|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 92 No. 10 (November 15), 1998:
pp. 3647-3657
Flt3 Ligand Promotes the Generation of a Distinct CD34+
Human Natural Killer Cell Progenitor That Responds to Interleukin-15
By
Haixin Yu,
Todd A. Fehniger,
Pascal Fuchshuber,
Karl S. Thiel,
Eric Vivier,
William E. Carson, and
Michael A. Caligiuri
From the Divisions of Human Cancer Genetics, Hematology/Oncology, and
Surgical Oncology, Department of Pathology, and the Comprehensive
Cancer Center of The Ohio State University, Columbus, OH; the Division
of Surgical Oncology, Roswell Park Cancer Institute, Buffalo, NY; and
the Centre d'Immunologie Institut National de la Santé et de la
Recherche Médicale/Centre National de la Recherche Scientifique
de Marseille-Luminy, Institut Universitaire de France,
Marseille, France.
 |
ABSTRACT |
Interleukin-15 (IL-15) is produced by human bone marrow (BM) stromal
cells and can induce CD34+ hematopoietic progenitor cells
(HPCs) to differentiate into CD56+CD3
natural killer (NK) cells in the absence of stromal cells. IL-15 mediates its effects by signaling through the and c
chains of the IL-2/15 receptor (R). The c-kit ligand (KL), also
produced by stromal cells, enhances the expansion of NK cells from
CD34+ HPCs in the presence of IL-15, but alone has no
ability to differentiate NK cells. Mice deficient in KL do not appear
to have a quantitative deficiency in NK cells, suggesting that other
stromal cell factors may contribute to NK cell expansion. Flt3 ligand
(FL) is also produced by BM stromal cells and has homology with KL.
Furthermore, mice with a targeted disruption of the FL gene have
reduced numbers of NK cells. We evaluated here the effects of FL on
human NK cell development and expansion from CD34+ HPCs.
Like KL, FL significantly enhanced the expansion of NK cells from
CD34+ HPCs in the presence of IL-15, compared with IL-15
alone. However, FL alone had no effect on NK cell differentiation. We
therefore explored the mechanism by which FL promotes IL-15-mediated
NK cell development. FL was found to induce IL-2/15R (CD122)
expression on CD34bright HPCs. The CD34bright
CD122+ cell coexpressed CD38, but lacked expression of
CD7, CD56, NK cell receptors (NKRs), or cytotoxic activity in the
absence of IL-15. Using limiting dilution analysis in the presence of
IL-15 alone, we demonstrated that the FL-induced
CD34brightCD122+ HPCs had an NK cell
precursor frequency 20- to 60-fold higher than the
CD34dim/negCD122 HPCs and 65- to 235-fold
higher than fresh CD34+ HPCs. KL had similar effects as
FL, but induced a significantly lower percentage of
CD34brightCD122+ cells (P .01).
Both FL and KL also increased IL-15R transcript in
CD34+ HPCs. Culture of CD34+ HPCs in FL or
KL, followed by culture in IL-15 alone, induced expression of both
C-type lectin and Ig-superfamily NKRs on CD56+ cells.
These data collectively support a role for FL in early human NK cell
development. FL or KL generate a unique CD34bright
CD122+CD38+ human NK cell intermediate from
CD34+ HPCs that lacks NK features yet is
IL-15-responsive. IL-15 is then required for the induction of CD56 and
NKRs, LGL morphology, cytotoxic activity, and the ability to produce
abundant cytokines and chemokines.
© 1998 by The American Society of Hematology.
 |
INTRODUCTION |
NATURAL KILLER (NK) cells are large
granular lymphocytes (LGLs) that play an important role in the innate
or antigen nonspecific immune response to infection.1-3
Although it is known that NK precursor cells reside in the bone marrow
(BM), their phenotype(s) and the factors that regulate their
differentiation into mature NK cells are incompletely
understood.4,5 Interleukin-2 (IL-2) has been used
extensively to study NK cell development from CD34+
hematopoietic progenitor cells (HPCs) in vitro6-9; however, IL-2 is produced exclusively by antigen-activated T cells and is not
found within the BM stroma.10,11 Furthermore, NK cells develop normally in mice lacking T cells12 and in mice that bear a disrupted IL-2 gene,13,14 yet are absent in
mice15,16 and humans17 which lack either the
or c signaling components of the IL-2 receptor
(IL-2R). Collectively, these data suggest that other factors that bind
to the IL-2R are critical for NK cell development.11
IL-15 is produced by human BM stromal cells, binds to and signals
through the IL-2R , and can induce the differentiation of NK cells
from CD34+ HPCs in vitro.11,18 Mice that cannot
express IL-15 in their BM stroma lack NK cells.19,20
Another stromal cell factor, c-kit ligand (KL), can significantly
enhance the expansion of NK cells from CD34+ HPCs in
combination with IL-15, but alone has no effect on NK cell
differentiation.11 However, mice that lack KL have not been
reported as having NK cell deficiencies,21 suggesting that other stromal factors may contribute to the expansion of NK cells. c-Kit, the KL receptor, is a member of the class III receptor tyrosine
kinase (RTK) family that also includes flt3.22-26 Flt3 is
expressed almost exclusively on early hematopoietic CD34+
stem cells,26-31 whereas c-kit appears to be expressed on
primitive and mature hematopoietic cells as well as on blood NK
cells.24,32,33 Flt3 ligand (FL) has strong homology with KL
and is also produced by stromal cells.34-37 Several studies
have shown that FL maintains and stimulates the proliferation of
primitive murine and human HPCs and synergizes with a number of other
growth factors, including IL-3, IL-6, IL-7, IL-11, IL-12, and
granulocyte colony-stimulating factor (G-CSF).38-42
Interestingly, mice with a genetically disrupted FL gene exhibit a
deficiency in early lymphopoiesis, with low to absent mature NK cells,
implicating FL as an important factor for murine NK cell
development.43 Recently, Williams et al44 showed that
c-kit+Sca2+IL-2/15R Lin
murine BM cells incubated in a combination of IL-6, IL-7, KL, and FL
subsequently developed into functional NK1.1+ NK cells when
cultured in IL-15. In the present study, we have investigated the role
of FL in the regulation of human NK cell development from BM-derived
CD34+ HPCs in vitro and compared the effect of FL to that
of KL. We identify a novel population of human CD34+ HPCs
that express IL-2/15R after culture in FL or KL. This cell type is
IL-15-responsive and thus appears to represent a distinct intermediate
in human NK cell development.
 |
MATERIALS AND METHODS |
Growth factors.
Purified recombinant human (rh) FL, rhKL (specific activity,
>105 U/mg), and rhIL-15 (specific activity, 1.49 × 109 U/mg) were kindly provided by Immunex Research and
Development Corp (Seattle, WA). rhIL-2 (specific activity, 1.53 × 107 U/mg) was obtained from Hoffman LaRoche (Nutley, NJ).
rhIL-7, rhIL-9, transforming growth factor- 1
(TGF- 1), and tumor necrosis factor- (TNF- ) were
purchased from Peprotech Inc (Rocky Hill, NJ). rhIL-12 (specific
activity, 4.5 × 106 U/mg) was a gift of Dr Stanley
Wolf (Genetics Institute, Cambridge, MA).
Monoclonal antibodies (MoAbs).
The following MoAbs were purchased from Becton Dickinson (San
Jose, CA): anti-CD34-phycoerythrin (PE), anti-CD34-fluorescein isothiocyanate (FITC), anti-CD2-FITC (Leu-5b), anti-CD3-FITC (Leu-4), nonreactive mouse Ig (MsIg)-FITC (control-FITC), and MsIg-PE
(control-PE). The anti-CD16-FITC MoAb was obtained from CalTag
Laboratories (San Francisco, CA), and anti-CD56- (NKH-1) PE was
obtained from Coulter Immunotech (Hialeah, FL). The
mouse-antihuman NK cell receptor (NKR) MoAbs used for this study were
EB6 (anti-CD158a), GL 183 (anti-CD158b), Zin 276 (anti-p70/CDw159),
FSTR 172 (anti-p50.3), and Zin 270 (anti-NKG2A), kindly provided by Drs
Alessandro and Lorenzo Moretta (Università di Genova, Genova,
Italy).45-47
Purification of human BM HPCs.
BM was aspirated from the posterior iliac crest of healthy adult donors
after obtaining informed consent. BM mononuclear cells (MNC) were
separated by density centrifugation over a Ficoll-Hypaque (Sigma, St
Louis, MO) gradient at 400g for 30 minutes. CD34+
cells were enriched from MNC by affinity chromatography using the
Ceprate LC device (CellPro, Bothel, WA), following the manufacturer's instructions. The enriched cells were then stained with anti-CD34-PE (CD34+Lin ) population on a FACStar Plus
cell sorter (Becton Dickinson). Cells obtained in this manner were
routinely 98% pure.11
Long-term suspension culture of CD34+ HPCs.
Sorted CD34+Lin HPCs were cultured in
96-well microplates at a concentration of 2 × 104 in
200 µL of complete RPMI-1640 medium (RPMI-1640 [GIBCO, Grand Island,
NY] supplemented with 10% heat-inactivated human AB serum [HAB;
C-six; Diagnostics, Mequon, WI] and antibiotics [Sigma]) and the
indicated growth factors: rhFL, IL-15, and KL at 100 ng/mL; rhIL-2,
IL-7, and IL-9 at 10 ng/mL; rhIL-12 at 10 U/mL; and TNF- and
TGF- 1 at 20 ng/mL. At day 7, day 14, and every 3 days thereafter, half of the culture medium was replaced with fresh medium containing 10% HAB and the same concentration of growth factors. After 21 days,
the cells were enumerated and analyzed for morphology, cell surface
phenotype, cytotoxic activity, and cytokine production. Cell
enumeration was performed in triplicate by vital dye exclusion using a
hemacytometer. In some experiments, after culture for 21 days, cells
were cultured for an additional 14 days in the presence or absence of
additional cytokines as indicated.
Immunophenotype analyses.
Cultured cells were harvested, incubated on ice with an excess of
nonreactive mouse IgG for 10 minutes, and then stained on ice for 15 to
30 minutes with various combinations of the following directly
conjugated MoAb: anti-CD56-PE and FITC-conjugated MoAb reactive against
CD2, CD3, and CD16. For analysis of NKR expression, cultured cells were
stained with unconjugated mouse-antihuman NKR MoAb, washed, stained
with a secondary FITC-conjugated goat antimouse IgG (Sigma), washed
twice, and then stained with directly conjugated anti-CD56-PE.
Background fluorescence was determined by analysis of cells identically
stained with nonreactive isotype control MoAbs. Cells were analyzed
using an MNC gate on a FACScan (Becton Dickinson) with the Lysis II
software program.
Cytotoxicity and proliferation assays.
Cytotoxic activity of cultured cells was determined in a standard
51Cr-release cytotoxicity assay against the NK-sensitive
K562 cell line, as previously described,11 at an E:T ratio
of 8:1. Results of cytotoxicity assays represent the mean ± SEM of
triplicate wells. Cell proliferation was measured by
[3H]-thymidine incorporation during the final 24 hours of
a 96-hour incubation at 37°C.11 Results of
proliferation assays represent the mean ± SEM of
triplicate wells and are expressed as cpm of [3H]-thymidine incorporation.
Measurement of NK cell cytokine production.
Three-week cultures of CD34+ HPCs in FL plus IL-15 or IL-15
alone were harvested and separated by fluorescence-activated cell sorting (FACS) into CD56+CD3 and
CD56 CD3 subsets. Sorted ( 98%
purity) CD56+CD3 and
CD56 CD3 populations were plated
at 50,000 cells/well in complete RPMI-1640 medium. After resting
overnight in the absence of any cytokines, cells were costimulated with
100 ng/mL rhIL-15 and 10 U/mL of rhIL-12. After 48 hours of incubation,
cell-free culture supernatants were collected and frozen at
70°C. Commercial enzyme-linked immunosorbent assay (ELISA)
kits were used for the determination of interferon- (IFN- ;
Endogen, Woburn, MA), TNF- , TGF- (Genzyme, Cambridge, MA), and
macrophage inflammatory protein-1 (R & D Systems, Minneapolis, MN)
levels, following the manufacturer's instructions. All supernatants were assayed simultaneously.
Limiting dilution analysis (LDA).
As shown below, there is a striking positive correlation between the
expression of CD56 in these cultured cells and the expression of NKRs,
LGL morphology, cytotoxic activity, and the potential for cytokine
production, all of which define NK cells. Furthermore, CD56 cells in culture lack these properties.
Therefore, we were able to use CD56 expression as an accurate readout
for NK cell development in our LDA of NK cell precursor frequency.
Human CD34+ HPCs were isolated as described above, were
plated by limiting dilution, and were either assayed for NK cell
precursor frequency 2 weeks after being plated in 100 ng/mL IL-15 (day
0 LDA) or first cultured in 100 ng/mL KL or FL for 21 days, washed, and
then cultured for 2 weeks in IL-15 (day-21 LDA). For the LDA, cells
were plated in a limiting dilution fashion from a concentration of
5,000 cells/well to 21 cells/well in 96-well plates with 15 replicates
per cell concentration. One half of the cell culture medium was removed every 5 days and replaced with fresh IL-15-supplemented medium. After
2 weeks of culture in IL-15, the cells from each well were stained with
anti-CD56-PE, washed, and analyzed for CD56 expression by flow
cytometry, and wells were scored positive or negative compared with
identical wells stained with the nonreactive PE-conjugated isotype
control MoAb. BM-derived NK cells have very high (ie, 102
PE log fluorescence) surface density expression of CD56
(Fig 1A). Thus, CD56+ wells
were clearly and easily demarcated from identical wells stained with
isotype control MoAb. In some experiments,
CD34brightCD122+ and
CD34dim/negCD122 cells were sorted after
CD34+ HPC culture in FL alone and plated in an LDA for NK
cell progenitor frequencies as described above. The NK cell progenitor
frequency was calculated as the reciprocal of the concentration of
cells that resulted in 37% negative wells using Poisson statistics and the weighted mean method.48,49

