|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 92 No. 10 (November 15), 1998:
pp. 3636-3646
Cloning and Characterization of the Human Interleukin-3 (IL-3)/IL-5/
Granulocyte-Macrophage Colony-Stimulating Factor Receptor c Gene:
Regulation by Ets Family Members
By
Thamar B. van Dijk,
Belinda Baltus,
Eric Caldenhoven,
Hiroshi Handa,
Jan A.M. Raaijmakers,
Jan-Willem J. Lammers,
Leo Koenderman, and
Rolf P. de Groot
From the Department of Pulmonary Diseases, University Hospital
Utrecht, Utrecht, The Netherlands; and the Faculty of Bioscience and
Biotechnology, Tokyo Institute of Technology, Midoriku, Yokohama,
Japan.
 |
ABSTRACT |
High-affinity receptors for interleukin-3 (IL-3), IL-5, and
granulocyte-macrophage colony-stimulating factor (GM-CSF) are composed
of two distinct subunits, a ligand-specific chain and a common chain ( c). Whereas the mouse has two homologous subunits ( c
and IL-3), in humans, only a single chain is identified. We
describe here the isolation and characterization of the gene encoding
the human IL-3/IL-5/GM-CSF receptor subunit. The gene spans about
25 kb and is divided into 14 exons, a structure very similar to that of
the murine c/ IL-3 genes. Surprisingly, we also found the remnants
of a second c chain gene directly downstream of c. We identified
a functional promoter that is active in the myeloid cell lines U937 and
HL-60, but not in HeLa cells. The proximal promoter region, located
from 103 to +33 bp, contains two GGAA consensus binding sites for
members of the Ets family. Single mutation of those sites reduces
promoter activity by 70% to 90%. The 5 element specifically
binds PU.1, whereas the 3 element binds a yet-unidentified
protein. These findings, together with the observation that
cotransfection of PU.1 and other Ets family members enhances c
promoter activity in fibroblasts, reinforce the notion that GGAA
elements play an important role in myeloid-specific gene regulation.
© 1998 by The American Society of Hematology.
 |
INTRODUCTION |
PROLIFERATION AND differentiation of
hematopoietic progenitors is regulated by cytokines that are produced
by a wide variety of cell types. Among these cytokines, interleukin-3
(IL-3), IL-5, and granulocyte-macrophage colony-stimulating factor
(GM-CSF) are produced by a variety of cell types, including activated T cells and mast cells, and play an important role in hematopoiesis as
well as in inflammatory reactions.1,2 Both IL-3 and GM-CSF act on various lineages of hematopoietic cells,2,3 whereas IL-5 is a more lineage-restricted cytokine that acts mainly on eosinophils, basophils, and, in the mouse, some B cells.4,5 Although IL-3, IL-5, and GM-CSF show no amino acid homology, they have
striking similarities; their genes are linked on human chromosome 5,2 they induce the phosphorylation of similar
proteins,6,7 they compete with each other in binding to
their high-affinity receptors in humans,8,9 and they have
overlapping biological functions.2
Cloning of the receptor components and the reconstitution of functional
receptors for IL-3, IL-5, and GM-CSF has shown that the receptors are
heterodimers composed of a cytokine-specific chain (IL3-R ,
IL-5R , and GM-CSFR ) and a common chain
( c).10-12 Although the human c subunit has no binding
capacity by itself, it forms a high-affinity receptor complex by
association with the low-affinity chains. Besides its
role in high-affinity binding, the c chain plays a major role in
IL-3-, IL-5-, and GM-CSF-mediated signal
transduction.13,14 Therefore, the common use of the c
subunit by IL-3, IL-5, and GM-CSF explains the observed partial functional redundancy of these cytokines.15 However, when
the entire cytoplasmic domain of the IL-5R is deleted, intracellular signaling is blocked, indicating that the chain is also involved in
signaling.16,17
In contrast with humans, the mouse has two subunits, known as c
(AIC2B) and IL-3 (AIC2A).18,19 Analogous to the human c, the mouse c chain is the common subunit for the mouse
IL-3, IL-5, and GM-CSF receptors. Although c and IL-3 have 91%
homology at the amino acid level, only IL-3 binds IL-3 with low
affinity and does not form a high-affinity receptor with IL-5R and
GM-CSFR . The genes encoding c and IL-3 are located within 250 kb on mouse chromosome 15, and their genomic organization is almost
identical. Both genes consist of 14 exons and span about 28 kb each.
Furthermore, their 5 sequences are also well-conserved.20
These observations have led to the speculation that the two genes are
products of a gene duplication event that occurred after the divergence
of mice and humans.
