstract/Free Full Text]
14.
Kabat EA, Wu TT, Perry HM, Gottesman K, Foeller C:
Sequences of Proteins of Immunological Interest. Bethesda, MD, US Department of Health and Human Services, Public Health Service, National Institutes of Health, 1991.
15.
Chang Y, Paige CJ, Wu GE:
Enumeration and characterization of DJH structures in mouse fetal liver.
EMBO J
11:1891, 1992[Medline]
[Order article via Infotrieve]
16.
Feeney AJ, Riblet R:
DST4: A new, and probably the last, functional DH gene in the BALB/c mouse.
Immunogenetics
37:217, 1993[Medline]
[Order article via Infotrieve]
17.
Sakano H, Maki R, Kurosawa Y, Roeder W, Tonegawa S:
Two types of somatic recombination are necessary for the generation of complete immunoglobulin heavy-chain genes.
Nature
286:676, 1980[Medline]
[Order article via Infotrieve]
18.
Lafaille JJ, DeCloux A, Bonneville M, Takagaki Y, Tonegawa S:
Junctional sequences of T cell receptor gamma delta genes: Implications for gamma delta T cell lineages and for a novel intermediate of V-(D)-J joining.
Cell
59:859, 1989[Medline]
[Order article via Infotrieve]
19.
Gu H, Forster I, Rajewsky K:
Sequence homologies, N sequence insertion and JH gene utilization in VHDJH joining: Implications for the joining mechanism and the oncogenic timing of Ly1 B cell and B-CLL progenitor generation.
EMBO J
9:2133, 1990[Medline]
[Order article via Infotrieve]
20.
Reth M, Gehrmann P, Petrac E, Wiese P:
A novel VH to VHDJH joining mechanism in heavy-chain-negative (null) pre-B cells results in heavy-chain production.
Nature
322:840, 1986[Medline]
[Order article via Infotrieve]
21.
Kleinfield R, Hardy RR, Tarlinton D, Dangl J, Herzenberg LA, Weigert M:
Recombination between an expressed immunoglobulin heavy-chain gene and a germline variable gene segment in a Ly 1+ B-cell lymphoma.
Nature
322:843, 1986[Medline]
[Order article via Infotrieve]
22.
Bird J, Galili N, Link M, Stites D, Sklar J:
Continuing rearrangement but absence of somatic hypermutation in immunoglobulin genes of human B cell precursor leukemia.
J Exp Med
168:229, 1988[Abstract/Free Full Text]
23.
Wasserman R, Yamada M, Ito Y, Finger LR, Reichard BA, Shane S, Lange B, Rovera G:
VH gene rearrangement events can modify the immunoglobulin heavy chain during progression of B-lineage acute lymphoblastic leukemia.
Blood
79:223, 1992[Abstract/Free Full Text]
24.
Kitchingman GR:
Immunoglobulin heavy chain gene VH-D junctional diversity at diagnosis in patients with acute lymphoblastic leukemia.
Blood
81:775, 1993[Abstract/Free Full Text]
25.
Steenbergen EJ, Verhagen OJ, van Leeuwen EF, von dem Borne AE, van der Schoot CE:
Distinct ongoing Ig heavy chain rearrangement processes in childhood B-precursor acute lymphoblastic leukemia.
Blood
82:581, 1993[Abstract/Free Full Text]
26.
Mainville CA, Sheehan KM, Klaman LD, Giorgetti CA, Press JL, Brodeur PH:
Deletional mapping of fifteen mouse VH gene families reveals a common organization for three Igh haplotypes.
J Immunol
156:1038, 1996[Abstract]
27.
Nourrit F, Doyen N, Kourilsky P, Rougeon F, Cumano A:
Extensive junctional diversity of Ig heavy chain rearrangements generated in the progeny of single fetal multipotent hematopoietic cells in the absence of selection.
J Immunol
160:4254, 1998[Abstract/Free Full Text]
28.
Beishuizen A, Verhoeven MA, van Wering ER, Hahlen K, Hooijkaas H, van Dongen JJ:
Analysis of Ig and T-cell receptor genes in 40 childhood acute lymphoblastic leukemias at diagnosis and subsequent relapse: Implications for the detection of minimal residual disease by polymerase chain reaction analysis.
Blood
83:2238, 1994[Abstract/Free Full Text]
29.
Choi Y, Greenberg SJ, Du TL, Ward PM, Overturf PM, Brecher ML, Ballow M:
Clonal evolution in B-lineage acute lymphoblastic leukemia by contemporaneous VH-VH gene replacements and VH-DJH gene rearrangements.
Blood
87:2506, 1996[Abstract/Free Full Text]
30.