View larger version (34K):
[in this window]
[in a new window]

View larger version (16K):
[in this window]
[in a new window]
| Fig 1.
FL enhances IL-15-mediated development of
CD56+ CD3 NK cells from
CD34+ HPCs in vitro. (A) Flow cytometric analysis of CD56
and CD3 expression on MNCs generated in 21-day cultures of
CD34+ HPCs under the indicated conditions (right column).
Nonreactive MsIg isotype control MoAb were used to determine background
fluorescence (left column). Results displayed are representative of 10 separate experiments. (B) Fold increase in the absolute number of MNCs
after 21 days of culture of CD34+ HPCs in the indicated
conditions. (C) The absolute number of
CD56+CD3 cells after a 21-day culture of
CD34+ HPCs in the indicated conditions. These values were
calculated by multiplying the absolute number of viable MNCs by the
percentage of cells that were CD56+CD3 by
flow cytometric analysis. Results shown in (B) and (C) represent the
mean ± SEM of five separate experiments. The asterisk indicates a
value of P .025 compared with IL-15 alone.
|
|
Cell cycle analysis.
Cell cycle status was examined by staining cells with either propidium
iodide (PI), as described previously,50 or Hoechst 33342, as follows. One million viable cells were stained with 2 µg/mL
Hoechst 33342 in 1 mL of complete RPMI-1640 medium and incubated at
37°C for 45 minutes. After centrifugation, supernatants were
decanted and cells were stained with CD56-PE MoAb for 15 minutes on ice
and then washed with phosphate-buffered saline (PBS) containing 2 µg/mL Hoechst 33342. After being fixed in PBS with 2% formaldehyde
and 2 µg/mL Hoechst 33342, cells were simultaneously analyzed for
cell cycle status and CD56 expression by flow cytometry.
Analysis of flt3, c-kit, and IL-15R expression by reverse
transcription-polymerase chain reaction (RT-PCR).
Total RNA was prepared using RNAzol in accordance with the method of
Chomczynski and Sacchi.51 cDNA synthesis for RT-PCR was
performed at 42°C for 1 hour in a 30 µL reaction mixture
containing 2 µg of total RNA, 2 µmol/L of random hexamer primers,
300 U Moloney's murine leukemia virus (MMLV) reverse
transcriptase (GIBCO), and dNTPs at 0.2 mmol/L each (GIBCO), followed
by 5 minutes of incubation at 95°C and then incubated on ice for 5 minutes. Five microliters of the resultant cDNA product was amplified
by PCR with primers for flt329 or c-kit,52 as
described. Primers for IL-15R amplification were designed from the
published IL-15R sequence.53 The forward primer
(ACCTTCCACAGGAACCACAG) and reverse primer (AGGTAGCATGCCAGGAGAGA) yield
a 213-bp product. The products were separated on 2% agarose gel
containing 0.2 µg/mL ethidium bromide. The integrity of RNA samples
was verified by amplification of the -actin
transcript.11
Statistical analysis.
Experimental groups were compared using the Student's t-test,
where indicated, with P .05 considered significant.
 |
RESULTS |
FL synergizes with IL-15 in the generation of human CD56+
NK cells from CD34+ BM HPCs.
We examined the ability of FL, IL-15, or a combination of FL plus IL-15
to promote the development of human NK cells from BM HPCs in 3-week
cultures. Purified CD34+Lin HPCs (2 × 104/well) cultured in FL (100 ng/mL) alone
exhibited a 4.6- ± 0.7-fold increase in total MNC number, but did
not give rise to any CD56+ NK cells. Culture of
CD34+ HPCs in IL-15 alone (100 ng/mL) for 3 weeks resulted
in only a 1.3- ± 0.5-fold increase in total MNC number, but 74% ± 6.9% of cells expressed CD56 at high density
(CD56bright), which produced a low absolute number of
CD56+ NK cells. However, culture of CD34+ HPCs
with FL plus IL-15 resulted in an 8.4- ± 1.7-fold increase in total
MNC number, with 72% ± 8.6% of cells CD56bright,
which produced a 14.4- ± 6-fold greater absolute number of
CD56+CD3 NK cells compared with IL-15
alone (P .025; Fig 1A through C). The CD56+
cells generated by culture in FL plus IL-15 or IL-15 alone exhibited LGL morphology, an absence of CD3, and minimal surface density expression of CD2 and CD16 (data not shown).
Analysis of NK cell cytotoxic activity, cytokine production, and NKR
expression.
To assess the functional characteristics of the CD56+ cells
derived from culture of CD34+ HPCs in FL plus IL-15, we
tested cytotoxic activity and cytokine production. After 3 weeks of
culture in the presence of FL, MNCs had no CD56 expression and no
significant cytotoxic activity against K562 target cells, which lack
MHC class I. In contrast, CD34+ HPCs cultured in FL plus
IL-15 or IL-15 alone had high CD56 expression (Fig 1) and consistently
exhibited greater than 70% cytotoxicity against K562 target cells
(Fig 2A).

