|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 92 No. 10 (November 15), 1998:
pp. 3793-3803
An In Vivo Topoisomerase II Cleavage Site and a DNase I
Hypersensitive Site Colocalize Near Exon 9 in the MLL
Breakpoint Cluster Region
By
Pamela L. Strissel,
Reiner Strick,
Janet D. Rowley, and
Nancy
J. Zeleznik-Le
From the Department of Medicine, University of Chicago, Chicago, IL.
 |
ABSTRACT |
The human myeloid-lymphoid leukemia gene, MLL (also called
ALL-1, Htrx, or HRX ), maps to chromosomal band
11q23. MLL is involved in translocations that result in de novo
acute lymphoblastic leukemia (ALL), acute myelogenous leukemia (AML),
mixed lineage leukemia, and also in therapy AML (t-AML) and therapy ALL
(t-ALL) resulting from treatment with DNA topoisomerase II (topo II)
targeting drugs. MLL can recombine with more than 30 other
chromosomal bands, of which 16 of the partner genes have been cloned.
Breaks in MLL occur in an 8.3-kb breakpoint cluster region
(BCR) encompassing exons 5 through 11. We recently demonstrated that
75% of de novo patient breakpoints in MLL mapped in the
centromeric half of the BCR between two scaffold-associated
regions (SAR), whereas 75% of the t-AML patient breakpoints mapped to
the telomeric half of the BCR within a strong SAR. We have mapped
additional structural elements in the BCR. An in vivo DNA topo II
cleavage site (induced with several different drugs that target topo
II) mapped near exon 9 in three leukemia cell lines. A strong DNase I
hypersensitive site (HS) also mapped near exon 9 in four leukemia cell
lines, including two in which MLL was rearranged [a t(6;11)
and a t(9;11)], and in two lymphoblastoid cell lines with normal
MLL. Two of the leukemia cell lines also showed an in vivo topo
II cleavage site. Our results suggest that the chromatin structure of
the MLL BCR may influence the location of DNA breaks in both de
novo and therapy-related leukemias. We propose that topo II is enriched
in the MLL telomeric SAR and that it cleaves the DNase I HS
site after treatment with topo II inhibitors. These events may be
involved in recombination associated with t-AML/t-ALL breakpoints
mapping in the MLL SAR.
© 1998 by The American Society of Hematology.
| |
INTRODUCTION |
THE MYELOID-LYMPHOID
leukemia (MLL)1 gene (also called
ALL-1,2 Htrx,3 and
HRX 4), which maps to human chromosome 11 band
q23 (11q23), recombines with more than 30 different chromosomal partners (reviewed in Rowley5 and Bernard and
Berger6),7-10 resulting in acute myelogenous
leukemia (AML; usually monoblastic), acute lymphoblastic leukemia (ALL)
and, more rarely, in lymphoma and myelodysplastic
syndromes.11,12 The most common 11q23 translocations involving MLL are the t(9;11), t(6;11), and t(11;19)(19p13.1), usually resulting in AML de novo, and the t(4;11) and
t(11;19)(19p13.3), usually resulting in ALL.5,6,11,12 Sixty
to eighty percent of cases of acute leukemia in children less than 1 year of age show MLL rearrangements.13-16 Depending
on the schedule and the total dosage, between 1% and 15% of cancer
patients treated with chemotherapeutic drugs, particularly the
epipodophyllotoxins that target topoisomerase II (topo II), develop
therapy AML (t-AML) and, in rare cases, therapy ALL
(t-ALL).17-21 The translocation t(9;11) is the most common
of the 11q23 translocations in t-AML.11,22
Although the MLL gene spans approximately 90 kb,23
virtually all MLL breaks occur in an 8.3-kb BamHI
fragment, the breakpoint cluster region (BCR).5,6 We and
others have cloned and sequenced a total of 19 de
novo6,22,24-28 and 3 t-AML21,29 patient breakpoint junctions. A variety of motifs, including topo II consensus cleavage sites, chi, and heptamer and nonamer consensus sequences have
been noted at or near the breakpoint junctions. In addition, the
MLL breakpoint region contains eight Alu repetitive elements, five of which occur in the first half of the BCR, the site of the
majority of MLL breakpoints in de novo
leukemias.24,30,31 However, breakpoints in only one
translocation and in several MLL partial duplications found in
de novo leukemia with a normal karyotype map within Alu repeats on both
partner chromosomes.6,22,26,31-33 Previously, we mapped the
location of patient breakpoints within the BCR and showed that 75% of
de novo patient breakpoints mapped in the centromeric half of the BCR
between two scaffold-associated regions (SARs), whereas 75% of the
t-AML patient breakpoints mapped to the telomeric half of the BCR
within a strong SAR, which colocalized with 6 of 7 topo II consensus
cleavage sites (see Fig 1 in Strissel Broeker et al30).
We proposed that the chromatin structure of this 8.3-kb BCR may
influence the location of breaks in MLL. Recently, a study of
patients with t(4;11) leukemia reported that most de novo adults had a
break in the centromeric half of the BCR, whereas most infants (de
novo) and all t-AML breaks occurred in the telomeric half.34 These data raise the possibility that a similar
mechanism may be involved in breakpoints in both t-AML/t-ALL and in de
novo infant leukemia.
In mammalian cells, topo II has both enzymatic and structural
functions. There are two genetically and biochemically distinct topo II
isoforms, topo II  and topo II  .35,36 Studies show that topo II localizes in the nucleus, with its peak level of expression occurring at the G2/M boundary in the cell
cycle.35 Topo II localizes in the nucleolus and shows
constant levels during the cell cycle.36 As a structural
protein, topo II is needed for chromosome condensation, in which it
colocalizes to the metaphase scaffold of native chromsomes, where it is
thought to bind to SARs.37,38 Topo II has been implicated
in recombination events, particularly at the mouse Ig  light chain
gene intronic SAR, and also at the MLL
BCR.21,30,39-41
In general, DNase I hypersensitive sites (HS) represent nucleosomal DNA
that have become conformationally changed due to the binding of
specific proteins to target DNA sequences. They are identified in the
genome by their susceptibility to DNase I cleavage. For example, DNase
I HS are associated with the enhancers of transcriptionally active
genes,42-45 and they map to the boundaries of genes in
locus control regions.43,46 DNase I HS also associate with
SARs,46,47 where some SARs also show in vitro or in vivo
topo II cleavage.39,41,47 In yeast, DNase I sites are hot
spots for mitotic and meiotic recombination.48
Because of the association of previous treatment with topo II targeting
drugs and MLL rearrangements, we analyzed whether these drugs
could induce cleavage in the MLL BCR, particularly in the
MLL telomeric SAR.30,49 We have also investigated
whether the MLL BCR contains regions that are susceptible to
DNase I cleavage.
| |
MATERIALS AND METHODS |
Cell lines.
The chronic myelogenous leukemia (CML) BV173 cell line has the
phenotype of nondifferentiated stem cells derived from a CML patient in
blast crisis.50 The primary clone in this cell line (karyotyped at the University of Chicago, Chicago, IL) contains one
normal chromosome 22 and three copies of the Ph chromosome derived from
the t(9;22)(q34,q11). The UoC-M1 cell line is derived from a patient
with AML.51 This cell line has a complex karyotype (karyotyped at the University of Chicago), with four copies of a
germline MLL. Two B-lymphoblastoid cell lines (B-LCL), IB-4 generated from normal cord blood (kindly provided by Dr David Liebowitz, University of Chicago, Chicago, IL) and 9020 generated from a patient with t-AML and a t(9;11) involving MLL
(kindly provided by Dr Richard Larson, University of Chicago), were
established at the University of Chicago. The ML-2 cell line carrying a
t(6;11)(q27;q23), and the Mono Mac 6 (MM6) cell line carrying a
t(9;11)(p22;q23) were derived from patients with AML M5 de
novo.52,53 The cell lines have MLL fusions with the
AF6 and AF9 genes, respectively, which have been
characterized in our laboratory.22,54 Additional cell lines
studied were YK-M2, HL-60 (human promyelocytic leukemia cells),
K562 (erythroleukemia cells derived from a CML patient in blast
crisis), and the Burkitt lymphoma cell line, Raji. All cells were
cultured in RPMI supplemented with 10% fetal calf serum, 1% HEPES,
and sodium bicarbonate (amount adjusted per lot).
In vivo cleavage with DNA topoisomerase II.
Cells grown exponentially in complete media (RPMI 1640, fetal calf
serum 10%; GIBCO, Grand Island, NY) were diluted and then treated for 6 or 16 hours with the nonintercalating topo II inhibitors etoposide (VP16 100 µmol/L; Sigma, St Louis, MO), teniposide (VM26 50 µmol/L, 100 µmol/L), or the intercalating topo II inhibitor doxorubicin (10 µmol/L to 50 µmol/L; Sigma) to produce endogenous topo II-cleaved complexes. Cells were then lysed and the DNA was isolated using a previously described method to trap cleaved topo II
DNA.55 BV173 cells were also treated with additional
damaging agents, including Aclarubicin (0.5 µmol/L to 50 µmol/L;
Sigma) and N-Methylformamide (0.5 mol/L; Sigma). To map the approximate location of the drug-induced cleavage site, indirect end labeling was
used by hybridizing two probes to Southern blots, an MLL
telomeric probe (bp 7955-8332 of the MLL BCR56)
and the 0.74-kb cDNA (exons 5, 6, 7, 9, 10, and 11)
polymerase chain reaction (PCR) probe.57
Isolation of nuclei for DNAse I cleavage studies.