Because the expression of cytokine receptors, including those for IL-3,
IL-5, and GM-CSF, is generally restricted to hematopoietic cells, their
expression has to be regulated in a cell-type-specific manner. In
vitro development of murine embryonic stem (ES) cells or day-3.5 murine
blastocysts, used as a model for the earliest steps of hematopoietic
stem cell formation during embryogenesis,21,22 has shown
that ES cells and day-3.5 blastocysts express no detectable IL-3 or
c mRNA. However, the transcription of the two subunits is
dramatically increased after 7 to 9 days in culture, consistent with
the time of blood island formation and the induction of the CD34
gene.23 Because IL-3 stimulates multipotential progenitor cells (for review, see Ogawa24), it is not surprising that
CD34+ cells isolated from human bone marrow (BM) and cord
blood25 and murine c-kit+ BM
cells26 express the c subunit(s). However, at later
stages of development, expression of the c chain is mainly
restricted to the myeloid lineages. In the lymphoid compartment,
expression is only found in a minor fraction of cells with the B-cell
marker CD19, but not in cells with the T-cell marker CD3.25
Although it is clear that the expression of the c subunit is tightly
controlled, nothing is known about the molecular mechanisms underlying
this regulation. Cloning and characterization of the regulating
sequences of the c gene should shed light on the cell-specific expression. Furthermore, knowledge of c subunit expression can lead
to novel leads in the treatment of IL-3/IL-5/GM-CSF signaling-related diseases, such as leukemia, and inflammatory diseases. To study c
gene expression, we have cloned and characterized the human c locus.
We show here that the genomic organization of the gene is highly
homologous to the mouse AIC2A and AIC2B genes and that Ets family
members, including PU.1, are involved in the regulation of its basal
expression. Furthermore, our results also indicate that the human may
have had a second chain gene.
 |
MATERIALS AND METHODS |
Library screens.
Two human genomic libraries, prepared from placental DNA in the
EMBL3 and DASH vectors (Stratagene, La Jolla, CA), were screened
with the 868-bp EcoRI-Ava I (bp 2 to 869) fragment of the human c chain cDNA11 according to standard
techniques. The human chromosome 22-specific cosmid library LL22NC03 (a
kind gift of Dr P.H.J. Riegman, Dept. of Pathology,
Erasmus University, Rotterdam, The Netherlands)27 was
screened with the 275-bp EcoRI-Bgl I (bp 2 to 276)
fragment of the human c chain cDNA. A genomic HincII
fragment of 1,900 bp (containing exons p-2 and p-3) isolated from the
cosmid library was used to screen a bacterial artificial chromosome
(BAC) library. This screen was performed by Genome Systems, Inc (St
Louis, MO). One positive clone [BACH-249 (A21)] was detected and
further analyzed.
Isolation and subcloning of genomic clones.
DNA of positive phage/cosmid/BAC clones was digested with various
restriction enzymes, separated on 0.4% to 0.7% agarose gels, blotted
to nitrocellulose, and hybridized with various fragments of c chain
cDNA or exon-specific oligonucleotide probes. cDNA probes were labeled
with [ -32P]dCTP using a random priming labeling kit
(Pharmacia Biotech, Uppsala, Sweden) and hybridized for 16 hours at
42°C in standard 50% formamide buffer. Oligonucleotide probes were
labeled with [ -32P]dATP by T4 polynucleotide kinase
and hybridized for 16 hours at 42°C in 6× standard sodium
citrate, 0.5% sodium dodecyl sulphate, 5× Denhardts' reagent,
and 0.1 mg/mL ssDNA. Positive fragments were subcloned in pBluescript
II SK( ) (Stratagene).
Polymerase chain reaction (PCR) and DNA sequencing.
Oligonucleotide primers corresponding to the 5 and 3
sequences of each exon (based on the organization of the murine
c/IL-3 chain genes) were used for polymerase chain reactions to
estimate the intron lengths. DNA and BAC DNA served as templates (1 ng), using 100 ng of each primer in a reaction volume of 100 µL. For fragments 1,500 bp, reactions were performed for 30 cycles (1 minute
at 95°C, 1.5 minutes at 46°C or 52°C, and 2 minutes at 72°C) using AmpliTaq (Perkin-Elmer, Branchburg, NJ). For fragments greater than 1,500 bp, reactions were performed for 30 cycles (1 minute
at 95°C, 1.5 minutes at 46°C or 52°C, and 8 minutes at
68°C) using the Expand PCR kit (Boehringer Mannheim, Mannheim, Germany). Products were analyzed by electrophoresis on a 1% agarose gel. Fragments were subcloned using the pGEM-T cloning kit (Promega, Leiden, The Netherlands), according to the manufacturer's
instructions.