View larger version (21K):
[in this window]
[in a new window]

View larger version (32K):
[in this window]
[in a new window]
| Fig 2.
Characterization of NK cell cytotoxicity, cytokine
production, and NKR expression by MNCs,
CD56+CD3 , and
CD56 CD3 cells generated from
CD34+ HPCs in various conditions. (A) Cytotoxicity assay.
MNCs were harvested after 21-day culture with indicated cytokines,
washed, and tested for cytotoxic activity against the NK-sensitive K562
target cell line at an 8:1 E:T ratio. (B) Cytokine (IFN- ) and
chemokine (MIP-1 ) production. MNCs were harvested after 21-day
culture with indicated cytokines, sorted into
CD56+CD3 and
CD56 CD3 fractions, and costimulated with
IL-15 plus IL-12 for 48 hours. Cell-free supernatants were harvested
and tested for IFN- and MIP-1 by ELISA. For both (A) and (B),
results represent the mean ± SEM of four separate experiments. The
asterisk in (A) denotes a value of P .01 compared with
culture in FL alone. (C) NKR expression. NK cells generated in vitro by
culture in FL for 3 weeks, and then in IL-15 for 2 weeks, were stained
with anti-NKR and anti-CD56 MoAbs and analyzed by flow cytometry as
described in Materials and Methods. Flow cytometry data are
representative of 3 separate donors, which are summarized in Table 1.
|
|
The monocyte-derived cytokines IL-12 and IL-15 are potent costimulators
for IFN- and MIP-1 production by mature NK
cells.54,55 Three-week cultures of CD34+ HPCs
in FL plus IL-15 or in IL-15 alone were harvested and separated by FACS
into CD56+CD3 and
CD56 CD3 subsets. Equal numbers of
each subset (5 × 104 per well) were then costimulated
with IL-15 plus IL-12 for 48 hours, after which cell-free culture
supernatants were harvested and assayed for IFN- or MIP-1 protein
production by ELISA. CD56+ cells generated from
CD34+ HPCs cultured either in FL plus IL-15 or in IL-15
alone produced abundant amounts of IFN- and MIP-1 after 48 hours
of costimulation with IL-15 plus IL-12, whereas CD56
cells from the same cultures showed little or no production of above-noted cytokines (Fig 2B). There was no spontaneous production of
immunomodulatory cytokines, ie, IFN- , MIP-1 , TGF- , or TNF- , detected from supernatants in the above-noted culture conditions, from
cells cultured in FL or KL alone for 3 weeks, or after an additional 2 weeks of culture in IL-15 (data not shown).
We assessed CD56 and CD56+ BM-derived NK
cell progenitors and BM-derived NK cells, respectively, for NKR
expression. CD34+ HPCs cultured for 3 weeks in FL or KL
alone did not express CD56 or NKR (not shown). However, after the
washout of FL or KL and culture in IL-15 for an additional 2 weeks, NKR
expression was observed within the CD56+ fraction of cells.
This included modest but distinct expression of Ig-superfamily killer
inhibitory receptor (KIR) antigens on CD56+ NK cells, as
well as abundant expression of the C-type lectin NKR on
CD56+ cells. CD56 cells did not express
NKR. These results are summarized for three donors in
Table 1 and a representative panel of
two-parameter histograms is shown in Fig 2C. Thus, after culture in FL
and IL-15, all NK cell phenotypic and functional characteristics were
restricted to the CD56+ subset of cells.
View this table:
[in this window]
[in a new window]
|
Table 1.
NKR Surface Expression by CD56+ Cells
Derived From CD34+ HPCs Cultured in FL for 21 Days,
Followed By Culture in IL-15 for 14 Days
|
|
Comparison of the effects of FL and KL on NK cell precursor
frequency.
We have previously reported that KL, a BM stromal factor with strong
homology to FL, can synergize with IL-15 to enhance the expansion of
CD56+ NK cells from CD34+ HPCs.11
We therefore directly compared FL and KL for their ability to increase
NK cell precursor frequency among CD34+ HPCs in an LDA
(Fig 3). NK cell precursor frequency in
freshly isolated CD34+ HPCs cultured in IL-15 alone was 1 in 483 ± 16 cells, or approximately 0.21% ± 0.007%. However,
when CD34+ HPCs were first cultured for 3 weeks in KL and
then analyzed for NK cell precursor frequency in subsequent culture
with IL-15 alone, there was a significant (P .005)
increase in precursor frequency to 1 in 67 ± 8.3 cells (1.5% ± 0.19%). Likewise, initial 3-week culture in FL increased the
subsequent NK cell precursor frequency in IL-15 alone to 1 in 25 ± 2.5 cells (3.9% ± 0.4%; P .002), which was
significantly higher than that observed in KL (P .01;
Fig 3).

View larger version (12K):
[in this window]
[in a new window]
| Fig 3.
LDA of NK cell precursor frequency within freshly
isolated CD34+ HPCs (day 0) or CD34+ HPCs
cultured for 21 days in KL (day 21/KL) or FL (day 21/FL).
CD34+ HPCs cultured in KL (*P .005) or FL
(**P .002) had significantly increased NK cell precursor
frequency compared with freshly isolated CD34+ HPCs. In
addition, the 21-day/FL cultures had significantly greater NK cell
precursor frequencies when compared with 21-day/KL culture (#P .01). The results represent the mean ± SEM of three independent
experiments.
|
|
Identification of an NK cell precursor after culture in FL or
KL.
The significant increase in NK cell precursor frequency after culture
of CD34+ HPCs in FL or KL suggested that these factors may
be responsible for the generation of an intermediate, IL-15-responsive
NK cell precursor. The IL-2/15R chain (CD122) is required for IL-15
signaling.18 We therefore examined CD122 expression by flow
cytometric analysis on both freshly isolated human CD34+
HPCs and CD34+ HPCs cultured in FL for 10 days. Fresh
CD34+ BM HPCs expressed no detectable CD122 on their
surface, consistent with earlier reports.44,56 However,
after 10 days of culture in FL alone, 20% ± 3% of
CD34+ HPCs became CD122+. Interestingly, this
fraction was among the cells expressing CD34 with relatively high
surface density, ie, the CD34bright subset
(Fig 4A).

View larger version (17K):
[in this window]
[in a new window]

View larger version (36K):
[in this window]
[in a new window]
| Fig 4.
Expression of CD122 (IL-2/15R ) protein and IL-15R
mRNA on CD34+ HPCs after culture in FL or KL. (A) Flow
cytometric analysis of CD122 on freshly isolated CD34+
HPCs (day 0) or CD34+ HPCs cultured in FL or KL for 10 days. The percentage of CD34+CD122+ cells
(gated population) is indicated for each condition. (B) RT-PCR for
IL-15R mRNA transcript expression. CD34+ HPCs from 2 donors were examined for IL-15R on day 0 (lanes 1 and 4), day-10
culture in KL (lanes 2 and 5), day-10 culture in FL (lanes 3 and 6),
and 10-day culture in FL followed by culture in IL-15 for 14 days (lane
7). Lane 8 was H2O control. RT-PCR analysis was performed
as described in Materials and Methods.
|
|
To determine the NK cell precursor frequency in these CD34+
HPC subsets after the 10-day culture in FL, FACS-sorted
CD34brightCD122+ and
CD34dim/negCD122 cells were compared
using LDA. The NK cell precursor frequency in
CD34brightCD122+ cells was between 20- and
60-fold higher than the NK cell precursor frequency among the
CD34dim/neg CD122 subset and
between 65- and 235-fold higher than the frequency in fresh
CD34+ HPCs (Table 2). Thus, it
appears that culture of human CD34+ HPCs in FL induces
IL-2/15R (CD122) expression in CD34bright HPCs, creating
a cell that, by our assays, represents a phenotypic and functional
intermediate within human NK cell development. CD34brightCD122+ is the phenotype that
identifies this subset after culture in FL but before culture in IL-15.
The CD34brightCD122+ subset is
CD38+CD7 CD56 by flow
cytometric analysis. Before culture in IL-15, the
CD34brightCD122+ subset does not express any of
the NKR shown in Table 1 and Fig 2C, and it does not have any cytotoxic
activity against NK targets (data not shown). Although we were unable
to detect IL-15R protein expression by flow cytometric analysis of
this subset, we were able to easily detect the expression of IL-15R
transcript after culture of CD34+ HPCs in FL (Fig 4B).
Importantly, KL has similar, albeit less dramatic, effects as FL in the
generation of this NK cell intermediate. After a 10-day culture
of CD34+ HPCs in KL, 7.5% ± 0.7% of the
CD34+ HPCs coexpressed CD122, again within the
CD34bright fraction (Fig 4A). This was significantly
lower than the percentage of
CD34brightCD122+ cells found after culture with
FL (P .01). This is consistent with the significantly
lower NK cell precursor frequency seen when CD34+ HPCs were
cultured for 21 days in KL compared with FL, as shown in Fig 3.
The IL-15R transcript was also detected after incubation of CD34+ HPCs in KL (Fig 4B).
The effect of IL-15 on NK cell development.
As described above, there is a striking correlation between the
expression of CD56 and the appearance of NK cell function. The
mechanism by which CD56+ NK cells develop from their
CD34+CD56 precursor populations after
the addition of IL-15, ie, differentiation or proliferation, is
unknown. We therefore examined CD34+ HPCs after 21 days of
culture in FL or KL and quantitated the MNC number, viability,
percentage of apoptosis, and cell cycle status at 3-day intervals after
the addition of IL-15. Absolute cell number did not change
significantly over 14 days after the addition of IL-15, yet
CD56+ cells went from less than 1% to greater than 80%.
Cell cycle analysis demonstrated that a constant fraction (14% ± 2.1%) of cells were in G2/S phase over the subsequent
14-day culture with IL-15, which was approximately equal to the
fraction undergoing apoptosis (15% ± 1.4%). When analyzed on days
10 through 12 after addition of IL-15 (ie, days 31 to 33), 13% ± 1.5% of the CD56 fraction was cycling
(G2/S), whereas only 2.2% ± 0.6% of the CD56+ fraction was cycling. The absolute increase in
CD56+ cells from day 10 (36,450) to day 12 (81,420) could
not be accounted for by proliferation, as virtually every
CD56+ cell on day 31 would have to double once in 48 hours,
data not supported by the cell cycle analysis. These data are
summarized in Table 3 and suggest that the
increase in CD56+ NK cells in the presence of IL-15 is more
likely the result of NK precursor cell differentiation to mature NK
cells rather than the selective outgrowth of a small fraction of
CD56+ cells. However, it does not suggest that all
CD34+ HPCs cultured in FL or KL were committed to NK cell
development before the addition of IL-15. Indeed, when
CD34+ HPCs after 21 days of culture in FL or KL, but before
culture in IL-15, were exposed to other hematopoietic factors, such as G-CSF, granulocyte-macrophage colony-stimulating factor (GM-CSF), erythropoietin, or thrombopoietin, we observed morphologic evidence of
differentiation to other lineages (not shown).
View this table:
[in this window]
[in a new window]
|
Table 3.
Time Course of Cell Number, CD56 Expression, Viability,
Percentage of Apoptosis, and Cell Cycle Status of CD34+
HPCs Cultured in FL or KL for 21 Days, Followed by the Addition of
IL-15 for 14 Days
|
|
Synergistic effect of FL with other cytokines upon CD56+
NK cell generation from CD34+ HPCs.
We next investigated whether FL could combine with other cytokines that
have been shown to act in early hematopoiesis38-42 for the
production of CD56+ NK cells from CD34+ HPCs.
CD34+ HPCs were cultured for 3 weeks with rhIL-2, IL-7,
IL-9, IL-12, IL-15, and KL in the presence of FL. The absolute number
of CD56+CD3 cells generated among total
cells in each culture condition is shown in
Fig 5A. A direct comparison of IL-2 and
IL-15 in combination with FL showed that these cytokines were not
significantly different in their ability to generate
CD56+CD3 NK cells in this culture
system. Both IL-7 and IL-9 demonstrated weak synergy with FL in the
production of CD56+CD3 NK cells.
However, these factors alone yielded no
CD56+CD3 NK cells (data not shown).
IL-12, alone or in combination with FL, did not stimulate production of
CD56+CD3 NK cells in this culture
system. The combination of KL and FL did not generate any
CD56+CD3 NK cells, and FL, KL, and IL-15
together were no more effective in generating
CD56+CD3 NK cells from CD34+
HPCs than were FL plus IL-15 or KL plus IL-15 (Fig 5B). When CD34+ HPCs were cultured with FL and IL-15 and TNF- , the
generation of CD56+CD3 NK cells was
inhibited by 90% ± 7% (FL plus IL-15 v FL plus IL-15 plus
TNF- ; P .005). Similarly, the addition of TGF- to
cells being cultured with FL plus IL-15 resulted in a 72% ± 8%
reduction in the generation of CD56+CD3
NK cells (FL plus IL-15 v FL plus IL-15 plus TGF- ; P .005). MIP-1 did not significantly inhibit the generation of NK
cells from CD34+ HPCs (Fig 5B). Thus, the most potent
combinations for the generation of
CD56+CD3 NK cells from CD34+
BM HPCs were FL plus IL-15 or KL plus IL-15, and TNF- , TGF- can
function as potent negative regulators of NK cell development.