For each hematopoietic cell line, approximately 5.0 × 108
cells were isolated for nuclei according to Mirkovitch et
al,58 with some modifications. All nuclear isolation steps
were on ice. Briefly, cells were treated with chilled hypotonic
solution I (3.75 mmol/L Tris/HCl, 0.5% thiodiglycol, 0.05 mmol/L
spermine, 0.125 mmol/L spermidine, 0.5 mmol/L KOH/EDTA, protease
inhibitors [0.1 mmol/L phenylmethysulfonyl fluoride
(PMSF), and 0.5% aprotinin], and 20 mmol/L KCl). After two washes,
cells were treated with ice-cold solution I + digitonin (0.1%)
(solution II). After cellular homogenization, nuclei were centrifuged
through a 0.25 mol/L sucrose cushion, washed several times with
solution II, optical density (OD) readings were
determined, and then the nuclei were frozen in 50% glycerol/solution
II at  20°C for up to 4 months.
Treatment of nuclei with the DNase I endonuclease.
For DNase I treatment of nuclei, we used the methods of Kas and
Laemmli,47 with modifications. Briefly, a total of 12 OD units of nuclei were washed in a 1× working solution (15 mmol/L Tris/HCl, 0.2 mmol/L spermine, 0.5 mmol/L spermidine, 80 mmol/L KCl,
0.1% digitonin, and the protease inhibitors PMSF [0.2 mmol/L] and
aprotinin [1.0%]). Immediately, a range of DNase I enzyme units
(0.20 to 20.0 U; Boehringer Mannheim, Indianapolis, IN) were added to each tube containing 1.6 OD units of nuclei and resuspended gently. After an incubation on ice for 5 minutes, all DNase
I reactions were stopped by adding 1 µl of 0.5 mol/L EDTA and a 2×
buffer containing 100 mmol/L Tris/HCl, 0.5% sodium dodecyl sulfate, and 25 mmol/L EDTA. All samples were diluted into 1×
TE containing 250 ng/µL RNase A (Sigma). After 1 hour of incubation at 37°C, proteinase K was added and incubated for an
additional 1 hour at 55°C. All DNase I samples were then incubated overnight at 37°C. The following day, each sample was diluted 1:1
with TE, and the DNA was extracted first with phenol and then with
phenol/chloroform. The DNA was precipitated with isopropanol in the
presence of 0.3 mol/L Na acetate or 0.7 mol/L ammonium acetate.
Southern blot and DNA probe hybridizations.
After digestion of the DNase I samples with restriction enzymes,
approximately 15 to 20 µg of DNA (determined by OD readings) was
electrophoresed on 0.8% or 1.0% agarose gels. Using standard conditions for Southern blotting (without acid depurination), the DNA
was transferred by electroblotting in a 12 mmol/L Tris, 6 mmol/L Na
acetate, and 0.3 mmol/L EDTA (pH 7.5)-containing buffer to
GeneScreen or Hybond (Amersham, Arlington Heights, IL)
positively charged nylon membranes.59 Using indirect end
labeling,42 hybridization of DNA probes to Southern blots
was performed according to standard protocols, with 50% formamide at
42°C. With certain probes, Cot I DNA (100 µg;
GIBCO-BRL, Gaithersburg, MD) was used in the
prehybridization and hybridization steps to block repetitive elements.
For topo II analysis, high molecular weight DNA was digested with
BamHI and analyzed by Southern blot using standard conditions
as previously described.12
DNA probe isolation.
Cloned DNA fragments or PCR-amplified products were purified from
agarose gels after gel electrophoresis and were used as probes.60 Figure 1 shows a
restriction map of the MLL BCR and the location of all the
MLL probes used for this study. Primers chosen for MLL
amplification corresponded to non-Alu regions of the 8.3-kb
BamHI BCR. The following are the DNA fragments listed in the
centromeric to telomeric orientation in the MLL gene: a cloned
0.32-kb Rsa I DNA fragment, which maps centromeric to the 8.3-kb MLL BCR (kindly provided by Dr Peter Domer, University of Chicago); a 0.48-kb PCR DNA fragment, the cen probe, which maps
adjacent to the centromeric BamHI site and within the
MLL BCR (top primer 5 GGATCCTGCCCCAAAGAAAAGCAGTAGTGAGCC 3,
and bottom primer 5 AGGCTTCGAACAGGAAATTAAAACAATACCTCC 3); a 1.2-kb
Bgl II/Sac I PCR DNA fragment, which maps to the middle
of the MLL BCR30; a 0.8-kb Nco
I/BamHI cloned DNA fragment, which maps to the telomeric region
of the MLL BCR; a 0.385-kb PCR DNA fragment, tel probe, which
maps adjacent to the telomeric BamHI site within the
MLL BCR (top primer 5 TTTTCTTACAGCAGCTGCTGGAGTGTAAT 3, and bottom primer 5 AGCTCTTACAGCGAACACACTTGGTACAGATC 3); the 0.74-kb complementary DNA (cDNA) (MLL exons 5, 6, 7, 9, 10, and 11) PCR fragment57; and two DNA fragments that map
adjacent and telomeric to the 8.3-kb BamHI BCR a 0.6-kb
PstI DNA fragment isolated from the  phage clone 14p, a
14-kb telomeric BamHI fragment (0.6-kb P), and a 0.9-kb H/E DNA
fragment isolated from the MM6 der(9) EcoRI clone (0.9-kb H/E;
Fig 1).22 The AF9MM6 probe was PCR amplified from
the AF9 C48 cosmid DNA.22 This AF9MM6 DNA
fragment maps centromeric and adjacent to the MM6 breakpoint junction
and thus identifies both the AF9 germline and the der(9)
EcoRI DNA fragments (top primer 5
ATATTATGTACAAGAATAAGTTATGCTCTA 3, bottom primer 5
AATAGAATTAGAATACTGGAGCTC 3).
View larger version (12K):
[in this window]
[in a new window]
| Fig 1.
Restriction map of the MLL BCR showing the
location of the MLL probes used in this study, the in vivo topo
II cleavage site, and the DNA damaging agent cleavage site (large black
arrow above the map). Above the map and indicated as grey hatched boxes
are the genomic probes from left to right: the 0.32-kb Rsa I
DNA fragment, the 0.8-kb Nco I/BamHI DNA fragment, the
0.6-kb P DNA fragment, and the 0.9-kb H/E DNA fragment. Below the map
are the PCR probes: the cen 0.48-kb DNA fragment, the 1.2-kb
Bgl II/Sac I DNA fragment, the 0.74-kb
cDNA, and the tel 0.385-kb DNA fragment. Restriction enzyme sites are
indicated along the black line showing the MLL BCR and regions
centromeric and telomeric to the BCR. BamHI (B) DNA fragments
covering 42 kb (black lines indicated above the map), including the
centromeric 24-kb fragment, the 8.3-kb BCR DNA fragment, and the 14-kb
telomeric DNA fragment, were analyzed for in vivo cleavage of topo II
by hybridizing the 0.32-kb Rsa I, the 0.74-kb cDNA, the tel,
and the 0.6-kb P probes to BamHI digestions of
etoposide-treated cells. Only the 8.3-kb BCR DNA fragment in BV173
cells was analyzed for cleavage using the DNA damaging agents
aclarubicin and N-Methylformamide. Black bars below the map are the
weak centromeric and strong telomeric SARs.30 Numbered
exons are represented as grey hatched rectangles on the map. The
restriction map is not drawn to scale centromeric or telomeric to the
double thick black diagonal lines (//). Restriction enzymes are noted
on the map as follows: B, BamHI; S, Sac I; H,
HindIII; E, EcoRI; Bg, Bgl II; X, Xba
I. Note that the Bg* enzyme restriction site is polymorphic in BV173
cells.
|
|
We also used DNA probes for other gene regions. The AML1 exon 6 probe was PCR amplified from the AML1B cDNA clone (kindly provided by Dr Guiseppina Nuicifora, Loyola University, Chicago IL; top
primer 5 GACATCGGCAGAAACGAGATGATCAGACC 3, bottom primer 5
GCATCTGACTCTGAGGCTGAGGGTTAAAG 3). BCR gene probes (on
chromosome 22) included the 2.3-kb EcoRI/BamHI fragment
isolated from the ALL SUPB13 breakpoint junction61 and the
5 and 3 BCR DNA fragments isolated from the 5.8-kb major BCR
(MBCR).62 The 5 MBCR BCR DNA probe detects a known
HS site approximately 8 kb 5 to the MBCR.63 The
-globin IVS2 probe (kindly provided by Dr Owen Witte, UCLA,
Los Angeles, CA) was used as a negative control for DNase I HS sites in
cell lines that do not express the -globin gene.
| |
RESULTS |
In this study, we describe structural elements that map to the same
region within the MLL BCR: an in vivo topo II cleavage site, a
strong DNase I HS site, and a cleavage site induced with DNA damaging
agents. These DNA structural elements may contribute to the location
and to the mechanism of breakage leading to leukemia.