Supercoiled plasmid DNA was alkaline-denatured and sequenced by the
dideoxy chain termination method using T7 polymerase sequencing kit
(Pharmacia). Oligonucleotide primers used were from the flanking regions of the vector (T3 and T7), cDNA sequence, or from the intron
sequence obtained.
RNAse protection and 5 RACE.
RNAse protection analysis was performed according to Melton et
al.28 Ten micrograms of total RNA derived from U937, HL-60, THP-1, TF-1, and HeLa cells was hybridized to 32P-labeled
complementary RNA probes derived from the human c gene. After RNase
digestion of the single-strand transcripts, protected fragments were
separated on a sequencing gel. A set of sequence reactions was loaded
to determine the lengths of the protected fragments. HeLa and yeast
tRNA served as a negative control. The 5 RACE was performed
using the Marathon cDNA amplification kit according to the
manufacturer's instructions (Clontech, Palo Alto, CA), using 1 µg of
HL-60-derived polyA+ RNA.
Cells, plasmids, oligonucleotides, and antibodies.
COS-1 and HeLa cells were cultured in Dulbecco's modified Eagle medium
(DMEM; Life Technologies, Breda, The Netherlands) supplemented with 8%
heat-inactivated fetal calf serum (FCS; Life Technologies). The
monocytic cell line U937, the promyelocytic leukemia cell line HL-60,
erythroleukemia TF-1 cells, and monocytic THP1 cells were maintained in
RPMI 1640 (Life Technologies) supplemented with 8% FetalClone I
(HyClone, Logan, UT).
The complete cDNA of PU.129 was cloned in the expression
vector pSG5 (Stratagene). Expression vectors for cEts-1,
GABP /E4TF1-60, and GABP 1/E4TF1-53 are described previously
(Coffer et al30 and Watanabe et al,31
respectively).
The following oligonucleotides were used in this study: for
site-directed mutagenesis of the GGAA element 65, 65mut
(GGGCCGGCACTGCTAGATCTTTCTGCTTCTC) and the GGAA element
45, 45mut (TTTCTGCTTCTCTGATATCTGATGACATCAAC); for band-shift analysis (only upper strand is shown), 65
(AGCTTCCGGCACTGCTTCCTCTTTCTGCTA) and 45
(AGCTTGCTTCTCTGTTTCCTGATGACATCA).
The following antibodies were used in this study: anti-Ets-1 (N-276,
sc-111X; Santa Cruz, Santa Cruz, CA), anti-Ets-2 (C-20, sc-351X; Santa
Cruz), anti-Fli-1 (C-19, sc-356X; Santa Cruz), anti-PU.1 (T-21,
SC-352X; Santa Cruz), anti-ATF3 (C19, sc-188X; Santa Cruz), and
anti-GABP (rabbit polyclonal, a generous gift from S.L. McKnight,
Tularik, South San Francisco, CA).
Plasmids for promoter analysis, transient transfection, and CAT
assay.
The BAC 2.7-kb HinDIII fragment hybridizing with an exon 1 specific oligonucleotide was subcloned into the HinDIII site of the promoterless pBLCAT3 vector32 in both orientations and
sequenced. This construct was used as a template for the PCR-based
deletion constructs 358/+33, 226/+33, and 103/+33.
These constructs were cloned into the Xba I-BamHI sites
of pBLCAT3. Site-directed mutagenesis was performed according to
Kunkel.33
For transfection experiments, COS-1 cells were cultured in six-well
dishes (Nunc, Naperville, IL); 3 hours later, the cells were
transfected with 6 to 8 µg of supercoiled plasmid DNA, as described
previously.34,35 HeLa cells were transfected 16 hours after
splitting. After 16 to 20 hours of exposure to the calcium-phosphate precipitate, medium was refreshed. Cells were harvested for CAT assays
24 hours later. Transfection of U937 and HL-60 cells was performed by
electroporation at 300 V and 960 µF (107 cells, 20 µg
supercoiled plasmid DNA). Two days after transfection, cells were
harvested for CAT assays. CAT assays were performed as described
previously.36 LacZ determination was used to correct for
transfection efficiency.
Gel retardation assay.
Nuclear extracts were prepared from U937, HL-60, and COS-1 cells
following a previously described procedure.37
Oligonucleotide probes were labeled by filling in the cohesive ends
with [ -32P]dCTP using Klenow fragment of DNA
polymerase I. Gel retardation assays were performed as described
previously.38 In supershift experiments, 2 µg of antibody
was added to the extracts on ice, 45 minutes before the addition of the
probe.
 |
RESULTS |
Isolation and organization of the IL-3/IL-5/GM-CSF receptor c gene.