View larger version (23K):
[in this window]
[in a new window]

View larger version (24K):
[in this window]
[in a new window]
| Fig 5.
Effect of FL in combination with various cytokines on the
generation of CD56+CD3 NK cells from
CD34+ HPCs. Purified CD34+ HPCs were plated
in complete RPMI-1640 medium in the presence of the indicated cytokines
at the concentrations described in Materials and Methods. Results
represent the mean ± SEM of total MNC number and absolute
CD56+ NK cell number of five separate experiments.
*P .01 and **P .005 compared with cultures with
FL plus IL-15.
|
|
Expression and functional assessment of flt3 and c-kit transcript
during NK cell differentiation.
CD34+ BM HPCs, BM-derived
CD56+CD3 NK cells,
CD56bright and CD56dim blood NK cells,
CD3+ T cells, and unfractionated peripheral blood
lymphocytes (PBLs) were examined by RT-PCR for their
expression of flt3 and c-kit transcripts. Amplification of the flt3
transcript (210 bp) was observed in CD34+ BM cells from
five consecutive normal donors. However, 5 samples of BM-derived
CD56+CD3 NK cells obtained from a 21-day
culture of CD34+ HPCs with FL plus IL-15, as well as 5 samples of CD56bright, CD56dim blood NK cells,
and CD3+ T cells were negative for the flt3 mRNA transcript
(Fig 6A). One of 5 unfractionated PBL
samples was positive for flt3 mRNA, which may be explained by
expression of flt3 in rare circulating CD34+ HPCs. The
c-kit transcript (1,090 bp) was observed in all 5 samples of
CD34+ BM cells, BM-derived
CD56+CD3 NK cells obtained from a 21-day
culture of CD34+ HPCs with FL plus IL-15, as well as
CD56bright blood NK cells, CD3+ T cells, and
unfractionated PBLs. The CD56dim blood NK cell subset was
negative for c-kit mRNA, consistent with our previous functional
observations.33,57 To confirm the absence or presence of
functional gene products in blood NK cell subsets, sorted
CD56bright cells were cultured in IL-2, FL plus IL-2, or KL
plus IL-2 for 96 hours and assayed for a proliferative response (Fig
6B). CD56bright NK cells cultured with FL plus IL-2
demonstrated no enhancement of [3H]-thymidine
incorporation over the same cells cultured with IL-2 alone. In
contrast, a parallel culture of CD56bright NK cells in KL
plus IL-2 showed a proliferative synergy compared with those cells
cultured in IL-2 alone. This is consistent with our earlier
observations of a functional c-kit receptor on this NK cell
subset.33 Thus, flt3 and c-kit appear to have distinct patterns of expression during NK cell differentiation.

View larger version (29K):
[in this window]
[in a new window]