An in vivo topo II cleavage site maps near exon 9.
After treatment of BV173 cells with either etoposide, teniposide, or
doxorubicin, we identified one additional DNA band within the
MLL BCR using BamHI-digested DNA and a probe located at
the telomeric end of the MLL BCR (Figs 1 and
2A). Two additional DNA bands
(approximately 6.9 to 7.0 kb and 1.5 to 1.6 kb) were also observed
using the 0.74-kb cDNA probe after treatment with etoposide, doxorubicin, aclarubicin, and N-Methylformamide (Figs 1 and
2B and data not shown). In general, treatment with etoposides showed a
much stronger DNA cleavage than treatment of cells with aclarubicin or
with N-Methylformamide (data not shown). The cleavage site mapped
approximately 1.5 to 1.6 kb from the telomeric BamHI site in
the MLL BCR, which is near to exon 9 within the telomeric SAR (Fig 1).30 We detected only one in vivo topo II cleavage
site mapping within this region, regardless of which topo II-targeting drug was used and with a range of drug concentrations. We identified this same topo II cleavage site in two additional hematopoietic cell
lines tested: UoC-M1 and YK-M2 (data not shown). However, we were
unable to detect cleavage using similar conditions in some other cell
lines, including HL60, K562, Raji, and several B-LCLs (9020 and IB-4;
data not shown). In the case of BV173, in which we noted topo II
cleavage, we hybridized the same blots with MLL probes (0.32-kb
Rsa I and 0.6-kb Pst I) that identify the MLL
24-kb centromeric and 14-kb telomeric BamHI fragments, respectively, and did not detect any new size fragments (Fig 1 and data
not shown). Hybridization of these blots with the -globin probe also did not identify any other regions with drug-induced cleavage sites (data not shown). Therefore, this topo II cleavage site
was a specific event.
View larger version (75K):
[in this window]
[in a new window]
View larger version (71K):
[in this window]
[in a new window]
| Fig 2.
Southern blots of BV173 DNA showing
drug-induced cleavage of the MLL BCR. (A) The lanes from left
to right show the marker (M), a negative control [() where no drugs
were added to BV173 cells], VP16 cell treatment (100 µmol/L, 200 µmol/L), VM26 cell treatment (50 µmol/L, 100 µmol/L), and
doxorubicin (Dox) cell treatment (10 µmol/L). An increasing amount of
drug added is indicated by a triangle above the lanes. The PCR genomic
probe (tel; see Fig 1) was hybridized to the Southern blot. The 8.3-kb
germline DNA fragment and the new 1.5- to 1.6-kb drug-induced DNA
fragment are indicated. (B) The lanes from left to right show DNase
I-treated nuclei (0 to 20 U as indicated), a 16-hour drug treatment of
BV173 cells, including a dimethyl sulfoxide control (C),
VP16 (100 µmtwo lanes), and N-Methylformamide (NMF; 0.5 mol/L). The
PCR cDNA probe indicated above (0.74 kb) was hybridized to
BamHI-digested DNA. The 8.3-kb germline and two new DNase I and
drug-induced DNA fragments (1.5 kb and 6.9 to 7.0 kb) are indicated to
the right. The DNase I, topo II, and DNA damaging agent cleavage sites
either map within exon 9 or just telomeric of exon 9. Note that the new
6.9- to 7.0-kb DNA fragment is strongly hybridizing with exons 5, 6, and 7 and either all or half of exon 9. In contrast, the 1.5-kb DNA
fragment is hybridizing more weakly with either none or half of exon 9, plus exon 10 and half of exon 11 (133 bp or 206 bp, respectively). The
1-kb marker (M) indicated to the left identifies a few of the molecular
weight bands that cross-hybridize with this probe.
|
|
A strong DNase I site maps to the telomeric region of the MLL BCR
near exon 9.
We analyzed the DNA regions within and outside the MLL BCR for
the presence of DNase I HS. Nuclei from six cell lines were treated
with increasing concentrations of DNase I and were then hybridized with
various MLL probes. Figure 3 shows
a summary of our MLL DNase I mapping results. For all six cell
lines tested, we mapped a single strong DNase I HS site near exon 9. In
contrast, no DNase I HS mapped in the centromeric half of the BCR or in 24 kb centromeric or 14 kb telomeric to the BCR in the cell lines studied. For example, in BV173 cells, the 1.2-kb Bgl
II/Sac I DNA fragment hybridizes to a 6.6-kb Bgl II
germline fragment and a new 5.0-kb Bgl II DNase I fragment
(Figs 3 and 4A). In the UoC-M1 cell line,
the MLL cen probe hybridizes to the 8.3-kb BamHI
germline fragment and a new 6.9- to 7.0-kb BamHI DNase I
fragment (Fig 3 and data not shown). No DNase I fragment was observed
in the centromeric region of the BCR (Figs 3 and 4B). Because both the 1.2-kb Bgl II/Sac I probe and the MLL cen probe
map at the centromeric ends of the digested MLL DNA, we were
able to map the DNase I HS near exon 9 (Fig 3).
View larger version (29K):
[in this window]
[in a new window]
| Fig 3.
A DNase I HS site maps near exon 9 in the MLL
BCR. Restriction map of the MLL BCR and adjacent regions are
represented. Exons, SARs, and restriction enzymes are the same as in
Fig 1. The restriction map is not drawn to scale centromeric or
telomeric to the double thick black diagonal lines (//). The large
black arrow above the map represents the strong DNase I cleavage site
near exon 9. Probes are represented as grey hatched boxes above the
map, and the 7 small black arrows above the map represent potential
topo II in vivo cleavage sites identified by computer
analysis.30 Thin black lines below the map identify
germline fragments that hybridize with the probes above. Thick lines
below the map represent the new DNase I fragments that are only
observed after DNase I digestion. Note that only BamHI and
Bgl II germline (thin lines) and DNase I (thick lines)
fragments are represented below the restriction digest map to show
examples of our results. The table below the map represents a summary
of the DNA restriction digests, the gene probes, and DNase I HS results
correlated with the MLL map. The two top rows for each set of
results correspond to the probes hybridized (in bold) to DNA isolated
from DNase I-treated nuclei and digested with particular enzymes
(second row, or otherwise indicated). Restriction enzymes:
BamHI (B), Bgl II (Bg), EcoRI (E), Nco
I, and Pst I. Results are indicated as + for the presence of
DNase I HS, for negative for DNase I HS, and nd for not
determined.
|
|
View larger version (46K):
[in this window]
[in a new window]
| Fig 4.
BV173 Southern blot showing the MLL BCR DNase I
HS site. A Southern blot representing BamHI/Bgl
II-digested DNA from DNase I-treated (DNase I units directly above
each lane) and BV173 whole nuclei was hybridized independently with
MLL BCR DNA probes (indicated above each panel). Phage
HindIII/EcoRI-digested marker (left of [A])
correlates with all three hybridizations. (A) Top germline 6.6-kb
Bgl II DNA fragment hybridizing with the 1.2-kb Bgl
II/Sac I DNA probe is seen in all lanes. A new 5.0-kb
Bgl II/DNase I DNA fragment (arrow) is not observed in the
absence of DNase I, but increases in intensity at higher DNase I
concentrations. (B) A germline 2.2-kb DNA fragment is observed in all
DNA lanes; thus, the centromeric portion of the MLL BCR is
negative for DNase I HS sites. (C) The germline 6.0-kb Bgl II
DNA fragment hybridizing with the 0.8-kb Nco I-BamHI
DNA probe is seen in all of the DNA lanes. A new 1.4-kb Bgl II
DNA fragment is not observed in the absence of DNase I, but increases
in intensity at higher concentrations of DNase I (arrow).
|
|
To define the location of the DNase I HS on smaller DNA fragments, we
hybridized the 0.8-kb Nco I/BamHI MLL telomeric
DNA fragment to BamHI/Bgl II- and
BamHI-digested DNA from DNase I-treated BV173 and UoC-M1
nuclei (Figs 3 and 4C and data not shown). In addition to MLL
germline fragments, results showed two new DNase I HS DNA fragments, a
1.4-kb Bgl II fragment and a 1.5- to 1.6-kb BamHI
fragment, which increased in intensity with higher DNase I
concentrations (Fig 4C and data not shown). These results confirm that
the HS maps within the previously mapped strong SAR near to exon 9 and,
interestingly, maps to the same region as the in vivo topo II cleavage
site as well as the cleavage site induced with DNA damaging agents
(Figs 2B and 3).30
We studied four other cell lines, including 9020, IB-4, and two
leukemia cell lines, the ML-2 [t(6;11)] and MM6 [t(9;11)], in which
the MLL gene is rearranged as a consequence of a translocation. Our results showed a strong DNase I HS site mapping to the same region
as BV173 and UoC-M1 cells in all four cell lines (Fig 3). Cytogenetic
analysis of the ML-2 cell line shows a complex tetraploid karyotype,
including two copies of the der(6) and der(11) chromosomes that result
from the balanced t(6;11) and two copies of a deleted chromosome 6 and
a second abnormal chromosome 11 with an interstitial deletion from
MLL intron 6 through the ETS1 probe at
11q25.52,54 The ML-2 cell line contains rearrangements of
all MLL alleles, with the genomic breakpoint in all alleles
mapping in the first half of the BCR between exons 6 and
7.54 In this cell line, the DNase I HS site is translocated
to the derivative 6 chromosome mapping approximately 5.3 kb telomeric
to the MLL/AF6 fusion point (Fig 3 and data not shown).