To isolate the genomic sequences of the human IL-3/IL-5/GM-CSF receptor
c gene, we initially screened a human genomic EMBL3 library with
the 868-bp EcoRI-Ava I fragment of the c
cDNA.11 The positive clone obtained ( 12) contained exons
4 to 14 (Fig 1A). To isolate exons 1 through 3 and upstream sequences, we screened the chromosome
22-specific cosmid library LL22NC03 with the 275-bp EcoRI-Bgl I probe. One positive (43B4) was shown to
contain exons 2 and 3. Nevertheless, the sequences of these regions
shared only about 85% and 95% homology with the cDNA, respectively
(Fig 1B), highly suggesting that these exons were obtained from a
pseudogene (see below).

View larger version (14K):
[in this window]
[in a new window]

View larger version (61K):
[in this window]
[in a new window]
| Fig 1.
Schematic representation of the human IL-3/IL-5/GM-CSFR
chain gene and the remains of a c pseudogene. (A) The c chain
gene spans 25 kb and is divided into 14 exons, while of the pseudogene,
only a part of the promoter and exons 2, 3, and 4 are identified
(p-prom, p-2, p-3, and p-4). Coding regions are shown in black,
noncoding are shown regions in gray. The phage, cosmid, and BAC clones
used to characterize the locus are also indicated. (B) Alignment of the
homologous regions of the c chain gene and the pseudogene. The upper
strand represents the c chain sequence (numbers are relative to the
transcription start site); the lower strand represents the pseudogene
sequence (numbers are according to BAC clone F45C1). The translation
start site is boxed (exon2). The p-promoter region, p-exon2, p-exon3,
and p-exon4 have homology of 80%, 85%, 95%, and 89% with the c
gene, respectively.
|
|
Because exon 1 was not present in the cosmid clones, a BAC library was
screened, leading to the identification of one positive clone, which
appeared to contain the whole c gene. As shown in the schematic
diagram (Fig 1A), the estimated length of the gene is approximately 25 kb. The gene contains 13 introns, and all the sequences of intron-exon
boundaries conform to the consensus sequences of
eukaryotic splice junctions (Table 1).
Because of unknown technological problems, we were not able to
characterize the 3 sequence of intron 1.
The length of the gene and the number of exons are not the only
striking similarities between the human c and murine c/ IL-3 genes. Exon 1 encodes 5 -untranslated sequences, and exon 2 encodes more 5 -untranslated sequences and the start of the open
reading frame. The extracellular domain is encoded by 9 exons (exon 2 to 10), the transmembrane domains are on the 11th exon and cytoplasmic domain by three exons (exon 12 through 14). Exon 14 also contains the
3 untranslated sequences. Also, the relative lengths of the introns are very comparable between mice and humans.
The remains of a second c gene?
Interestingly, the mutated exons 2 and 3 identified in cosmid 43B4 were
also found in the BAC. Furthermore, in both the BAC and cosmid clones,
a region homologous to exon 4 was also found (89% homology; Fig 1B).
Interestingly, a BLAST search identified a cosmid clone F45C1 (GenBank
accession no. Z75892) that is (at least partially) identical to our
cosmid clone 43B4. The complete sequence of cosmid F45C1 is available
in the GenBank and confirmed the genomic organization of the exons 11 to 14 and the localization of a pseudo chain gene, as depicted in
Fig 1A.
The 5 flanking region.
To identify the functional promoter of the c chain gene, a 2.7-kb
HinDIII fragment hybridizing with an exon 1-specific
oligonucleotide was cloned and completely sequenced (GenBank accession
no. AF069543). Computer analysis showed a TATA-box (TFIID/TBP binding
site) and a cap sequence that were also found in the murine sequence.
To localize the transcription start site(s), we performed an RNase protection assay with total RNA from HL-60, U937, TF-1, THP-1, and HeLa
(negative control) cells and used a genomic sequence that contained
exon1 as a probe. Figure 2A shows that
fragments of 44, 45, 50, and 58 bp are protected in c
subunit-expressing cells but not in HeLa cells. The integrity of these
start sites was confirmed by 5 RACE analysis using
polyA+ RNA from HL-60 cells (data not shown). These results
indicate that multiple initiation sites are used at 11, 19, 24, and 25 bp from the putative TATA box (Fig 2B). Alignment of the human and
murine sequences (Fig 2B) showed the high degree of homology of the
promoter proximal regions, including the first exon. We therefore
placed the +1 at the same position as the major transcription start
site found in the murine genes, corresponding to the 44-bp protected
fragment.

View larger version (95K):
[in this window]
[in a new window]

View larger version (60K):
[in this window]
[in a new window]
| Fig 2.
