|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 92 No. 10 (November 15), 1998:
pp. 3829-3840
Bcr-Abl Efficiently Induces a Myeloproliferative Disease and
Production of Excess Interleukin-3 and Granulocyte-Macrophage
Colony-Stimulating Factor in Mice: A Novel Model for Chronic
Myelogenous Leukemia
By
Xiaowu Zhang and
Ruibao Ren
From the Rosenstiel Basic Medical Sciences Research Center, the
Department of Biochemistry, and the Department of Biology, Brandeis
University, Waltham, MA.
 |
ABSTRACT |
The bcr-abl oncogene plays a critical role in causing
chronic myelogenous leukemia (CML). Effective laboratory animal models of CML are needed to study the molecular mechanisms by which the bcr-abl oncogene acts in the disease progression of CML. We
used a murine stem cell retroviral vector (MSCV) to transduce the
bcr-abl/p210 oncogene into mouse bone marrow cells and found
that expression of Bcr-Abl/p210 induced a myeloproliferative disorder
that resembled the chronic phase of human CML in 100% of bone marrow
transplanted mice in about 3 weeks. This CML-like disease was readily
transplanted to secondary recipient mice. Multiple clones of infected
cells were expanded in the primary recipients, but the leukemia was primarily monoclonal in the secondary recipient mice. Mutation analysis
demonstrated that the protein tyrosine kinase activity of Bcr-Abl/p210
was essential for its leukemogenic potential in vivo. Interestingly, we
found that the leukemic cells expressed excess interleukin-3 (IL-3) and
granulocyte-macrophage colony-stimulating factor (GM-CSF) in the
diseased mice. These studies demonstrate that expression of Bcr-Abl can
induce a CML-like leukemia in mice much more efficiently and
reproducibly than in previously reported mouse CML models, probably due
to efficient expression in the correct target cell(s). Our first use of
this model for analysis of the molecular mechanisms involved in CML
raises the possibility that excess expression of hematopoietic growth
factors such as IL-3 and GM-CSF may contribute to the clinical
phenotype of CML.
© 1998 by The American Society of Hematology.
 |
INTRODUCTION |
CHRONIC MYELOGENOUS leukemia (CML) is a
clonal myeloproliferative disorder resulting from the neoplastic
transformation of a hematopoietic stem cell.1-3 The disease
usually has a biphasic or triphasic course, composed of chronic phase,
accelerated phase, and blastic phase. The initial chronic phase is
characterized by accumulation of large numbers of myeloid-lineage cells
predominated by granulocytes in peripheral blood, bone marrow, and
spleen. Progression of the disease after 3 to 5 years duration to
terminal blast crisis stage is characterized by accelerated
accumulation of immature myeloid or lymphoid cells. Greater than 90%
of CML cases are associated with the presence of the Philadelphia
chromosome (Ph+).4 The Philadelphia chromosome
is a result of a reciprocal translocation between chromosomes 9 and 22 that fuses Bcr-encoded sequences to a truncated c-abl gene. The
oncogene produces a fusion protein, Bcr-Abl, in which the protein
tyrosine kinase activity of Abl is increased. Depending on the precise
breakpoint within the bcr and c-abl genes, various
bcr-abl fusion genes can be generated and are associated with
different types of leukemia.4 Bcr-Abl is apparently
important in both initiation and maintenance of the neoplastic
transformation. However, the progression of the disease to terminal
blast crisis stage is thought to require additional mutations.