With the MM6 cell line with a t(9;11), we defined the location of the
DNase I HS more precisely. This cell line is hypotetraploid and has a
complex karyotype including two copies of the normal chromosomes 9 and
11 and two copies of the derivative chromosomes 9 and
11.22,53 Both MLL and AF9 show staggered
breaks that result in deletions.22 With more precise
mapping, the MLL deletion, which we initially
determined to be 499 bp, has been determined to be 507 bp of
MLL (from nucleotides 6577 to 7084 in the MLL BCR). The
deletion of AF9 is 165 bp.22 Interestingly, the
DNase I HS region appears to map within the region of MLL that
is deleted in both derivative chromosomes 9 and 11. Thus, in MM6 cells,
we predict that the DNase I HS site maps only on the two normal 11 chromosomes. Hybridizing two MLL probes that map
telomeric to the MM6 MLL breakpoint, the 0.6-kb P and the
0.9-kb H/E DNA fragments to EcoRI-digested DNA, we observed a
4.3-kb MLL germline DNA fragment, a 6.0-kb der (9) DNA
fragment, and a new 3.2-kb DNase I HS fragment (Figs 3 and 5A and
B). Hybridizing the AF9MM6 probe to
the same blot only showed a germline AF9 3.4-kb DNA fragment
and the der (9) 6.0-kb rearranged DNA fragment (Fig 5C). Because we did
not detect the 3.2-kb DNase I HS fragment with the AF9MM6
probe, which we did with both MLL probes (0.6-kb P and 0.9-kb
H/E), we conclude that the MLL DNase I HS region did not
translocate to AF9 and therefore does not map telomeric to
nucleotide (nt) 7087 in the MLL BCR.
View larger version (64K):
[in this window]
[in a new window]
| Fig 5.
MM6 DNA Southern blot showing the MLL DNase I HS
site on the normal 11 chromosomes. Southern blot representing
EcoRI-digested DNA from DNase I-treated (DNase I units used
indicated directly above panels) MM6 whole nuclei was hybridized
independently with three DNA probes (indicated above each panel). The
1-kb plasmid marker is shown to the left of (A) and also correlates
with hybridizations in (B) and (C). (A) The top 6.0-kb DNA band
hybridizing with the MLL 0.6-kb P probe represents the der (9)
and is observed in all DNA lanes. The middle MLL 4.5-kb
germline (G) DNA band is seen in all DNA lanes. A new 3.2-kb
EcoRI/DNase I DNA fragment is only observed in DNase I-treated
whole nuclei (arrow). (B) The top 6.0-kb DNA band hybridizing with the
MLL 0.9-kb HindIII/EcoRI DNA probe represents
the der(9) and is observed in all DNA lanes. The middle MLL
4.5-kb germline (G) DNA band is seen in all DNA lanes. A new 3.2-kb
EcoRI/DNase I DNA fragment is only observed in DNase I-treated
whole nuclei (arrow). This is the same DNA fragment to which the 0.6-kb
P probe hybridizes. (C) The top 6.0-kb DNA band hybridizing with the
AF9MM6 probe represents the der (9) and is observed in all DNA
lanes. The 3.4-kb DNA band represents the AF9 germline (G)
region containing the MM6 deletion breakpoint region and is also
observed in all DNA lanes.
|
|
In summary, based on our Southern blot analysis of MM6 cells together
with the five other cell lines studied, particularly our hybridizations
with the 0.8-kb Nco I/BamHI probe, we predict that a
strong DNase I HS site maps to the 387-bp region between nucleotides
6700 and 7087 (containing exon 9) in the MLL BCR. In contrast,
no DNase I HS sites mapped in the centromeric half of the BCR or
outside the MLL BCR for a total of 42 kb.
Additional gene regions studied for DNase I HS.
Three other gene regions, one of which is involved in topo
II-associated t-AML, were also tested for DNase I hypersensitivity. The
AML1 gene on chromosome 21 is involved in the t(8;21)(q22;q22) in both de novo leukemia and in t-AML after therapy with drugs that
target DNA topo II.19,64 We examined a 23.9-kb
BamHI DNA fragment that contains exon 6 with 1.7 kb of intron 5 and 22.2 kb of intron 6, the location of many of the translocation
breakpoints.64 We also examined two BamHI and
Bgl II DNA regions from the BCR gene on chromosome 22 involved in the t(9;22): the ALL BCR and the CML MBCR; and a 14-kb
BamHI DNA region from the -globin gene that is not
involved in translocations.61-63 In the AML1 23-kb BamHI gene region containing intron 6, in both the BV173 and
UoC-M1 cell lines, we detected no DNase I HS sites (up to 20 U of DNase I enzyme; data not shown). In the BCR gene, we observed
possibly three DNase I HS sites mapping to the ALL BCR in BV173 cells, whereas no DNase I HS sites mapped to this same region in three other
cell lines tested (UoC-M1, 9020, and IB-4; P.L. Strissel, unpublished data). We detected a strong DNase I HS site approximately 8 kb 5 to the CML MBCR in the BCR gene in all cell lines tested (BV173, UoC-M1, 9020, IB4, and MM6). This DNase I HS site had been
previously mapped in the K562 cell line.63 In addition to
the DNase I HS site 5 to the CML MBCR, we observed a strong HS site
that maps within the 5.8-kb MBCR in the BV173, the UoC-M1, and the ML-2
cell lines but not in the B-LCLs (9020 and IB4; P.L. Strissel, unpublished data). The -globin gene
(the BamHI DNA region including intron 2, exon 3, and the
enhancer element) lacked any hypersensitive sites, indicating that it
is in a closed chromatin configuration in each of these cell lines
(data not shown).
| |
DISCUSSION |
The MLL BCR is a unique region to study mechanisms of
illegitimate recombination, because virtually all of de novo and
therapy-related leukemia patient breakpoints involving MLL map
within the 8.3-kb BamHI fragment. As an approach to try to
understand MLL BCR illegitimate recombination events, we have
studied various DNA structural elements. We mapped an in vivo topo II
cleavage site, a strong DNase I HS, and a DNA damaging cleavage site to
the same region near exon 9. In contrast, no topo II cleavage sites or
DNase I HS sites were found in the centromeric half of the MLL
BCR or outside of the BCR for a total of 42 kb.
Our observations confirm our preliminary results49 and
those of others40,41 who have detected a single in vivo
topo II cleavage site near exon 9 in the MLL BCR and who also
noted that no other topo II cleavage sites mapped centromeric in the
BCR or centromeric and telomeric in the adjacent BamHI
fragments.40 Domer et al21 also observed in
vivo topo II cleavage in the MLL BCR of HL-60 cells. Although
they did not use indirect or direct end labeling experiments, they
observed two in vivo topo II cleavage sites, one of which most likely
colocalizes with the cleavage site near to exon 9.21
Despite the fact that different MLL BCR probes (representing
the centromeric, the middle, and telomeric regions) and various
restriction enzyme-digested genomic DNA were used in these
investigations, the majority of the studies identified a single in vivo
topo II cleavage site on Southern blots, thus confirming that the
location of the cleavage site is specific to the MLL BCR region
(this report and previous literature21,40,41).