RNase protection and sequence alignment of the proximal
promoter region of the human and mouse c chain genes. (A) RNase
protection was used to determine transcription start sites. Specific
protected fragments of 44, 45, 50, and 58 nucleotides were observed in
c expressing HL-60, butyric acid (BA)-treated HL-60, U937, TF-1, and
THP-1 cell lines, but not in the HeLa and tRNA control lanes. The
integrity of these start sites was confirmed by 5 RACE analysis
on HL-60-derived polyA+ RNA. (B) The putative TFIID/TBP
binding sites are indicated in boldface and underlined, the first exons
are indicated in bold face, and transcription start sites, identified
by RNase protection and 5 RACE, are indicated by asterisks.
Several putative binding sites for different transcription factor
families, including cEts, cMyb, MZF-1, GATA-1, STAT, cMyc, and C/EBP
are identified in the human sequence. Ets-binding sites studied in this
report are named 65 and 45 and are indicated in boldface.
Furthermore, these elements are conserved in the murine sequence.
|
|
Searching the TFMATRIX transcription factor database
(http://pdap1.trc.rwcp.or.jp/research/db/TFSEARCH.html), putative
binding sites were identified throughout the 2.7-kb fragment. In the
proximal promoter region from 495 to +54 relative to the
transcription start site, these include binding sites for the
transcription factor families of cEts, STAT, cMyc, Myb, GATA, and C/EBP
(Fig 2B).
The functionally active promoter region is cell-type specific.
To study whether the sequences upstream of exon 1 had promoter
activity, the 2.7-kb HinDIII fragment was cloned into the
promoterless CAT-vector pBLCAT3 in both forward (F) and reverse (R)
orientation. The plasmids, 2100/+600CAT-F and
2100/+600CAT-R, were transfected into the monocytic cell line
U937, the promyelocytic leukemia cell line HL-60, and the cell lines
COS-1 and HeLa. CAT activity was measured 2 days after transfection. As
shown in Fig 3, CAT activity was clearly
detected in U937, HL-60, and COS-1 cells transfected with
2100/+600CAT-F (F), but not in HeLa cells or cells transfected
with 2100/+600CAT-R (R). As a negative control, we used the
empty pBLCAT3 vector (V). As a positive control for HeLa cell
transfection, we used CAT plasmids with the RSV promoter. The results
indicate that the 2.7-kb HinDIII fragment contains a functional
promoter with some degree of cell-type-specific activity.

View larger version (18K):
[in this window]
[in a new window]
| Fig 3.
The c chain promoter has cell-type-specific activity.
The 2.7-kb HinDIII fragment was cloned into pBLCAT3 in both
forward (F) and reverse (R) orientation and subsequently transfected
into U937, HL-60, COS-1, and HeLa cells. Empty vector (V) was used as a
negative control; a CAT reporter plasmid driven by an RSV promoter was
used as a positive control (RSV). Promoter activity can only be
detected in U937, HL-60, and COS-1 cells transfected with the forward
construct, indicating that the 2.7-kb HinDIII fragment contains
a functional promoter. Values are the mean of at least four independent
experiments; the error bars indicate the standard deviation. LacZ
determination was used to correct for transfection efficiency.
|
|
GGAA elements are essential for promoter activity.
To determine the functionally important regions of the c chain
promoter, PCR-based deletion mutants were constructed. As shown in
Fig 4, the deletion constructs
358/+33CAT, 226/+33CAT, and 103/+33CAT, which also
lack the intron sequences, still had high promoter activity in HL-60
and U937 cells (endpoints of these constructs are indicated in Fig 2B).
This indicates that an important cis-acting element(s) is located
within the first 103 bp upstream of the transcription start site.
Further examination of the promoter sequence showed that at least five
putative cEts/PU.1 binding sites could be identified in the human
proximal promoter region (Fig 2B). To test whether these sites could
play a role in promoter regulation, the constructs 226/+33CAT,
103/+33CAT, and also 2100/+600 were cotransfected with
the cDNAs of several Ets family members into COS-1 cells. As shown in
Fig 5A, cotransfection of cEts-1 or PU.1
led to an 8 to 10 times increase of promoter activity of the constructs
2100/+600 and 226/+33CAT. Also, the activity of
103/+33CAT was induced by cEts-1 and PU.1, although only
threefold. This was due to the high background level of this construct
in COS-1 cells (data not shown). Overexpression of the related Ets family member GABP also resulted in increased promoter activity of
103/+33CAT (Fig 5A).

View larger version (39K):
[in this window]
[in a new window]
| Fig 4.