View larger version (16K):
[in this window]
[in a new window]
| Fig 6.
(A) RT-PCR analysis of flt3 and c-kit mRNA expression in
HPCs and various lymphocyte populations. Lanes 1 through 3, purified
CD34+ HPCs from 3 normal BM donors; lanes 4 and 5, CD56+CD3 NK cells generated from
CD34+ HPCs after culture in FL plus IL-15 for 3 weeks;
lanes 6 and 7, CD56bright blood NK cells; lanes 8 and 9, CD56dim blood NK cells from two normal blood donors; lane
10, unfractionated PBL; lane 11, blood CD3+ T cells.
(Below) Human -actin control of the identical samples. (B)
Proliferation of CD56bright NK cells in response to various
concentrations of IL-2, IL-2 plus FL (100 ng/mL), and IL-2 plus KL (100 ng/mL). The results are representative of three separate experiments
and indicate the mean cpm ± SEM of triplicate measures.
|
|
 |
DISCUSSION |
In the present study, we investigated the role of FL in the regulation
of human NK cell development from BM-derived CD34+ HPCs and
compared the effect of FL with that of KL. Neither FL nor KL had any
ability to induce NK cell differentiation from CD34+ HPCs
in the absence of IL-15. However, the ability of both FL and KL to
significantly increase NK cell precursor frequency among CD34+ HPC before the addition of IL-15 strongly suggested
that these factors contribute to the survival and/or expansion
of an IL-15-responsive NK precursor cell. Indeed, we demonstrated that
incubation of CD34+ HPCs in FL or KL resulted in the
generation of a novel human NK cell intermediate characterized by
CD34bright and CD122 (IL-2/15R ) expression. It is
unclear if activation of either c-kit or flt3 by their respective
ligands induces the IL-15R components on a fraction of
CD34+ cells or whether there is a selective expansion of a
small CD34brightCD122+ subset. Our failure to
detect CD122 expression by flow cytometric analysis of 10,000 CD34+ cells before culture in FL or KL might suggest that
at least some component of enhanced CD122 gene expression via
activation of these two type III RTKs is likely. However, we and
others57 detect a low frequency of NK precursor cells in
fresh CD34+ HPCs by LDA, so the IL-2/15R c
chains are likely to be constitutively expressed on some small number
of CD34+ HPCs at a surface density that is below detection
by flow cytometry. Indeed, others have failed to detect
IL-2/15R c on the surface of mature NK cells that are
known to functionally respond to IL-2 and IL-15.58 The same
may be true for IL-15R expression on CD34+ HPCs. Our
preliminary studies reported here suggest that FL and KL may upregulate
this chain as well, although a quantitative analysis of the IL-15R
gene product has not yet been performed. In addition to these
scenarios, our data do not exclude the possibility that FL
and/or KL may mediate some of their effects by inducing the
expression of additional factors from the starting population of
CD34+ HPCs.
The incorporation of the LDA assay for assessment of NK cell precursor
frequency provided strong support for the
CD34brightCD122+ cell as an NK cell
intermediate. There was a striking positive correlation of CD56
expression with NKR expression, LGL morphology, cytotoxic activity, and
cytokine production, as well as a notable absence of these features in
the CD56 population. This allowed us to use CD56
expression as a simple and accurate readout for human NK cell
outgrowth. We were then able to document a very high NK cell precursor
frequency in the CD34brightCD122+ subset, in
contrast to the CD34dim/negCD122 subset.
Furthermore, we demonstrated that preincubation of CD34+
HPCs in either KL or FL significantly increased the NK cell precursor frequency seen with IL-15, compared with fresh CD34+ cells
plated in an LDA with IL-15. Because neither KL nor FL by itself
induces NK cell differentiation, the mechanism likely involves the
generation of the CD34brightCD122+ NK cell
intermediate that is, in turn, responsive to IL-15. The observation
that the NK cell precursor frequency was significantly higher with
preincubation in FL versus KL is consistent with FL inducing over
double the percentage of CD34brightCD122+ NK
cell intermediates.
We also demonstrated that IL-15 has the ability to induce NKR and CD56
expression, LGL morphology, and cytotoxic properties as well as prepare
the cell for potent cytokine and chemokine production after monokine
stimulation. The CD56+ NK cells generated from human BM
CD34+ HPCs with FL followed by IL-15 expressed both C-type
lectin (NKG2A) and Ig-superfamily (CD158a, CD158b, and p70/CDw159 KIR)
NKR. This appears to be in contrast to NK cell progenitors in the
thymus cultured in IL-15 or IL-15 plus KL, in which only C-type lectin NKR were induced.59-61 The reason for variation in KIR
expression between these two in vitro systems may relate to differences
in BM versus thymic NK precursor cells, accessory cells in the
cultures, or culture conditions. Studies are currently underway to
further characterize the factors that may be critical for NKR induction during human NK cell development.
These findings, along with our earlier demonstration of IL-15 protein
production within human BM stroma,11 provide compelling evidence for an important role for IL-15 in human NK cell development. Genetic disruption studies provide supporting evidence for this in the
mouse. The interferon response factor-1 (IRF-1) knockout mouse lacks
the ability to express IL-15 transcript in BM stroma, and lacks NK
cells. Incubation of IRF-1 / HPCs in IL-15 or
transplantation of IRF-1 / HPCs into lethally
irradiated wild-type mice leads to the generation of NK cells, strongly
suggesting that IL-15 is required in the process of NK cell
development.19,20 Likewise, there is support for the role
of FL in NK cell development, because mice genetically deficient in FL
have low NK cell numbers.43 This would be consistent with
the notion that absence of FL leads to fewer IL-15-responsive NK cell
intermediates. The NK deficiency in FL / mice
would suggest that KL is not fully redundant with FL in this regard.
The Sld/Sld mouse, which lacks expression of
c-kit, has not been noted as NK deficient, but it is unclear if a
careful quantitative analysis of NK cells has been
undertaken.21 Finally, Williams et al44 have
recently demonstrated that, in the mouse, a combination of IL-6, IL-7,
KL, and FL can induce CD122 on multipotential murine BM HPCs that, in
turn, become responsive to IL-15 for NK cell development.
The data from the current study would suggest that both FL and KL have
the capacity to induce CD34brightCD122+ NK cell
precursors from CD34+ HPCs, but that FL may perform this
function more efficiently. The reasons for this are not entirely clear,
but may relate to differences in flt3 and c-kit expression on the
earliest HPCs. Shah et al41 have reported that FL was able
to induce significantly greater proliferation of quiescent
CD34+CD38 cells than KL in long term
culture. Haylock et al62 found that, in single cell assays,
FL, but not KL, was able to recruit an additional subpopulation of HPCs
representing approximately 12% of
CD34+CD38 cells that were
rhodaminedull and 4-hydroperoxycyclophosphamide (4-HC)
resistant. Consistent with this, Miller et al63 have
recently shown that NK cell progenitor frequency increases when FL is
added to switch cultures of CD34+CD33
HPCs in IL-2, IL-7, and KL. In contrast to FL, KL has effects on mature
CD56bright NK cells found in blood, promoting their
survival64 and potentiating their IL-2/15-induced
proliferation.33 KL does not enhance CD56bright
NK cell cytotoxic activity in the presence or absence of
IL-2/15,33 which is consistent with its inability to induce
NK cell differentiation from HPCs. These differences highlight some
distinct functional effects of FL and KL on NK cells due to the
distribution of their respective receptors.
In the absence of FL or KL, IL-15 induces NK cell differentiation from
CD34+ HPCs, but without significant
expansion.11,44 This suggests that IL-15 itself promotes NK
cell development via differentiation of committed precursors, not via
proliferation. To address this possibility, we performed a kinetic
analysis of CD56+ cells during NK cell development from
CD34+ HPCs in the presence of IL-15 and either FL or KL.
Cell cycle analysis during the substantial increase in CD56 expression
proved that IL-15's effect on CD56+ NK cell development
could not be accounted for by induction of proliferation. Thus, IL-15
appears to be the factor most likely responsible for inducing the
expression of genes that characterize NK cells.
Collectively, these data suggest that, in humans, both FL and KL