The observations of various groups demonstrate differences in topo II
cleavage susceptibility between various cell types and also show DNA
cleavage with DNA damaging agents or cell starvation. In these
investigations, cells were cultured using various apoptosis-inducing drugs that target topo II (etoposide, tenoposide, and doxorubicin) or
genotoxic chemotherapeutic agents or culture conditions (fetal calf
serum starvation) that do not target topo II (this report and previous
literature21,40,41). We observed drug-induced cleavage in
undifferentiated blast cells (BV173) using both topo II targeting drugs
and additional DNA damaging agents (Figs 1 and 2A and B). In two
myeloid cell lines (UoC-M1 and YK-M2), we observed topo II cleavage
(Fig 1). However, we did not observe any topo II cleavage in
HL-60 myeloid cells, in K562 erythroleukemia cells, or in the Burkitt
lymphoma (Raji) or the two B-LCLs tested (IB-4 and 9020). Thus, we
detected differences in topo II cleavage susceptibility between myeloid
cell lines; however, we did not observe cleavage in the lymphoblastic
cell lines. Domer et al21 observed in vivo topo II cleavage
sites in the MLL BCR in the HL-60 cell line, whereas Aplan et
al40 observed topo II cleavage only in one (ML-1 cells) of
six (HL-60, KG-1, K562, U937, HEL) myeloid cell lines; in contrast to
our results, they observed cleavage in Raji cells. Aplan et
al40 also observed that topo II cleaved the MLL BCR
in normal peripheral blood cells (±phytohemagglutinin), in T-ALL cells at diagnosis, in 4 of 6 T- and 3 of 4 B-cell lines, and
in one small cell lung carcinoma cell line. They did not observe cleavage in HeLa or in cell lines from a neuroblastoma, fibrosarcoma, or a bladder cell line. Possible explanations for these conflicting results between our data and those of others21,40 with
regard to HL60 and Raji cells could be that cell lines after a
different number of passages may have become resistant to etoposide
(possibly through mutations in the topo II gene) or may have acquired
mutations in the multidrug resistant (MDR) gene65
or that the cells could have reduced their topo II enzymatic
activity.66 One example supporting resistance to etoposide
is a variant HL-60 cell line that was selected for resistance to
doxorubicin.67 This HL-60 cell line demonstrates a 10×
and 20× resistance to doxorubicin and etoposide, respectively, when
compared with the parental HL-60 cells.
The MLL DNase I HS site was present in all six hematopoietic
cell lines we tested, including undifferentiated blast cells (BV173),
three myeloid cell lines (UoC-M1, ML-2, and MM6), and two B-LCLs (IB-4
and 9020; Fig 3). Thus, in our study, the DNase I HS and the in vivo
topo II cleavage site both occur in the same MLL region in
BV173 and in UoC-M1 cells. The BV173 cleavage site induced with
additional DNA damaging agents also maps to the region where DNase I
and topo II cleaves. In contrast, DNase I hypersensitivity but not topo
II cleavage was observed in the B-LCLs. In all of these cell lines, the
DNase I cleavage was strong, appearing first at 2.0 U DNase I and at
4°C (Figs 4A and C and 5A and B). In the ML-2 cell line, the DNase I
HS was located on the derivative 6 chromosome as a result of the
t(6;11). In the MM6 t(9;11) cell line, we mapped the DNase I HS
cleavage site in the BCR more precisely to a 387-bp region between
nucleotides 6700 and 7087 (containing exon 9 on two normal 11 chromosomes). We did not test for DNase I cleavage in any T-cell lines
or in other tissues; therefore, at present we do not know whether this
site shows tissue specificity. As noted earlier, Aplan et
al40 detected the topo II cleavage site in T cells.
In addition to MLL, we examined regions of other genes for
DNase I HS sites and topo II cleavage. No HS sites were found in a
23.9-kb region of AML1. This region consists of 1.7 kb of
intron 5 and 22.2 kb of intron 6 and is a region where some t(8;21) de novo and t-AML leukemia breakpoints occur. Stannula et
al68 observed a weak topo II cleavage site in this same
region in two T-cell lines and in one pre-B-cell line. Even at the
highest levels of DNase I concentration, we did not observe DNase I HS
in BV173 and UoC-M1 cells. Similar to our DNase I results, Stannula et al68 did not observe in vivo topo II cleavage in the
AML1 gene in any of the five myeloid cell lines studied. In
contrast, the BCR gene on chromosome 22 showed several DNase I
HS sites. For example, in BV173 cells, we observed possibly three DNase
I HS mapping in the ALL BCR in intron 1.61,69 In
contrast, these same sites were not present in the myeloid UoC-M1 cell
line or in the lymphoid cell lines 9020 and IB-4. At the CML MBCR
located in the second half of the BCR gene,62 we
observed a single strong DNase I HS site mapping within the MBCR in
BV173, UoC-M1, ML-2, and MM6 cells, but it was not present in the
B-cell lines 9020 and IB-4. As a negative control, the
-globin gene region was devoid of DNase I HS sites and in
vivo topo II cleavage sites; thus, in these cell lines, this region is
in a closed chromatin conformation as expected and does not demonstrate
sensitivity to topo II-targeting drugs.
We have previously proposed that the chromatin structure of the
MLL BCR may be involved in the mechanism of recombination for
both de novo acute leukemias and t-AML.30 In our initial studies, we found differences in the location of MLL
breakpoints in de novo and t-AML patients, that we could correlate with
DNA structural features. Thus, 75% of the de novo leukemia breakpoints mapped in the centromeric half of the BCR (a non-SAR DNA loop), compared with 75% of t-AML breakpoints that mapped to the telomeric half of the BCR localizing within the strong SAR.30 Our
findings have recently been confirmed by Cimino et al,34
who found that 67% of MLL breakpoints in children and adults
with de novo leukemia and a t(4;11) mapped in the centromeric half of
the BCR, whereas all five of their t-AML patient breakpoints mapped to
the telomeric half. Of particular interest is the fact that these
investigators showed that 71% (20/28) of breakpoints in infant t(4;11)
ALL mapped to the telomeric half of the MLL BCR. It has been
suggested that infant ALL may, in part, be caused by the exposure of
expectant mothers to pesticides or an excess of natural topo II
inhibitors such as flavonoids.70,71 Cimino et
al34 speculate that the leukemias in both infants and in
t-AML patients may share a common mechanism for breakage in the BCR
that may be different from the mechanism involving breaks in the de
novo leukemias in older patients.
One proposed mechanism for MLL BCR breakage and recombination
is that the topo II cleavage site and the telomeric SAR are initiation
sites during early events in apoptosis.41 Stanulla et
al41 observed that the same DNA cleavage site mapping near to exon 9 was detected in cells exposed to etoposide treatment as well
as in those exposed to other agents (antimetabolites, genotoxic drugs,
and cell starvation) that do not affect topo II. This suggests that
this is a unique structural region of DNA. Using rapidly growing cells,
we observed that this same region is cleaved with DNase I. Thus,
another possibility for recombination may be an initial open region
(the DNase I HS site/topo II cleavage site) where cleavage occurs more
frequently and then promotes illegitimate recombination that is subject
to selective pressures. Alternatively, other investigators have
proposed that breakage and repair may be involved in MLL
recombination events; after initial breakage, exonuclease degradation
and DNA repair is attempted, and this could result in the observed
location of the breakpoints mapping at some distances from the site of
initial breakage.72
Almost all DNase I HS sites are associated with the binding of a
protein to a specific region of DNA.42,73,74 Upon
protein/DNA binding, the surrounding chromatin becomes structurally
altered, making the DNA more accessible, and this change can be
detected using enzymes such as DNase I and S1 nuclease. We previously
hypothesized that the MLL telomeric SAR is a protein-enriched
region that may reflect SAR function.30 During mitosis,
SARs have been shown to be condensation points along the chromosomal
axis and appear to be responsible for the remodeling and maintenance of
chromatin as well as sites for association with topo II and other
nonhistone proteins.75 Thus, the DNase I HS in the
telomeric MLL SAR may be a region to which a protein or a
protein complex (either topo II or other proteins) binds, perhaps
specifically. In the presence of topo II-targeting drugs, such as
etoposide in the treatment of cancer patients, or possibly exposure to
flavonoids or pesticides in utero as in the infant cases, topo II would
lead to cleavage at the DNase I HS. Topo II cleavage occurring at the
DNase I HS followed by repair or illegitimate recombination
(translocation) could be one explanation for t-AML breakpoints mapping
within the telomeric half of the MLL BCR. Elucidation of how
DNA breaks occur in the MLL BCR in t-AML patients and in infant
leukemia patients will provide critical insights into the mechanism(s) related to translocations, which is likely to be applicable to at least
some translocations that occur de novo. Resolution of this question
could lead to safer chemotherapeutic drugs as well as, potentially, to
a reduced incidence of infant leukemia.
| |
ACKNOWLEDGMENT |
The authors thank Dr Ulrich Laemmli and Dr Craig Hart at the University
of Geneva for their advice and help in initiating the DNase I studies
in their laboratory. The authors also thank Alanna Harden for expert
technical assistance.
| |
FOOTNOTES |
Submitted February 6, 1998;
accepted July 3, 1998.
Supported in part by the International Cancer Research Technology
Transfer (ICRETT) Grant No. 246 (Geneva, Switzerland), as a travel
grant to (P.L.S.), by the National Cancer Institute (CA 400046; J.D.R.
and N.J.Z.-L.) and (CA 42557; J.D.R.), the Spastic Paralysis Foundation
of the Illinois Eastern-Iowa District of Kiwanis International (J.D.R.)
and by the ILL division ACS (95-42; N.J.Z.-L.). P.L.S. was a fellow
supported by an Environmental Carcinogenesis Training Grant
(5T32CA09273-19).
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Pamela L. Strissel, PhD, 5841 S Maryland
Ave, MC2115, Chicago, IL 60637.
| |
REFERENCES |
1.