The proximal promoter contains important regulating
sequences. Promoter constructs 2100/+600, 358/+33,
226/+33, and 103/+33 were transfected into HL-60 cells. Empty
vector pBLCAT3 was used as a negative control. All constructs have high
promoter activity, indicating that positively regulating elements are
located within the first 103 bp of the proximal promoter. Values are
the mean of at least four independent experiments; the error bars
indicate the standard deviation. LacZ determination was used to correct
for transfection efficiency. No difference was observed between HL-60
and U937 cells (not shown).
|
|

View larger version (24K):
[in this window]
[in a new window]

View larger version (27K):
[in this window]
[in a new window]

View larger version (48K):
[in this window]
[in a new window]
| Fig 5.
GGAA binding proteins regulate c chain promoter
activity. (A) Cotransfection of Ets family members cEts-1, PU.1, and
GABP enhances promoter activity in fibroblasts. COS-1 cells were
transfected with 2 µg of promoter and 6 µg of Ets expression vector
or pSG5 (negative control). Promoter activity of the constructs
2100/+600 and 226/+33 is enhanced 8 to 10 times, whereas
construct 103/+33 is activated only 3 times, probably due to the
high basal activity of 103/+33 in COS cells. ( ) pSG5; ( )
cEts; ( ) PU.1; ( ) GABP + . (B) Ets-binding sites 65 and
45 are crucial for promoter activity. Both binding sites were
mutated in the 103/+33 construct and tested for promoter activity.
Both single mutations and the double mutation show a clear decrease in
promoter function in both U937 and HL-60 cells. Values are the mean of
at least four independent experiments; the error bars indicate the
standard deviation. LacZ determination was used to correct for
transfection efficiency. (C) Point mutations in Ets-binding sites 65
and 45 prevent binding of several protein complexes. The
103/+33 fragments were used in a band shift assay, using 10 µg
of nuclear extract HL-60 cells. When site 65 is mutated, complexes
C2 and C3 are no longer observed (lanes 2 and 4), whereas binding of C1
is also decreased. Mutation of site 45 prevents complex C4 from
binding (lanes 3 and 4). Similar results were obtained when using U937
cells (data not shown).
|
|
The fragment 103/+33 contains two GGAA elements, one at bp
44 to 47 (named 45) and the other at bp 65
to 68 (named 65). These two elements are also present in
the murine promoter sequence,20 whereas the three
additional elements in construct 495/+54 are not conserved in
the mouse promoter. To elucidate whether the cEts/PU.1 binding elements
are functionally important, both cEts/PU.1 sites were mutated in the
103/+33CAT construct. Single mutation of the 65 site
resulted in a decrease of promoter activity of more than 70% in both
U937 and HL-60 cells (Fig 5B). When only the 45 site is mutated,
promoter activity is decreased by 90% to 95%. When both sites were
mutated, no additional effects could be measured. These data show that
both elements are essential for promoter activity and suggest the
cooperation of the proteins binding to the elements. It should be noted
that some residual activity of the double mutant could be detected in
U937 cells, in contrast to HL-60 cells.
To study whether the mutations at 65 and 45 indeed
resulted in a change in proteins binding to the c promoter, we
performed band shift analysis using the 103/+33 bp fragments as
probe (Fig 5C). As was expected, the mutations prevented binding of
different protein complexes (complexes C2 and C3 for mutation
65, while also binding of C1 is moderately affected; complex C4
for mutation 45). Moreover, they did not artificially form a
site for another specific binding activity. These results show that two
different GGAA elements play a major role in the regulation of the c
chain gene promoter. Interestingly, these results also suggest that both elements independently bind different proteins, because the complex binding to 45 has a lower mobility than the complexes binding to 65.
PU.1 and another GGAA-binding protein bind to the c promoter.
Because the proteins binding to several GGAA-elements in other
myeloid-specific promoters are well characterized, sequences of those
elements were aligned with 65 and 45. As shown in
Table 2, the sequences flanking the
well-conserved GGAA core are highly diverse. It is therefore not
possible to predict which Ets protein binds to a certain GGAA element.
Therefore, band shift analysis was used to further study the proteins
binding to the elements 65 and 45. As shown in
Fig 6A, element 65 was indeed able
to bind several protein complexes (lane 1). Binding of the observed complexes was specific, because binding could be competed with a 10 to
100 molar excess of cold self oligo, but not with mutant oligo (lanes 2 and 3 and lanes 4 and 5, respectively). Binding could also be competed
with an element from the G-CSFR promoter that specifically binds PU.1
(lanes 6 and 7, see also Table 2, G-CSFR 5 ), an oligo that binds
E4TF1/GABP (lanes 8 and 9, see also Table 2), but not with element
45, again indicating that 65 and 45 bind different
proteins. These results further show that PU.1 and GABP are possible
candidates to bind to 65. To further identify the protein
binding to 65, extracts were preincubated with specific
antibodies against Ets family members that are implicated in
hematopoietic gene regulation, including Ets-1, Ets-2, Fli-1, PU.1, and
GABP .39 Anti-ATF3 was used as a negative
control. Figure 6B shows that all complexes are shifted after the
addition of anti-PU.1, clearly demonstrating that PU.1 is binding to
65. Also, the addition of anti-GABP results in a weak
supershifted complex (indicated by an arrow), but this complex was also
observed in the absence of nuclear extract (data not shown). Band shift assays were also performed with nuclear extracts of COS cells transfected with PU.1 and GABP cDNA. Overexpressed PU.1 strongly binds to 65 and comigrates with the most prominent complex
observed in HL-60 and U937 cells, whereas GABP did not bind to
65 (data not shown). All together, these results show that the
complexes binding to 65 contain PU.1. The less prominent and
faster migrating complexes might represent different phosphorylation
states of PU.1, as were previously observed.40

View larger version (54K):
[in this window]
[in a new window]
| Fig 6.