participate in the generation of NK cell progenitors from CD34+ HPCs. Both induce an NK cell intermediate from HPCs
and both are likely to enhance their expansion while IL-15 induces NK
cell differentiation. In this capacity, these two RTK ligands are
likely to be functionally redundant.65 The failure of a
combination of KL and FL to enhance the absolute number of
CD56+ NK cells obtained from CD34+ HPCs
cultured with IL-15 plus either FL or KL alone supports this. However,
evidence from our study and from others41,62,63 would
suggest that FL might also perform its function on an additional subset
of NK precursors, which are not responsive to KL. We also noted that
CD34+ HPCs cultured in FL or KL can subsequently
differentiate along different lineages in the absence of IL-15 and in
the presence of other growth factors. Furthermore, we can introduce
factors that negatively regulate human NK cell development. These
observations remind us that the process of NK cell development is
likely to be substantially more complex in vivo. Continued
characterization of growth factors and their receptors on HPCs and
their progeny will hopefully provide additional insight into this
fascinating biological process.
 |
ACKNOWLEDGMENT |
The authors thank Dr Carlton Stewart for his advice and technical
assistance in the cell cycle analysis by flow cytometry, Dr Jeffrey
Miller for assistance with the LDA, Drs Stewart D. Lyman and Elaine
Thomas for their critical review of the manuscript, Dr Vinay Kumar, and
our anonymous reviewers for their constructive comments. We also thank
Drs Alessandro Moretta and Lorenzo Moretta for kindly providing the
anti-NKR antibodies.
 |
FOOTNOTES |
Submitted March 5, 1998;
accepted July 10, 1998.
H.Y. and T.A.F. contributed equally to this work.
Supported by Grants No. 5P30CA16058, CA68458, and CA65670 from the
National Cancer Institute. T.A.F. is the recipient of the Howard Hughes
Medical Institute Research Fellowship for Medical Students and the
Bennett Fellowship from The Ohio State University College of Medicine.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Michael A. Caligiuri, MD, The Ohio State
University, Division of Hematology/Oncology, 458A Starling Loving Hall,
320 W 10th Ave, Columbus, OH, 43210; e-mail:
caligiuri-1{at}medctr.osu.edu.
 |
REFERENCES |
1.
Robertson MJ, Ritz J:
Biology and clinical relevance of human natural killer cells.
Blood
76:2421, 1990[Free Full Text]
2.
Trinchieri G:
Cytokines acting on or secreted by macrophages during intracellular infection (IL-15, IL-12, IFN-gamma).
Curr Opin Immunol
9:17, 1997[Medline]
[Order article via Infotrieve]
3.
Biron CA:
Activation and function of natural killer cell responses during viral infections.
Curr Opin Immunol
9:24, 1997[Medline]
[Order article via Infotrieve]
4.
Carson WE, Caligiuri MA:
Natural killer cell subsets and development.
Methods: A Companion to Methods in Enzymology
9:327, 1996
5.
Lanier LL, Spits H, Phillips JH:
The developmental relationship between NK cells and T cells.
Immunol Today
13:392, 1992[Medline]
[Order article via Infotrieve]
6.
Lotzova E, Savary CA, Champlin RE:
Genesis of human oncolytic natural killer cells from primitive CD34+CD33 bone marrow progenitors.
J Immunol
150:5263, 1993[Abstract]
7.
Miller JS, Verfaillie C, McGlave P:
The generation of human natural killer cells from CD34+/DR primitive progenitors in long-term bone marrow culture.
Blood
80:2182, 1992[Abstract/Free Full Text]
8.
Silva MR, Hoffman R, Srour EF, Ascensao JL:
Generation of human natural killer cells from immature progenitors does not require marrow stromal cells.
Blood
84:841, 1994[Abstract/Free Full Text]
9.
Shibuya A, Nagayoshi K, Nakamura K, Nakauchi H:
Lymphokine requirement for the generation of natural killer cells from CD34+ hematopoietic progenitor cells.
Blood
85:3538, 1995[Abstract/Free Full Text]
10.
Smith KA:
Interleukin-2: Inception, impact, and implications.
Science
240:1169, 1988[Abstract/Free Full Text]
11.
Mrózek E, Anderson P, Caligiuri MA:
Role of interleukin-15 in the development of human CD56+ natural killer cells from CD34+ hematopoietic progenitor cells.
Blood
87:2632, 1996[Abstract/Free Full Text]
12.
Dorshkind K, Pollack SB, Bosma MJ, Phillips RA:
Natural killer (NK) cells are present in mice with severe combined immunodeficiency (scid).
J Immunol
134:3798, 1985[Abstract]
13.
Schorle H, Holtschke T, Hunig T, Schimpl A, Horak I:
Development and function of T cells in mice rendered interleukin-2 deficient by gene targeting.
Nature
352:621, 1991[Medline]
[Order article via Infotrieve]
14.
Kundig TM, Schorle H, Bachmann MF, Hengartner H, Zinkernagel RM, Horak I:
Immune responses in interleukin-2-deficient mice.
Science
262:1059, 1993[Abstract/Free Full Text]
15.
Suzuki H, Duncan GS, Takimoto H, Mak TW:
Abnormal development of intestinal intraepithelial lymphocytes and peripheral natural killer cells in mice lacking the IL-2 receptor beta chain.
J Exp Med
185:499, 1997[Abstract/Free Full Text]
16.
DiSanto JP, Muller W, Guy-Grand D, Fischer A, Rajewsky K:
Lymphoid development in mice with a targeted deletion of the interleukin 2 receptor gamma chain.
Proc Natl Acad Sci USA
92:377, 1995[Abstract/Free Full Text]
17.
Noguchi M, Yi H, Rosenblatt HM, Filipovich AH, Adelstein S, Modi WS, McBride OW, Leonard WJ:
Interleukin-2 receptor gamma chain mutation results in X-linked severe combined immunodeficiency in humans.
Cell
73:147, 1993[Medline]
[Order article via Infotrieve]
18.
Giri JG, Ahdieh M, Eisenman J, Shanebeck K, Grabstein K, Kumaki S, Namen A, Park LS, Cosman D, Anderson D:
Utilization of the beta and gamma chains of the IL-2 receptor by the novel cytokine IL-15.
EMBO J
13:2822, 1994[Medline]
[Order article via Infotrieve]
19.
Ogasawara K, Hida S, Azimi N, Tagaya Y, Sato T, Yokochi-Fukuda T, Waldmann TA, Taniguchi T, Taki S:
Requirement for IRF-1 in the microenvironment supporting development of natural killer cells.
Nature
391:700, 1998[Medline]
[Order article via Infotrieve]
20.
Ohteki T, Yoshida H, matsuyama T, Duncan GS, Mak TW, Ohashi P:
The transcription factor interferon regulatory factor 1 (IRF-1) is important during the maturation of natural killer 1.1+ T cell receptor -alpha/beta+ (NK1+ T) cells, natural killer cells, and intestinal intraepithelial T cells.
J Exp Med
187:967, 1998[Abstract/Free Full Text]
21.
Pantel K, Boertman J, Nakeff A:
Identification of the c-kit ligand: End of the road for understanding aplastic anemia in steel mutant mice?
Blood
78:1428, 1991[Abstract/Free Full Text]
22.
Ullrich A, Schlessinger J:
Signal transduction by receptors with tyrosine kinase activity.
Cell
61:203, 1990[Medline]
[Order article via Infotrieve]
23.
Sherr CJ:
Colony-stimulating factor-1 receptor.
Blood
75:1, 1990[Free Full Text]
24.
Galli SJ, Zsebo KM, Geissler EN:
The kit ligand, stem cell factor.
Adv Immunol
55:1, 1994[Medline]
[Order article via Infotrieve]
25.
Rosnet O, Marchetto S, deLapeyriere O, Birnbaum D:
Murine Flt3, a gene encoding a novel tyrosine kinase receptor of the PDGFR/CSF1R family.
Oncogene
6:1641, 1991[Medline]
[Order article via Infotrieve]
26.
Matthews W, Jordan CT, Wiegand GW, Pardoll D, Lemischka IR:
A receptor tyrosine kinase specific to hematopoietic stem and progenitor cell-enriched populations.
Cell
65:1143, 1991[Medline]
[Order article via Infotrieve]
27.
Small D, Levenstein M, Kim E, Carow C, Amin S, Rockwell P, Witte L, Burrow C, Ratajczak MZ, Gewirtz AM, Civin CI:
STK-1, the human homolog of Flk-2/Flt-3, is selectively expressed in CD34+ human bone marrow cells and is involved in the proliferation of early progenitor/stem cells.
Proc Natl Acad Sci USA
91:459, 1994[Abstract/Free Full Text]
28.
Zeigler FC, Bennett BD, Jordan CT, Spencer SD, Baumhueter S, Carroll KJ, Hooley J, Bauer K, Matthews W:
Cellular and molecular characterization of the role of the flk-2/flt-3 receptor tyrosine kinase in hematopoietic stem cells.
Blood
84:2422, 1994[Abstract/Free Full Text]
29.
Rosnet O, Schiff C, Pebusque MJ, Marchetto S, Tonnelle C, Toiron Y, Birg F, Birnbaum D:
Human FLT3/FLK2 gene: cDNA cloning and expression in hematopoietic cells.
Blood
82:1110, 1993[Abstract/Free Full Text]
30.
Lyman SD:
Biology of flt3 ligand and receptor.
Int J Hematol
62:63, 1995[Medline]
[Order article via Infotrieve]
31.
Lyman SD, James L, Johnson L, Brasel K, de Vries P, Escobar SS, Downey H, Splett RR, Beckmann MP, McKenna HJ:
Cloning of the human homologue of the murine flt3 ligand: A growth factor for early hematopoietic progenitor cells.
Blood
83:2795, 1994[Abstract/Free Full Text]
32.
Ashman LK, Cambareri AC, Bik To L, Levinsky RJ, Juttner CA:
Expression of the YB5 antigen (c-kit proto-oncogene product) in normal human bone marrow.