Ziemin-Van Der Poel S, McCabe NR, Gill HJ, Espinosa R III, Patel Y, Harden A, Rubinelli P, Smith SD, LeBeau MM, Rowley JD, Diaz MO:
Identification of a gene, MLL, that spans the breakpoint in 11q23 translocations associated with human leukemias.
Proc Natl Acad Sci USA
88:10735, 1991[Abstract/Free Full Text]
2.
Gu Y, Cimino G, Alder H, Nakamura T, Prasad R, Canaani O, Moir DT, Jones C, Nowell PC, Croce CM, Canaani E:
The (4;11)(q21;q23) chromosome translocations in acute leukemias involve the VDJ recombinase.
Proc Natl Acad Sci USA
89:10464, 1992[Abstract/Free Full Text]
3.
Djabali M, Selleri L, Parry P, Bower M, Young BD, Evans GA:
A trithorax-like gene is interrupted by chromosome 11q23 translocations in acute leukaemias.
Nat Genet
2:113, 1992[Medline]
[Order article via Infotrieve]
4.
Tkachuk DC, Kohler S, Cleary ML:
Involvement of ahomolog of Drosophila trithorax by 11q23 chromosomal translocation in acute leukemias.
Cell
71:691, 1992[Medline]
[Order article via Infotrieve]
5.
Rowley JD:
Rearrangements involving chromosome band 11q23 in acute leukemia, in
Rabbitts TH
(ed):
Seminars in Cancer Biology. London, UK, Academic, 1993, p 377.
6.
Bernard O, Berger R:
Molecular basis of 11q23 rearrangements in hematopoietic malignant proliferations.
Genes Chromosomes Cancer
13:75, 1995[Medline]
[Order article via Infotrieve]
7.
Hillion J, Le Coniat M, Jonveaux P, Berger R, Bernard OA:
AF6q21, a novel partner of the MLL gene in t(6;11)(q21;q23), defines a forkhead transcriptional factor subfamily.
Blood
90:3714, 1997[Abstract/Free Full Text]
8.
So CW, Caldas C, Liu MM, Chen SJ, Huang QH, Gu LJ, Sham MH, Wiedemann LM, Chan LC:
EEN encodes for a member of a new family of proteins containing an Src homology 3 domain and is the third gene located on chromosome 19p13 that fuses to MLL in human leukamia.
Proc Natl Acad Sci USA
94:2563, 1997[Abstract/Free Full Text]
9.
Sobulo OM, Borrow J, Tomek R, Reshmi S, Harrden A, Schlegelberger B, Housman D, Doggett NA, Rowley JD, Zeleznik-Le NJ:
MLL is fused to a histone acetyltransferase, in therapy-related acute myeloid leukemia with a t(11;16)(q23;p13.3).
Proc Natl Acad Sci USA
94:8732, 1997[Abstract/Free Full Text]
10.
Ida K, Kitabayashi I, Taki T, Taniwaki M, Noro K, Yamamoto M, Ohki M, Hayashi Y:
Adenoviral E1A-associated protein p300 is involved in acute myeloid leukemia with t(11;22)(q23;q13).
Blood
90:4699, 1997[Abstract/Free Full Text]
11.
Mitelman F:
Catalog of Chromosome Aberrations in Cancer (ed 5). New York, NY, Wiley-Liss, 1994.
12.
Thirman MJ, Gill HJ, Burnett RC, Mbangkollo D, Mccabe NR, Kobayashi H, Ziemin-Van Der Poel S, Kaneko Y, Morgan R, Sandberg AA, Chaganti RSK, Larson RA, LeBeau MM, Diaz MO, Rowley JD:
Rearrangement of the MLL gene in acute lymphoblastic and acute myeloid leukemias with 11q23 chromosomal translocations.
N Engl J Med
329:909, 1993[Abstract/Free Full Text]
13.
Kaneko Y, Shikano T, Maseki N:
Clinical characteristics of infant acute leukemia with or without 11q23 translocations.
Leukemia
2:672, 1988[Medline]
[Order article via Infotrieve]
14.
Raimondi SC:
Current status of cytogenetic research in childhood acute lymphoblastic leukemia.
Blood
81:2237, 1993[Free Full Text]
15.
Sorensen PHB, Chen CS, Smith FO, Arthur DC, Bernstein DC, Domer PH, Korsmeyer SJ, Hammond GD, Kersey JH:
Molecular rearrangements of chromosome band 11q23 are common in infant AML and are strongly correlated with monocytic or myelomonocytic phenotypes.
J Clin Invest
93:429, 1994
16.
Martinez-Climente JA, Thirman MJ, Espinosa R III, Le Beau MM, Rowley JD:
Detection of 11q23/MLL rearrangements in infant leukemias with fluorescent in situ hybridization and molecular analysis.
Leukemia
9:1299, 1995[Medline]
[Order article via Infotrieve]
17.
Gill Super HJ, McCabe NR, Thirman M, Larson RA, Le Beau MM, Pedersen-Bjergaard J, Preben P, Diaz M, Rowley JD:
Rearrangements of the MLL gene in therapy-related acute myeloid leukemia in patients previously treated with agents targeting DNA-topoisomerase II.
Blood
82:3705, 1993[Abstract/Free Full Text]
18.
Hunger SP, Tkachuk DC, Amylon MD, Link MP, Carroll AJ, Welborn JL, Willman CL, Cleary ML:
HRX involvement in de novo and secondary leukemias with diverse chromosome 11q23 abnormalities.
Blood
81:3197, 1993[Abstract/Free Full Text]
19.
Pedersen-Bjergaard J, Rowley JD:
The balanced and the unbalanced chromosome aberrations of acute myeloid leukemia may develop in different ways and may contribute differently to malignant transformation.
Blood
83:2780, 1994[Abstract/Free Full Text]
20.
Piu C-H, Riberio RC, Hancock ML, Rivera GK, Evans WE, Raimondi SC, Head DR, Behm FG, Mahmoud MH, Sandlund JT, Crist WM:
Acute myeloid leukemia in children treated with epipodophyllotoxins for acute lymphoblastic leukemia.
N Engl J Med
325:1682, 1991[Abstract]
21.
Domer PH, Head DR, Renganathan N, Raimondi SC, Yang E, Atlas M:
Molecular analysis of 13 cases of MLL/11q23 secondary acute leukemia and identification of topoisomerase II consensus-binding sequences near the chromosomal breakpoint of a secondary leukemia with the t(4;11).
Leukemia
9:1305, 1995[Medline]
[Order article via Infotrieve]
22.
Gill Super H, Strissel P, Sobulo OM, Burian D, Reshmi S, Roe B, Zeleznik-Le NJ, Diaz MO, Rowley JD:
Identification of complex genomic breakpoint junctions in the t(9;11) MLL-AF9 fusion gene in acute leukemia.
Genes Chromosom Cancer
20:185, 1997[Medline]
[Order article via Infotrieve]
23.
Rasio D, Schichman SA, Negrini M, Cannaani E, Croce CM:
Complete exon structure of the ALL1 gene.
Cancer Res
56:1766, 1996[Abstract/Free Full Text]
24.
Gu Y, Alder H, Nakamura T, Schichman SA, Prasad R, Canaani O, Saito H, Croce CM, Canaani E:
Sequence analysis of the breakpoint cluster region in the ALL-1 gene involved in acute leukemia.
Cancer Res
54:2327, 1994
25.
Chaplin T, Ayton P, Bernard O, Vaskar S, Della Valle V, Hillion J, Gregorini A, Lillington D, Berger R, Young BD:
A novel class of zinc finger/leucine zipper genes identified from the molecular cloning of the t(10;11) translocation in acute leukaemia.
Blood
85:1435, 1995[Abstract/Free Full Text]
26.
So CW, Ma ZG, Price CM, Dong S, Chen SJ, Hu LJ, So CKC, Weidemann LM, Chan LC:
MLL self fusion mediated by Alu repeat homologous recombination and prognosis of AML-M4/M5 subtypes.
Cancer Res
57:117, 1997[Abstract/Free Full Text]
27.
Felix CA, Kim CS, Megonigal MD, Slater DJ, Jones DH, Spinner NB, Stump T, Hosler MR, Nowell PC, Lange BJ, Rappaport EF:
Panhandle polymerase chain reaction amplifies MLL genomic translocation breakpoint involving unknown partner gene.
Blood
90:4679, 1997[Abstract/Free Full Text]
28.
Megonigal M, Rappaport EF, Jones DH, Williams TM, Lovett BD, Kelly KM, Lerou PH, Moulton T, Budarf ML, Felix CA:
t(11;22)(q23;q11.2) in acute myeloid leukemia of infant twins fuses MLL with hCDCre1, a cell division cycle gene in the genomic region of deletion in DiGeorge and velocafdiofacial syndromes.
Proc Natl Acad Sci USA
95:6413, 1998[Abstract/Free Full Text]
29.
Megonigal M, Rappaport EF, Jones DH, Kim CS, Nowell PE, Lange BJ, Felix CA:
Panhandle PCR strategy to amplify MLL genomic breakpoints in treatment-related leukemias.