GGAA element 65 specifically binds PU.1. (A) An
oligonucleotide encompassing the Ets-binding site 65 was used in a
band shift assay with nuclear extracts of HL-60 cells. One prominent
and several minor complexes are observed (lane 1). All complexes can be
competed with a 10- to 100-fold molar excess of cold self oligo (lanes
2 and 3), but not with mutant oligo (lanes 4 and 5), indicating that
the complexes bind specifically. Binding is also inhibited by addition
of the PU.1 binding element of the G-CSFR and by E4TF1, a sequence that
binds GABP, but not by element 45 (lanes 6 through 11). (B) To
identify the protein(s) binding to 65, 2 µg of specific antibody
against different Ets family members was added before the addition of
the probe. Anti-ATF3 was used as a negative control. Complexes are only
supershifted when anti-PU.1 is added (lane 5). The arrow
indicates a nonspecific complex that appears after addition of
anti-GABP (lane 6). However, this complex is also observed when no
nuclear extract is added (data not shown). These results show that PU.1
binds to element 65. Similar results were obtained when using U937
cells (data not shown).
|
|
The same procedure was followed to characterize the proteins binding to
element 45. In extracts of HL-60 and U937 cells, binding of a
number of complexes was observed (Fig 7A,
lane 1), of which complexes C2, C3, and C4 could be competed by
addition of cold self oligo (lanes 2 and 3). However, binding of C2 and C3 could also be inhibited by mutant 45 oligo, as well as by the
E4TF1, 65, and PU.1 oligonucleotides (lanes 4 through 11), suggesting that C2 and C3 are nonspecific complexes. Complexes C1 and
C5 are also nonspecific, because the addition of cold self oligo did
not affect binding of these complexes. Supershift analysis showed that
C4 is a complex containing PU.1, explaining why binding of this complex
could be inhibited by addition of excess self-, E4TF1-, PU.1-, and
65 oligo, but not by mutant 45 oligo. Nevertheless, previous experiments, together with the observation that overexpressed PU.1 only weakly binds to 45, have indicated that PU.1 is likely not the most prominent protein that binds to this element.
Interestingly, longer exposure of the same gel led to the
identification of two complexes (C6 and C7, Fig 7B), running with lower
mobility than C1 in Fig 7A, that only could be competed with cold self
oligo (lanes 2 and 3 and 4 through 11). Repetitive experiments showed that these complexes were present in U937 and HL-60 cells and that
binding was highly sensitive to freeze-thawing (data not shown).
Furthermore, the complexes could not be supershifted with antibodies
against Ets-1, Ets-2, Fli-1, PU.1, and GABP (data not shown) These
results show that a yet-unidentified protein and, to a lesser extent,
PU.1 bind to the 3 GGAA-element in the promoter proximal region.

View larger version (49K):
[in this window]
[in a new window]
| Fig 7.
GGAA-element 45 binds an unidentified protein. (A) An
oligonucleotide encompassing the Ets-binding site 45 was used in a
band shift assay with nuclear extracts of HL-60 cells. Five complexes
(C1 through C5) bound to 45 (lane 1), of which C2, C3, and C4 could
be competed with excess of self oligo (lanes 2 and 3). Complexes C1 and
C5 were nonspecific, because these complexes could not be competed.