Davi F, Gocke C, Smith S, Sklar J:
Lymphocytic progenitor cell origin and clonal evolution of human B-lineage acute lymphoblastic leukemia.
Blood
88:609, 1996[Abstract/Free Full Text]
31.
Taniguchi M, Iwamoto T, Hamaguchi M, Matsuyama M, Takahashi M:
The ret oncogene products are membrane-bound glycoproteins phosphorylated on tyrosine residues in vivo.
Biochem Biophys Res Commun
181:416, 1991[Medline]
[Order article via Infotrieve]
32.
Taniguchi M, Iwamoto T, Nakashima I, Nakayama A, Ohbayashi M, Matsuyama M, Takahashi M:
Establishment and characterization of a malignant melanocytic tumor cell line expressing the ret oncogene.
Oncogene
7:1491, 1992[Medline]
[Order article via Infotrieve]
33.
Rolink A, Kudo A, Karasuyama H, Kikuchi Y, Melchers F:
Long-term proliferating early pre B cell lines and clones with the potential to develop to surface Ig-positive, mitogen reactive B cells in vitro and in vivo.
EMBO J
10:327, 1991[Medline]
[Order article via Infotrieve]
34.
Gattei V, Celetti A, Cerrato A, Degan M, De Iuliis A, Rossi FM, Chiappetta G, Consales C, Improta S, Zagonel V, Aldinucci D, Agosti V, Santoro M, Vecchio G, Pinto A, Grieco M:
Expression of the RET receptor tyrosine kinase and GDNFR-alpha in normal and leukemic human hematopoietic cells and stromal cells of the bone marrow microenvironment.
Blood
89:2925, 1997[Abstract/Free Full Text]
35.
Mak YF, Ponder BA:
RET oncogene.
Curr Opin Genet Dev
6:82, 1996[Medline]
[Order article via Infotrieve]
36.
Pachnis V, Mankoo B, Costantini F:
Expression of the c-ret proto-oncogene during mouse embryogenesis.
Development
119:1005, 1993[Abstract]
37.
Tsuzuki T, Takahashi M, Asai N, Iwashita T, Matsuyama M, Asai J:
Spatial and temporal expression of the ret proto-oncogene product in embryonic, infant and adult rat tissues.
Oncogene
10:191, 1995[Medline]
[Order article via Infotrieve]
38.
Chesi M, Nardini E, Brents LA, Schrock E, Ried T, Kuehl WM, Bergsagel PL:
Frequent translocation t(4;14)(p16.3;q32.3) in multiple myeloma is associated with increased expression and activating mutations of fibroblast growth factor receptor 3.
Nat Genet
16:260, 1997[Medline]
[Order article via Infotrieve]
39.
Xiao S, Nalabolu SR, Aster JC, Ma J, Abruzzo L, Jaffe ES, Stone R, Weissman SM, Hudson TJ, Fletcher JA:
FGFR1 is fused with a novel zinc-finger gene, ZNF198, in the t(8;13) leukaemia/lymphoma syndrome.
Nat Genet
18:84, 1998[Medline]
[Order article via Infotrieve]
40.
Popovici C, Adelaide J, Ollendorff V, Chaffanet M, Guasch G, Jacrot M, Leroux D, Birnbaum D, Pebusque MJ:
Fibroblast growth factor receptor 1 is fused to FIM in stem-cell myeloproliferative disorder with t(8;13).
Proc Natl Acad Sci USA
95:5712, 1998[Abstract/Free Full Text]
41.
Cao T, Borden KL, Freemont PS, Etkin LD:
Involvement of the rfp tripartite motif in protein-protein interactions and subcellular distribution.
J Cell Sci
110:1563, 1997[Abstract]
42.
Fang W, Mueller DL, Pennell CA, Rivard JJ, Li YS, Hardy RR, Schlissel MS, Behrens TW:
Frequent aberrant immunoglobulin gene rearrangements in pro-B cells revealed by a bcl-xL transgene.
Immunity
4:291, 1996[Medline]
[Order article via Infotrieve]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
D. L. McCormick and R. Kavet
Animal Models for the Study of Childhood Leukemia: Considerations for Model Identification and Optimization to Identify Potential Risk Factors
International Journal of Toxicology,
May 1, 2004;
23(3):
149 - 161.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
V. I. Brown, J. Fang, K. Alcorn, R. Barr, J. M. Kim, R. Wasserman, and S. A. Grupp
Rapamycin is active against B-precursor leukemia in vitro and in vivo, an effect that is modulated by IL-7-mediated signaling
PNAS,
December 9, 2003;
100(25):
15113 - 15118.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Top
Abstract
Introduction