Blood
78:30, 1991[Abstract/Free Full Text]
33.
Matos ME, Schnier GS, Beecher MS, Ashman LK, William DE, Caligiuri MA:
Expression of a functional c-kit receptor on a subset of natural killer cells.
J Exp Med
178:1079, 1993[Abstract/Free Full Text]
34.
Lyman SD, James L, Vanden Bos T, de Vries P, Brasel K, Gliniak B, Hollingsworth LT, Picha KS, McKenna HJ, Splett RR, Fletcher FA, Maraskovsky E, Farrah T, Foxworthe D, Williams DE, Beckmann MP:
Molecular cloning of a ligand for the flt3/flk-2 tyrosine kinase receptor: A proliferative factor for primitive hematopoietic cells.
Cell
75:1157, 1993[Medline]
[Order article via Infotrieve]
35.
Hannum C, Culpepper J, Campbell D, McClanahan T, Zurawski S, Bazan JF, Kastelein R, Hudak S, Wagner J, Mattson J:
Ligand for FLT3/FLK2 receptor tyrosine kinase regulates growth of haematopoietic stem cells and is encoded by variant RNAs.
Nature
368:643, 1994[Medline]
[Order article via Infotrieve]
36.
Lyman SD, James L, Escobar S, Downey H, de Vries P, Brasel K, Stocking K, Beckmann MP, Copeland NG, Cleveland LS, Jenkins NA, Belmont JW, Davison BL:
Identification of soluble and membrane-bound isoforms of the murine flt3 ligand generated by alternative splicing of mRNAs.
Oncogene
10:149, 1995[Medline]
[Order article via Infotrieve]
37.
Lisovsky M, Braun SE, Ge Y, Takahira H, Lu L, Savchenko VG, Lyman SD, Broxmeyer HE:
Flt3-ligand production by human bone marrow stromal cells.
Leukemia
10:1012, 1996[Medline]
[Order article via Infotrieve]
38.
Rusten LS, Lyman SD, Veiby OP, Jacobsen SE:
The FLT3 ligand is a direct and potent stimulator of the growth of primitive and committed human CD34+ bone marrow progenitor cells in vitro.
Blood
87:1317, 1996[Abstract/Free Full Text]
39.
Hirayama F, Lyman SD, Clark SC, Ogawa M:
The flt3 ligand supports proliferation of lymphohematopoietic progenitors and early B-lymphoid progenitors.
Blood
85:1762, 1995[Abstract/Free Full Text]
40.
Hudak S, Hunte B, Culpepper J, Menon S, Hannum C, Thompson-Snipes L, Rennick D:
FLT3/FLK2 ligand promotes the growth of murine stem cells and the expansion of colony-forming cells and spleen colony-forming units.
Blood
85:2747, 1995[Abstract/Free Full Text]
41.
Shah AJ, Smogorzewska EM, Hannum C, Crooks GM:
Flt3 ligand induces proliferation of quiescent human bone marrow CD34+CD38 cells and maintains progenitor cells in vitro.
Blood
87:3563, 1996[Abstract/Free Full Text]
42.
Jacobsen SE, Okkenhaug C, Myklebust J, Veiby OP, Lyman SD:
The FLT3 ligand potently and directly stimulates the growth and expansion of primitive murine bone marrow progenitor cells in vitro: Synergistic interactions with interleukin (IL) 11, IL-12, and other hematopoietic growth factors.
J Exp Med
181:1357, 1995[Abstract/Free Full Text]
43.
McKenna HJ, Miller RE, Brasel K, Maraskovsky E, Maliszwski C, Pulendran B, Lynch D, Teepe M, Roux ER, Smith J, Williams DE, Lyman SD, Peschon JJ, Stocking K:
Targeted disruption of the flt3 ligand gene in mice affects multiple hematopoietic lineages, including natural killer cells, B lymphocytes, and dendritic cells.
Blood
88:474a, 1996 (abstr, suppl 1)
44.
Williams NS, Moore TA, Schatzle JD, Puzanov IJ, Sivakumar PV, Zlotnik A, Bennett M, Kumar V:
Generation of lytic natural killer 1.1+, Ly49 cells from multipotential murine bone marrow progenitors in a stroma-free culture: Definition of cytokine requirements and developmental intermediates.
J Exp Med
186:1609, 1997[Abstract/Free Full Text]
45.
Moretta A, Bottino C, Pende D, Tripodi G, Tambussi G, Viale O, Orengo A, Barbaresi M, Merli A, Ciccone E, Moretta L:
Identification of four subsets of human CD3 CD16+ natural killer (NK) cells by the expression of clonally distributed functional surface molecules: Correlation between subset assignment of NK clones and ability to mediate specific alloantigen recognition.
J Exp Med
172:1589, 1990[Abstract/Free Full Text]
46.
Moretta A, Bottino C, Vitale M, Pende D, Biassoni R, Mingari MC, Moretta L:
Receptors for HLA-class-I molecules in human natural killer cells.
Annu Rev Immunol
14:619, 1996[Medline]
[Order article via Infotrieve]
47.
Cantoni C, Biassoni R, Pende S, Sivori S, Accame L, Pareti L, Semenzato G, Moretta A, Bottino C:
The activating form of CD94 covalently associates with the Kp39 protein that represents the product of the NKG2-C gene.
Eur J Immunol
28:327, 1998[Medline]
[Order article via Infotrieve]
48.
Poter EH, Berry RJ:
The efficient design of transplantable tumor assays.
J Cancer
17:583, 1963
49.
Taswell C:
Limiting dilution assay for the determination of immunocompetent cell frequencies: I. Data analysis.
J Immunol
126:1614, 1981[Abstract]
50.
Ross ME, Caligiuri MA:
Cytokine-induced apoptosis of human natural killer cells identifies a novel mechanism to regulate the innate immune response.
Blood
89:910, 1997[Abstract/Free Full Text]
51.
Chomczynski P, Sacchi N:
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal Biochem
162:156, 1987[Medline]
[Order article via Infotrieve]
52.
Mekori YA, Dastych J, Oh CK, Goff JP, Adachi S, Bianchine PJ, Worobec A, Semere T, Pierce JH, Metcalfe DD:
Characterization of a mast cell line that lacks the extracellular domain of membrane c-kit.
Immunology
90:518, 1997[Medline]
[Order article via Infotrieve]
53.
Anderson DM, Kumaki S, Adhieh M, Bertles J, Tometsko M, Loomis A, Giri J, Copeland NG, Gilbert DJ, Jenkins NA, Valentine V, Shapiro DN, Morris SW, Park LS, Cosman D:
Functional characterization of the human interleukin-15 receptor alpha chain and close linkage of IL15RA and IL2RA genes.
J Biol Chem
270:29869, 1995
54.
Carson WE, Giri JG, Lindemann MJ, Linett ML, Ahdieh M, Paxton R, Anderson D, Eisenmann J, Grabstein K, Caligiuri MA:
Interleukin (IL) 15 is a novel cytokine that activates human natural killer cells via components of the IL-2 receptor.
J Exp Med
180:1395, 1994[Abstract/Free Full Text]
55.
Bluman EM, Bartynski KJ, Avalos BR, Caligiuri MA:
Human natural killer cells produce abundant protein-1 alpha in response to monocyte-derived cytokines.
J Clin Invest
97:2722, 1996[Medline]
[Order article via Infotrieve]
56.
Shibuya A, Kojima H, Shibuya K, Nagayoshi K, Nagasawa T, Nakauchi H:
Enrichment of interleukin-2-responsive natural killer progenitors in human bone marrow.
Blood
81:1819, 1993[Abstract/Free Full Text]
57.
Bluman EM, Schnier GS, Avalos BR, Strout MP, Sultan H, Jacobson FW, Williams D, E., Carson WE, Caligiuri MA:
The c-Kit ligand potentiates the allogeneic mixed lymphocyte reaction.
Blood
88:3887, 1996[Abstract/Free Full Text]
58.
David D, Bani L, Moreau JL, Demaison C, Sun K, Salvucci O, Nakarai T, de Montalembert M, Chouaib S, Joussemet M, Ritz J, Theze J:
Further analysis of interleukin-2 receptor subunit expression on the different human peripheral blood mononuclear cell subsets.
Blood
91:165, 1998[Abstract/Free Full Text]
59.
Mingari MC, Vitale C, Cantoni C, Bellomo R, Ponte M, Schiavetti F, Bertone S, Moretta A, Moretta L:
Interleukin-15-induced maturation of human natural killer cells from early thymic precursors: Selective expression of CD94/NKG2-A as the only HLA class I-specific inhibitory receptor.
Eur J Immunol
27:1374, 1997[Medline]
[Order article via Infotrieve]
60.
Mingari MC, Ponte M, Bertone S, Schiavetti F, Vitale C, Bellomo R, Moretta A, Moretta L:
HLA-class I specific inhibitory receptors in T lymphocytes. IL-15 induced expression of CD94/NKG2A in superantigen- or alloantigen-activated human T cells.
Proc Natl Acad Sci USA
95:1172, 1997[Abstract/Free Full Text]
61.
Mingari MC, Moretta A, Moretta L:
Regulation or KIR expression in human T cells: A safety mechanism that may impair protective T-cell responses.
Immunol Today
19:153, 1998[Medline]
[Order article via Infotrieve]
62.
Haylock DN, Horsfall MJ, Dowse TL, Ramshaw HS, Niutta S, Protopsaltis S, Peng L, Burrell C, Rappold I, Buhring H, Simmons PJ:
Increased recruitment of hematopoietic progenitor cells underlies the ex vivo expansion potential of flt3 ligand.
Blood
90:2260, 1997[Abstract/Free Full Text]
63.
Miller JS, McCullar V, Verfaillie CM:
Ex vivo culture of CD34(+)/Lin /DR cells in stroma-derived soluble factors, interleukin-3, and macrophage inflammatory protein-1alpha maintains not only myeloid but also lymphoid progenitors in a novel switch culture assay.
Blood
91:4516, 1998[Abstract/Free Full Text]
64.
Carson WE, Haldar S, Baiocchi RA, Croce CM, Caligiuri MA:
The c-kit ligand suppresses apoptosis of human natural killer cells through the upregulation of bcl-2.
Proc Natl Acad Sci USA
91:7553, 1994[Abstract/Free Full Text]
65.
Metcalf D:
Hematopoietic regulators: Redundancy or subtlety?
Blood
82:3515, 1993[Free Full Text]