Proc Natl Acad Sci USA
94:11583, 1997[Abstract/Free Full Text]
30.
Strissel Broeker PL, Gill Super H, Thirman MJ, Pomykala H, Yonebayshi Y, Tanabe S, Zeleznik-Le N, Rowley JD:
Distribution of 11q23 breakpoints within the MLL breakpoint cluster region in de novo acute leukemia and in treatment related acute myeloid leukemia: Correlation with scaffold attachment regions and topoisomerase II consensus binding sites.
Blood
87:1912, 1996[Abstract/Free Full Text]
31.
Strout M, Marcucci G, Bloomfield CD, Caligiuri MA:
The partial tandem duplication of ALL1 (MLL) is consistently generated by Alu-mediated homologous recombination in acute myeloid leukemia.
Proc Natl Acad Sci USA
95:2390, 1998[Abstract/Free Full Text]
32.
Schichman S, Caligiuri M, Gu Y, Strout M, Carter SL, Gu Y, Canaani E, Bloomfield CD, Croce CM:
ALL-1 tandem duplication in acute myeloid leukemia with a normal karyotype involves homologous recombination between Alu elements.
Cancer Res
54:4277, 1994[Abstract/Free Full Text]
33.
Schichman S, Canaani E, Croce CM:
Self-fusion of the ALL-1 gene: A new genetic mechanism for acute leukemia.
JAMA
273:571, 1995[Abstract/Free Full Text]
34.
Cimino G, Rapanotti MC, Biondi A, Elia L, Lo Coco F, Price C, Rossi V, Rivolta A, Cananni E, Croce CM, Mandelli F, Greaves M:
Infant acute leukemias show the same biased distribution of ALL1 gene breaks as topoisomerase II related secondary acute leukemias.
Cancer Res
57:2879, 1997[Abstract/Free Full Text]
35.
Polijak L, Kas E:
Resolving the role of topoisomerase II in chromatin structure and function.
Trends Cell Biol
5:348, 1995[Medline]
[Order article via Infotrieve]
36.
Warburton PE, Earnshaw WC:
Untangling the role of DNA topoisomerase II in mitotic chromosome structure and function.
Bioessays
19:97, 1997[Medline]
[Order article via Infotrieve]
37.
Adachi Y, Luke M, Laemmli U:
Chromosome assembly in vitro: Topoisomerase II is required for condensation.
Cell
64:137, 1991[Medline]
[Order article via Infotrieve]
38.
Saitoh Y, Laemmli UK:
Metaphase chromosome structure: Bands arise from a differential folding path of the highly AT-rich scaffold.
Cell
76:609, 1994[Medline]
[Order article via Infotrieve]
39.
Sperry A, Blasquez V, Garrard W:
Dysfunction of chromosomal loop attachment sites: Illegitimate recombination linked to matrix association regions and topoisomerase II.
Proc Natl Acad Sci USA
86:5497, 1989[Abstract/Free Full Text]
40.
Aplan PD, Chervinsky DS, Stanulla M, Burhans WC:
Site-specific DNA cleavage within the MLL breakpoint cluster region induced by topoisomerase II inhibitors.
Blood
87:2649, 1996[Abstract/Free Full Text]
41.
Stanulla M, Wang J, Chervinsky DS, Thandla S, Aplan PD:
DNA cleavage within the MLL breakpoint cluster region is a specific event which occurs as part of higher-order chromatin fragmentation during the initial stages of apoptosis.
Mol Cell Biol Hum Dis Ser
17:4070, 1997
42.
Wu C:
Two protein-binding sites in chromatin implicated in the activation of heat-shock genes.
Nature
309:229, 1984[Medline]
[Order article via Infotrieve]
43.
Tuan D, Solomon W, Qiliang L, London IM:
The like globin gene domain in erythroid cells.
Proc Natl Acad Sci USA
82:6384, 1985[Abstract/Free Full Text]
44.
Kaye JS, Bellard M, Dretzen G, Chambon P:
A close association between sites of DNase I hypersensitivity and sites of enhanced cleavage by micrococcal nuclease in the 5 flanking region of the actively transcribed ovalbumin gene.
EMBO J
3:1137, 1984[Medline]
[Order article via Infotrieve]
45.
Langst G, Schatz T, Langowski J, Grummt I:
Structural analysis of mouse rDNA: Coincidence between nuclease hypersensitive sites, DNA curvature and regulatory elements in the intergenic spacer.
Nucleic Acids Res
25:511, 1997[Abstract/Free Full Text]
46.
Phi-Van L, Stratling W:
The matrix attachment regions of the chicken lysozyme gene co-map with the boundaries of the chromatin domain.
EMBO J
3:655, 1988
47.
Kas E, Laemmli UK:
In vivo topoisomerase II cleavage of the Drosophila histone and satellite III repeats: DNA sequence and structural characteristics.
EMBO J
11:705, 1992[Medline]
[Order article via Infotrieve]
48.
Wu T-C, Lichten M:
Meiosis-induced double strand break sites determined by yeast chromatin structure.
Science
263:515, 1994[Abstract/Free Full Text]
49.
Strissel PL, Hart C, Harden A, Rowley JD, Zeleznik-Le N:
A DNase I hypersensitive site and an in-vivo topoisomerase II cleavage site both map to the same region near exon 9 of the MLL breakpoint cluster region in various cell lines.
Blood
88:65a, 1996 (abstr, suppl 1)
50.
Pegoraro L, Matera L, Ritz J, Levis A, Palumbo A, Biagini G:
Establishment of a Ph1-positive human cell line (BV173).
J Clin Invest
70:447, 1983
51.
Allen RJ, Smith SD, Moldwin RL, Min-Min L, Giordano L, Vignon C, Yoshimasa S, Harden A, Tomek R, Veldman T, Reid T, Larson RA, Le Beau MM, Rowley JD, Zeleznik-Le N:
Establishment and characterization of a megakaryoblast cell line with amplification of MLL.
Leukemia
12:1119, 1998[Medline]
[Order article via Infotrieve]
52.
Ohyashiki K, Ohyaskiki JH, Scandberg AA:
Cytogenetic characterization of putative human myeloblastic leukemia cell lines (ML-1, -2, and -3): Origin of the cells.
Cancer Res
46:3642, 1986[Abstract/Free Full Text]
53.
MacLeod RAF, Voges M, Drexler HG:
Mono Mac 6: A mature monoblastic leukemia cell line with t(9;11)(p21;q23).
Blood
82:3221, 1993[Free Full Text] (letter)
54.
Tanabe S, Zeleznik-Le NJ, Kobayashi H, Vignon C, Espinosa R III, Le Beau MM, Thiman MJ, Rowley JD:
Analysis of the t(6;11)(q27;q23) in leukemia shows a consistent breakpoint in AF6 in three patients and in the ML-2 cell line.
Genes Chromosomes Cancer
15:206, 1996[Medline]
[Order article via Infotrieve]
55.
Pommier Y, Orr A, Kohn KW, Riou JF:
Differential effects of amsacrine and epipodophyllotoxins on topoisomerase II cleavage in the human c-myc protooncogene.
Cancer Res
52:3125, 1992[Abstract/Free Full Text]
56.
Mbangkollo D, Burnett RC, Mc Cabe NR, Thirman MJ, Gell Super HJ, Yu H, Rowley JD, Diaz MO:
The human MLL gene: Nucleotide sequence homology to the Drosophilia trx zinc-finger domain and alternative splicing.
DNA Cell Biol
14:475, 1995[Medline]
[Order article via Infotrieve]
57.
Mc Cabe NR, Burnett RC, Gill HG, Thirman MJ, Mbangkollo D, Kipniak M, van Melle E, Ziemin-van der Poel S, Rowley JD, Diaz MO:
Cloning of cDNAs of the MLL gene that detect DNA rearrangments and altered RNA transcripts in human leukemic cells with 11q23 translocations.
Proc Natl Acad Sci USA
89:11794, 1992[Abstract/Free Full Text]
58.
Mirkovitch J, Mirault M, Laemmli U:
Organization of the higher-order chromatin loop: Specific DNA attachment sites on nuclear scaffold.
Cell
39:223, 1984[Medline]
[Order article via Infotrieve]
59.
Maniatis T, Fritsch E, Sambrook J:
Molecular Cloning: A Laboratory Manual. New York, NY, Cold Spring Harbor Laboratory, 1982.
60.
Vaux:
Technical tips.
Trends Genet
8:81, 1992[Medline]
[Order article via Infotrieve]
61.
Rubin C, Carrino J, Dickler M, Leibowitz D, Smith S, Westbrook C:
Heterogeneity of genomic fusion of BCR and ABL in Philadelphia chromosome-positive acute lymphoblastic leukemia.
Proc Natl Acad Sci USA
85:2795, 1988[Abstract/Free Full Text]
62.
Groffen J, Stephenson J, Heisterkamp N, De Klein A, Bartram C, Grosveld G:
Philadelphia chromosomal breakpoints are clustered within a limited region, BCR, on chromosome 22.