Moreover, C2 and C3 were also nonspecific, because they could be
competed with mutant oligo (lanes 4 and 5). With supershift analysis it
was shown that C4 contains PU.1 (not shown), explaining why binding of
C4 was blocked by the addition of 45, E4TF1, 65, and PU.1
oligonucleotides. Similar results were obtained when using U937 cells
(data not shown). (B) Longer exposure of the gel shown in (A). Binding
of two complexes with low mobility (C6 and C7) was detected. Binding of
these complexes could be inhibited with excess of self oligo only,
showing the binding specificity of these complexes. These complexes
could not be supershifted with antibodies against Ets-1, Ets-2, Fli-1,
PU.1, and GABP . Similar results were obtained when using U937 cells
(data not shown).
|
|
 |
DISCUSSION |
Early hematopoietic CD34+ cells stem cells express the c
subunit,25 which is the main signaling component of the
IL-3, IL-5, and GM-CSF receptors. However, at later stages of
differentiation, expression of the c chain is mainly restricted to
the myeloid lineages. Uncovering the molecular mechanisms that drive
its expression will contribute to the understanding of the events of
myeloid commitment and differentiation. Because nothing is known about its organization, we have cloned and characterized the human c gene
and its regulating sequences.
In our initial genomic library screen, only a single clone, containing
region from exon 4 to exon 14, was isolated. Screening of several
genomic phage libraries, a chromosome 22-specific cosmid library, and a
P1 genomic library did not lead to the cloning of more upstream
sequences. This shows that the region containing the c gene, 22q12.2
to 22q13.1,41 does not efficiently integrate in a cloning
vector. Interestingly, Collins et al42 were not able to
clone the regions 22q11 and 22q13 into YACs, probably due to extensive
low-copy repeats and the high G+C content,
respectively.43,44
A unique feature of the evolution of the subunits of the IL-3,
IL-5, and GM-CSF receptors is that, in the human system, only one chain is expressed that is shared by the three
receptors.10-12 In contrast, in the mouse, two distinct but
homologous subunits are identified: one (AIC2A) specific for
IL-319 and the other (AIC2B) equivalent to the human c
chain.18 The absence of a second human chain as well as
the high degree of sequence homology and the close linkage between the
AIC2A and AIC2B genes has led to the hypothesis that the AIC2A gene has
arisen from a gene duplication that occurred after divergence between
mice and humans.20 Unraveling of the genomic structure of
the human c gene indeed showed a high degree of homology with the
murine c and IL-3 genes. The structural organization, length, and
number of exons are identical, while also the total length of the
genes, the sequences of the intron-exon junctions, the length of the
introns, and the promoter proximal region, including TATA-box and
transcription start site, are closely related. RNase protection and
5 RACE showed the existence of several transcription start
sites, all close to the putative TATA box. Whether the TATA box is
functional or the basal transcription machinery is recruited by Ets
factors binding to adjacent elements remains unclear at this point.
Interestingly, 3 of the c gene we also found a region
containing sequences highly homologous to the 5 upstream region
and exons 2, 3, and 4 of the c gene. This strongly suggests that a
gene-duplication occurred before the divergence of human and mouse. In
the mouse, these two genes evolved to c and IL-3, whereas in the
human, chromosomal mutations and reorganizations destroyed one of the
two genes. On the other hand, it cannot be ruled out that the pseudo
gene is the result of a human-specific duplication event, in which only
the first few exons are duplicated.
When linked to a promoterless CAT gene, the 2.7-kb HinDIII
fragment ( 2100/+600CAT) directed transcription in human myeloid U937 and HL-60 cells and in monkey COS-1 fibroblasts, but not in human
cervical carcinoma cells (HeLa). These results indicate that the 2.7-kb
HinDIII fragment contains the promoter that functions in a
cell-specific, but not hematopoietic-specific manner. Putative binding
sites for hematopoietic specific transcription factors (TFs), including
those for GATA, C/EBP, Myb, and MZF, as well as those for more general
expressed TFs such as cEts, Sp1, and AP-1, can be found throughout the
2100/+600 sequence. Also, recognition sequences for the
inducible TFs, such as STAT and NF B, are detected. These sites could
be of interest, because interferon- (IFN- ), erythropoietin (EPO),
stem cell factor (SCF), IL-3, and tumor necrosis factor
(TNF ) have been described to enhance c
expression.25,45-47 Further studies are necessary to
address whether one of the STAT and/or NF B sites are
functional. On the other hand, important regulating sequences have to
be present in the proximal promoter region, because deletion constructs
358/+33CAT, 226/+33CAT, and 103/+33CAT exhibit
maximal promoter activity. Within the proximal promoter sequence,
several putative cEts binding sites can be identified.
PU.1 (Spi-1) is a member of the Ets transcription factor family and its
expression is restricted to hematopoietic cells.29 PU.1 has
been implicated in the regulation of different myeloid-specific genes,
including macrophage colony-stimulating factor receptor (M-CSFR),48 granulocyte colony-stimulating factor receptor
(G-CSFR),49 GM-CSFR ,50
neutrophil elastase,51 myeloperoxidase,52 and eosinophil-derived neurotoxin (EDN).38 Other Ets factors,
including the more widely expressed GABP/E4TF1,38,53 were
al |