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
Proteolytic Activation of the Cytotoxic Phenotype during Human NK Cell Development
J. Immunol.,
July 15, 2009;
183(2):
803 - 813.
|
 |
|

|
 |

|
 |
 
D. M. Benson Jr, J. Yu, B. Becknell, M. Wei, A. G. Freud, A. K. Ferketich, R. Trotta, D. Perrotti, R. Briesewitz, and M. A. Caligiuri
Stem cell factor and interleukin-2/15 combine to enhance MAPK-mediated proliferation of human natural killer cells
Blood,
March 19, 2009;
113(12):
2706 - 2714.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I.-K. Park, C. Giovenzana, T. L. Hughes, J. Yu, R. Trotta, and M. A. Caligiuri
The Axl/Gas6 pathway is required for optimal cytokine signaling during human natural killer cell development
Blood,
March 12, 2009;
113(11):
2470 - 2477.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S.-i. Ohno, T. Sato, K. Kohu, K. Takeda, K. Okumura, M. Satake, and S. Habu
Runx proteins are involved in regulation of CD122, Ly49 family and IFN-{gamma} expression during NK cell differentiation
Int. Immunol.,
January 1, 2008;
20(1):
71 - 79.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Giustiniani, A. Marie-Cardine, and A. Bensussan
A Soluble Form of the MHC Class I-Specific CD160 Receptor Is Released from Human Activated NK Lymphocytes and Inhibits Cell-Mediated Cytotoxicity
J. Immunol.,
February 1, 2007;
178(3):
1293 - 1300.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Grzywacz, N. Kataria, M. Sikora, R. A. Oostendorp, E. A. Dzierzak, B. R. Blazar, J. S. Miller, and M. R. Verneris
Coordinated acquisition of inhibitory and activating receptors and functional properties by developing human natural killer cells
Blood,
December 1, 2006;
108(12):
3824 - 3833.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. H. Shah, A. G. Freud, D. M. Benson Jr., A. K. Ferkitich, B. J. Dezube, Z. P. Bernstein, and M. A. Caligiuri
A Phase I Study of Ultra Low Dose Interleukin-2 and Stem Cell Factor in Patients with HIV Infection or HIV and Cancer.
Clin. Cancer Res.,
July 1, 2006;
12(13):
3993 - 3996.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. G. Freud, A. Yokohama, B. Becknell, M. T. Lee, H. C. Mao, A. K. Ferketich, and M. A. Caligiuri
Evidence for discrete stages of human natural killer cell differentiation in vivo
J. Exp. Med.,
April 17, 2006;
203(4):
1033 - 1043.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. A. Perez, L. G. Mahaira, P. A. Sotiropoulou, A. D. Gritzapis, E. G. Iliopoulou, D. K. Niarchos, N. T. Cacoullos, Y. G. Kavalakis, A. I. Antsaklis, N. N. Sotiriadou, et al.
Effect of IL-21 on NK cells derived from different umbilical cord blood populations
Int. Immunol.,
January 1, 2006;
18(1):
49 - 58.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
U.-C. Meier, R. E. Owen, E. Taylor, A. Worth, N. Naoumov, C. Willberg, K. Tang, P. Newton, P. Pellegrino, I. Williams, et al.
Shared Alterations in NK Cell Frequency, Phenotype, and Function in Chronic Human Immunodeficiency Virus and Hepatitis C Virus Infections
J. Virol.,
October 1, 2005;
79(19):
12365 - 12374.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Giron-Michel, M. Giuliani, M. Fogli, D. Brouty-Boye, S. Ferrini, F. Baychelier, P. Eid, C. Lebousse-Kerdiles, D. Durali, R. Biassoni, et al.
Membrane-bound and soluble IL-15/IL-15R{alpha} complexes display differential signaling and functions on human hematopoietic progenitors
Blood,
October 1, 2005;
106(7):
2302 - 2310.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. M. Bernt, S. Ni, A.-T. Tieu, and A. Lieber
Assessment of a Combined, Adenovirus-Mediated Oncolytic and Immunostimulatory Tumor Therapy
Cancer Res.,
May 15, 2005;
65(10):
4343 - 4352.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. S. Miller, Y. Soignier, A. Panoskaltsis-Mortari, S. A. McNearney, G. H. Yun, S. K. Fautsch, D. McKenna, C. Le, T. E. Defor, L. J. Burns, et al.
Successful adoptive transfer and in vivo expansion of human haploidentical NK cells in patients with cancer
Blood,
April 15, 2005;
105(8):
3051 - 3057.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Sconocchia, H. Fujiwara, K. Rezvani, K. Keyvanfar, F. El Ouriaghli, M. Grube, J. Melenhorst, N. Hensel, and A. J. Barrett
G-CSF-mobilized CD34+ cells cultured in interleukin-2 and stem cell factor generate a phenotypically novel monocyte
J. Leukoc. Biol.,
December 1, 2004;
76(6):
1214 - 1219.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. S. Choi, V. S. Chhabra, Q. H. Nguyen, B. J. Ank, E. R. Stiehm, and R. L. Roberts
Interleukin-15 Enhances Cytotoxicity, Receptor Expression, and Expansion of Neonatal Natural Killer Cells in Long-Term Culture
Clin. Vaccine Immunol.,
September 1, 2004;
11(5):
879 - 888.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Chklovskaia, P. Nowbakht, C. Nissen, A. Gratwohl, M. Bargetzi, and A. Wodnar-Filipowicz
Reconstitution of dendritic and natural killer-cell subsets after allogeneic stem cell transplantation: effects of endogenous flt3 ligand
Blood,
May 15, 2004;
103(10):
3860 - 3868.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. S. Schluns, E. C. Nowak, A. Cabrera-Hernandez, L. Puddington, L. Lefrancois, and H. L. Aguila
Distinct cell types control lymphoid subset development by means of IL-15 and IL-15 receptor {alpha} expression
PNAS,
April 13, 2004;
101(15):
5616 - 5621.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Kataoka, J. R. McGhee, R. Kobayashi, K. Fujihashi, S. Shizukuishi, and K. Fujihashi
Nasal Flt3 Ligand cDNA Elicits CD11c+CD8+ Dendritic Cells for Enhanced Mucosal Immunity
J. Immunol.,
March 15, 2004;
172(6):
3612 - 3619.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Rutella, G. Bonanno, M. Marone, D. de Ritis, A. Mariotti, M. T. Voso, G. Scambia, S. Mancuso, G. Leone, and L. Pierelli
Identification of a Novel Subpopulation of Human Cord Blood CD34-CD133-CD7-CD45+Lineage- Cells Capable of Lymphoid/NK Cell Differentiation After In Vitro Exposure to IL-15
J. Immunol.,
September 15, 2003;
171(6):
2977 - 2988.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Giron-Michel, A. Caignard, M. Fogli, D. Brouty-Boye, D. Briard, M. van Dijk, R. Meazza, S. Ferrini, C. Lebousse-Kerdiles, D. Clay, et al.
Differential STAT3, STAT5, and NF-{kappa}B activation in human hematopoietic progenitors by endogenous interleukin-15: implications in the expression of functional molecules
Blood,
July 1, 2003;
102(1):
109 - 117.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. P. Kalberer, U. Siegler, and A. Wodnar-Filipowicz
Human NK cell development in NOD/SCID mice receiving grafts of cord blood CD34+ cells
Blood,
July 1, 2003;
102(1):
127 - 135.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. A. Perez, P. A. Sotiropoulou, D. G. Gkika, L. G. Mahaira, D. K. Niarchos, A. D. Gritzapis, Y. G. Kavalakis, A. I. Antsaklis, C. N. Baxevanis, and M. Papamichail
A novel myeloid-like NK cell progenitor in human umbilical cord blood
Blood,
May 1, 2003;
101(9):
3444 - 3450.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. P. Mitton, P. K. Swain, H. Khanna, M. Dowd, I. J. Apel, and A. Swaroop
Interaction of retinal bZIP transcription factor NRL with Flt3-interacting zinc-finger protein Fiz1: possible role of Fiz1 as a transcriptional repressor
Hum. Mol. Genet.,
February 15, 2003;
12(4):
365 - 373.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Jiang, B. Zhong, C. Ritchey, D. L. Gilvary, E. Hong-Geller, S. Wei, and J. Y. Djeu
Regulation of Akt-dependent cell survival by Syk and Rac
Blood,
January 1, 2003;
101(1):
236 - 244.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. S. Farag, T. A. Fehniger, L. Ruggeri, A. Velardi, and M. A. Caligiuri
Natural killer cell receptors: new biology and insights into the graft-versus-leukemia effect
Blood,
August 28, 2002;
100(6):
1935 - 1947.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. G. Gilliland and J. D. Griffin
The roles of FLT3 in hematopoiesis and leukemia
Blood,
August 13, 2002;
100(5):
1532 - 1542.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Azzoni, E. Papasavvas, J. Chehimi, J. R. Kostman, K. Mounzer, J. Ondercin, B. Perussia, and L. J. Montaner
Sustained Impairment of IFN-{gamma} Secretion in Suppressed HIV-Infected Patients Despite Mature NK Cell Recovery: Evidence for a Defective Reconstitution of Innate Immunity
J. Immunol.,
June 1, 2002;
168(11):
5764 - 5770.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Briard, D. Brouty-Boye, B. Azzarone, and C. Jasmin
Fibroblasts from Human Spleen Regulate NK Cell Differentiation from Blood CD34+ Progenitors Via Cell Surface IL-15
J. Immunol.,
May 1, 2002;
168(9):
4326 - 4332.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Sivori, M. Falco, E. Marcenaro, S. Parolini, R. Biassoni, C. Bottino, L. Moretta, and A. Moretta
Early expression of triggering receptors and regulatory role of 2B4 in human natural killer cell precursors undergoing in vitro differentiation
PNAS,
March 21, 2002;
(2002)
72065999.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. Shimozato, J. R. Ortaldo, K. L. Komschlies, and H. A. Young
Impaired NK Cell Development in an IFN-{gamma} Transgenic Mouse: Aberrantly Expressed IFN-{gamma} Enhances Hematopoietic Stem Cell Apoptosis and Affects NK Cell Differentiation
J. Immunol.,
February 15, 2002;
168(4):
1746 - 1752.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Nakajima, R. Zhao, T. C. Lund, J. Ward, M. Dolan, B. Hirsch, and J. S. Miller
The BCR/ABL Transgene Causes Abnormal NK Cell Differentiation and Can Be Found in Circulating NK Cells of Advanced Phase Chronic Myelogenous Leukemia Patients
J. Immunol.,
January 15, 2002;
168(2):
643 - 650.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. S. Miller and V. McCullar
Human natural killer cells with polyclonal lectin and immunoglobulinlike receptors develop from single hematopoietic stem cells with preferential expression of NKG2A and KIR2DL2/L3/S2
Blood,
August 1, 2001;
98(3):
705 - 713.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. Cooper, T. A. Fehniger, S. C. Turner, K. S. Chen, B. A. Ghaheri, T. Ghayur, W. E. Carson, and M. A. Caligiuri
Human natural killer cells: a unique innate immunoregulatory role for the CD56bright subset
Blood,
May 15, 2001;
97(10):
3146 - 3151.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. T. Le, K. L. Adams, N. Zaya, H. L. Mathews, W. J. Storkus, and T. M. Ellis
Human Thymic Epithelial Cells Inhibit IL-15- and IL-2-Driven Differentiation of NK Cells from the Early Human Thymic Progenitors
J. Immunol.,
February 15, 2001;
166(4):
2194 - 2201.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Vely, M.-A. Peyrat, C. Couedel, J.-F. Morcet, F. Halary, F. Davodeau, F. Romagne, E. Scotet, X. Saulquin, E. Houssaint, et al.
Regulation of Inhibitory and Activating Killer-Cell Ig-Like Receptor Expression Occurs in T Cells After Termination of TCR Rearrangements
J. Immunol.,
February 15, 2001;
166(4):
2487 - 2494.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Chklovskaia, C. Nissen, L. Landmann, C. Rahner, O. Pfister, and A. Wodnar-Filipowicz
Cell-surface trafficking and release of flt3 ligand from T lymphocytes is induced by common cytokine receptor {gamma}-chain signaling and inhibited by cyclosporin A
Blood,
February 15, 2001;
97(4):
1027 - 1034.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Q. Wu, Y. Sun, J. Wang, X. Lin, Y. Wang, L. E. Pegg, A. Futterer, K. Pfeffer, and Y.-X. Fu
Signal Via Lymphotoxin-{{beta}}R on Bone Marrow Stromal Cells Is Required for an Early Checkpoint of NK Cell Development
J. Immunol.,
February 1, 2001;
166(3):
1684 - 1689.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. A. Fehniger, K. Suzuki, A. Ponnappan, J. B. VanDeusen, M. A. Cooper, S. M. Florea, A. G. Freud, M. L. Robinson, J. Durbin, and M. A. Caligiuri
Fatal Leukemia in Interleukin 15 Transgenic Mice Follows Early Expansions in Natural Killer and Memory Phenotype CD8+ T Cells
J. Exp. Med.,
January 16, 2001;
193(2):
219 - 232.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. A. Fehniger and M. A. Caligiuri
Interleukin 15: biology and relevance to human disease
Blood,
January 1, 2001;
97(1):
14 - 32.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Colucci and J. P. Di Santo
The receptor tyrosine kinase c-kit provides a critical signal for survival, expansion, and maturation of mouse natural killer cells
Blood,
February 1, 2000;
95(3):
984 - 991.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. S. Williams, J. Klem, I. J. Puzanov, P. V. Sivakumar, M. Bennett, and V. Kumar
Differentiation of NK1.1+, Ly49+ NK Cells from flt3+ Multipotent Marrow Progenitor Cells
J. Immunol.,
September 1, 1999;
163(5):
2648 - 2656.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Sivori, M. Falco, E. Marcenaro, S. Parolini, R. Biassoni, C. Bottino, L. Moretta, and A. Moretta
Early expression of triggering receptors and regulatory role of 2B4 in human natural killer cell precursors undergoing in vitro differentiation
PNAS,
April 2, 2002;
99(7):
4526 - 4531.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|