Cell
36:93, 1984[Medline]
[Order article via Infotrieve]
63.
Schaefer-Rego K, Leibowitz D, Mears J:
Chromatin alterations surrounding the BCR/ABL fusion gene in K562 cells.
Oncogene
5:1669, 1990[Medline]
[Order article via Infotrieve]
64.
Nucifora G, Rowley JD:
AML1 and the 8;21 and 3;21 translocations in acute and chronic myeloid leukemia.
Blood
86:1, 1995[Free Full Text]
65.
Ueda K:
Multidrug resistance of cancer cells mediated by ABC superfamily transporters.
Nippon Rinsho
55:1024, 1997[Medline]
[Order article via Infotrieve]
66.
Singh SP, Mohamed R, Salmond C, Lavin MF:
Reduced DNA topoisomerase II activity in ataxia-telangiectasia cells.
Nucleic Acids Res
16:3919, 1988[Abstract/Free Full Text]
67.
Hong JH, Kusunoki Y, Komazawa Y, Mizutani A, Mizuno T, Kuramoto A, Kamada N:
Isolation and characterization of VP-16 resistant human leukemia cell line.
Biomed Pharmacother
44:35, 1990[Medline]
[Order article via Infotrieve]
68.
Stanulla M, Wang J, Chervinsky DS, Aplan PD:
Topoisomerase II inhibitors induce DNA souble strand breaks at a fragile site within the AML1 locus.
Leukemia
11:490, 1997[Medline]
[Order article via Infotrieve]
69.
Chen S, Grausz D, Hillion J, D'Auriol L, Flandrin G, Larsen C, Berger R:
Molecular cloning of a 5 segment of the genomic ph1 gene defines a new breakpoint cluster region (bcr2) in Philadelphia-positive acute leukemias.
Leukemia
2:634, 1988[Medline]
[Order article via Infotrieve]
70.
Greaves MF:
Workshop report. Infant leukemia biology, aetiology and treatment.
Leukemia (Baltimore)
10:372, 1996[Medline]
[Order article via Infotrieve]
71.
Ross JA, Davies SM, Potter JD, Robinson LL:
Epidemiology of childhood leukemia with a focus on infants.
Epidemiol Rev
16:243, 1994[Free Full Text]
72.
Kingma PS, Greider CA, Osheroff N:
Spontaneous DNA lesions poison human topoisomerase II and stimulate cleavage proximal to leukemic 11q23 chromosomal breakpoints.
Biochemistry
36:5934, 1997[Medline]
[Order article via Infotrieve]
73.
Pastorcic M, Bagchi MK, Tsai SY, O'Malley BO:
Multiple protein binding sites within the ovalbumin gene 5 flanking region: isolation and characterization of sequence specific binding proteins.
Nucleic Acids Res
17:6693, 1989[Abstract/Free Full Text]
74.
Fleenor D, Kaufman RE:
Characterization of the DNase I hypersensitive site 3 of the human globin gene domain.
Blood
8:2781, 1993
75.
Strick R, Laemmli UK:
SARs are cis DNA elements of chromosome dynamics: Synthesis of a SAR repressor protein.
Cell
83:1137, 1995[Medline]
[Order article via Infotrieve]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
J. Wiemels
Chromosomal Translocations in Childhood Leukemia: Natural History, Mechanisms, and Epidemiology
J Natl Cancer Inst Monographs,
July 1, 2008;
2008(39):
87 - 90.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. Szekvolgyi, Z. Rakosy, B. L. Balint, E. Kokai, L. Imre, G. Vereb, Z. Bacso, K. Goda, S. Varga, M. Balazs, et al.
Ribonucleoprotein-masked nicks at 50-kbp intervals in the eukaryotic genomic DNA
PNAS,
September 18, 2007;
104(38):
14964 - 14969.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. M. Azarova, Y. L. Lyu, C.-P. Lin, Y.-C. Tsai, J. Y.-N. Lau, J. C. Wang, and L. F. Liu
From the Cover: Roles of DNA topoisomerase II isozymes in chemotherapy and secondary malignancies
PNAS,
June 26, 2007;
104(26):
11014 - 11019.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. R. Mistry, C. A. Felix, R. J. Whitmarsh, A. Mason, A. Reiter, B. Cassinat, A. Parry, C. Walz, J. L. Wiemels, M. R. Segal, et al.
DNA Topoisomerase II in Therapy-Related Acute Promyelocytic Leukemia
N. Engl. J. Med.,
April 14, 2005;
352(15):
1529 - 1538.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Pedersen-Bjergaard
Insights into Leukemogenesis from Therapy-Related Leukemia
N. Engl. J. Med.,
April 14, 2005;
352(15):
1591 - 1594.
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Libura, D. J. Slater, C. A. Felix, and C. Richardson
Therapy-related acute myeloid leukemia-like MLL rearrangements are induced by etoposide in primary human CD34+ cells and remain stable after clonal expansion
Blood,
March 1, 2005;
105(5):
2124 - 2131.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Khobta, C. Carlo-Stella, and G. Capranico
Specific Histone Patterns and Acetylase/Deacetylase Activity at the Breakpoint-Cluster Region of the Human MLL Gene
Cancer Res.,
April 15, 2004;
64(8):
2656 - 2662.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. F. Greaves, A. T. Maia, J. L. Wiemels, and A. M. Ford
Leukemia in twins: lessons in natural history
Blood,
October 1, 2003;
102(7):
2321 - 2333.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. J. Betti, M. J. Villalobos, M. O. Diaz, and A. T. M. Vaughan
Apoptotic Stimuli Initiate MLL-AF9 Translocations that Are Transcribed in Cells Capable of Division
Cancer Res.,
March 15, 2003;
63(6):
1377 - 1381.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. B. Tennyson, N. Ebran, A. E. Herrera, and J. E. Lindsley
A Novel Selection System for Chromosome Translocations in Saccharomyces cerevisiae
Genetics,
April 1, 2002;
160(4):
1363 - 1373.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Zhang, P. Strissel, R. Strick, J. Chen, G. Nucifora, M. M. Le Beau, R. A. Larson, and J. D. Rowley
Genomic DNA breakpoints in AML1/RUNX1 and ETO cluster with topoisomerase II DNA cleavage and DNase I hypersensitive sites in t(8;21) leukemia
PNAS,
February 20, 2002;
(2002)
42702899.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Stanulla, P. Chhalliyil, J. Wang, S. N. Jani-Sait, and P. D. Aplan
Mechanisms of MLL gene rearrangement: site-specific DNA cleavage within the breakpoint cluster region is independent of chromosomal context
Hum. Mol. Genet.,
October 1, 2001;
10(22):
2481 - 2491.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. G. Blanco, T. Dervieux, M. J. Edick, P. K. Mehta, J. E. Rubnitz, S. Shurtleff, S. C. Raimondi, F. G. Behm, C.-H. Pui, and M. V. Relling
Molecular emergence of acute myeloid leukemia during treatment for acute lymphoblastic leukemia
PNAS,
August 28, 2001;
98(18):
10338 - 10343.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
N. F. KRYNETSKAIA, X. CAI, J. L. NITISS, E. Y. KRYNETSKI, and M. V. RELLING
Thioguanine substitution alters DNA cleavage mediated by topoisomerase II
FASEB J,
November 1, 2000;
14(14):
2339 - 2344.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
M. Binaschi, M. E. Borgnetto, and G. Capranico
Loss of drug-stimulated topoisomerase II DNA breaks in living cells is different at two unrelated loci
Nucleic Acids Res.,
September 1, 2000;
28(17):
3289 - 3293.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. L. Strissel, R. Strick, R. J. Tomek, B. A. Roe, J. D. Rowley, and N. J. Zeleznik-Le
DNA structural properties of AF9 are similar to MLL and could act as recombination hot spots resulting in MLL/AF9 translocations and leukemogenesis
Hum. Mol. Genet.,
July 1, 2000;
9(11):
1671 - 1679.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. T. Schneider, E. Hilgenfeld, D. Schwabe, W. Behnisch, A. Zoubek, R. Wessalowski, and U. Gobel
Acute Myelogenous Leukemia After Treatment for Malignant Germ Cell Tumors in Children
J. Clin. Oncol.,
October 1, 1999;
17(10):
3226 - 3233.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Zhang, P. Strissel, R. Strick, J. Chen, G. Nucifora, M. M. Le Beau, R. A. Larson, and J. D. Rowley
Genomic DNA breakpoints in AML1/RUNX1 and ETO cluster with topoisomerase II DNA cleavage and DNase I hypersensitive sites in t(8;21) leukemia
PNAS,
March 5, 2002;
99(5):
3070 - 3075.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. Strick, P. L. Strissel, S. Borgers, S. L. Smith, and J. D. Rowley
From the Cover: Dietary bioflavonoids induce cleavage in the MLL gene and may contribute to infant leukemia
PNAS,
April 25, 2000;
97(9):
4790 - 4795.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Top
Abstract
Introduction