Bcr-Abl contains many functional domains, interacts with and/or
phosphorylates a large number of proteins, and can potentially activate
multiple signal transduction pathways.5-7 However, the roles and relative importance of the domains of Bcr-Abl, of its interacting proteins, and of Bcr-Abl-activated signaling pathways in
developing CML remain to be elucidated. Furthermore, although Bcr-Abl
has a pleiotropic effect on deregulating multiple cellular processes,
CML cells remain dependent on growth factors.8-11
Therefore, unbalanced growth factor production may also contribute to
the massive expansion of myeloid cells seen in CML. Indeed, it has been
shown that Bcr-Abl can induce production of granulocyte-macrophage colony-stimulating factor (GM-CSF) and/or interleukin-3 (IL-3) in myeloid cell lines12-14 and that excess expression of
GM-CSF is often detected in CML patients.15-18 In mice,
enforced expression of IL-3, GM-CSF, granulocyte colony-stimulating
factor (G-CSF), or IL-6 can induce myeloproliferative
disorders.19-23 Bcr-Abl has been shown to transform a
variety of cell types in vitro.13,24-30 Although these in
vitro transformation assays show the oncogenic potential of Bcr-Abl,
they do not address the complex pathogenesis of CML. Therefore, an
efficient, reproducible, and experimentally convenient in vivo CML
model is needed to further elucidate the pathogenesis of CML, as well
as the molecular mechanisms by which the bcr-abl oncogene acts
in the pathogenesis of CML.
Previously, Bcr-Abl/p210, the major fusion protein form associated with
CML, has been expressed in murine bone marrow cells by retroviral
transduction. This resulted in a myeloproliferative disorder resembling
CML.31-34 However, the efficiency of disease induction by
this technique was low in terms of frequency, latency, and
transplantability. This hindered the usefulness of retroviral transduction as a mean to study the biology of Bcr-Abl in CML. Other in
vivo models used transgenic strains of mice expressing Bcr-Abl.35-38 Although these transgenic mice provide good
models for Ph+ leukemias, most of them do not model CML.
Recently, transgenic mice expressing Bcr-Abl/p210 driven by the
promoter of the tec gene were developed.38 The
founder mice developed acute lymphoblastic leukemia and the transgenic
progeny developed a myeloproliferative disorder resembling CML.
However, the latency of the disease was very long (~1 year).
We report here a new in vivo model for CML. Bcr-Abl/p210 was expressed
in bone marrow cells of mice by retrovirus transduction using a murine
stem cell retroviral vector (MSCV), which can drive the expression of
transduced genes in embryonic stem cells.39 This system
efficiently, reproducibly, and with an experimentally convenient
latency induced a myeloid leukemia that resembles the chronic phase of
human CML. In analyzing this novel mouse model for CML, we found that
the leukemic cells expressed excess hematopoietic growth factors IL-3
and GM-CSF. These studies demonstrate that expression of Bcr-Abl/p210
by this system produces an effective and experimentally useful in vivo
model of CML in mice and raise the possibility that excess expression
of IL-3 and GM-CSF may contribute to the clinical phenotype of CML.
 |
MATERIALS AND METHODS |
DNA constructs.
Retroviral transducing vector containing the green fluorescent protein
(GFP) gene, MSCV-IRES-gfp, was constructed as follows: a modified
humanized gfp gene40 was released from MSCVpuro-gfp (a generous gift from J. Jacob and B. Chen in Baltimore's laboratory at MIT) with EcoRI and Nco I; this fragment was cloned
into pCITE (Novagen, Madison, WI) between the Nco I and
Sal I sites with an EcoRI/Sal I adapter (the
adapter was designed to include a Not I site and to destroy the
EcoRI site after ligation); the IRES-gfp fragment was then
released from the pCITE-gfp with EcoRI and Sal I and
cloned into the MSCV vector. MSCV-bcr-abl/p210-IRES-gfp (Fig 1) was constructed by insertion of the
EcoRI fragment containing coding sequences of the wild-type
bcr-abl/p21031 into MSCV-IRES-gfp. MSCV-bcr-ablK1176R-IRES-gfp was constructed by insertion of the EcoRI fragment containing the coding sequences of the
kinase-deficient K1176R mutant bcr-abl/p210 into MSCV-IRES-gfp.

View larger version (8K):
[in this window]
[in a new window]
| Fig 1.
The retrovirus construct used to transduce the
bcr-abl/p210 and gfp genes. The construct
MSCV-bcr-abl/p210-IRES-gfp was made as described in Material and
Methods. LTR, long terminal repeat. Enzyme abbreviations: RI,
EcoRI; N, Nco I; S, Sal I.
|
|
Cell culture and retrovirus preparation.
NIH3T3 mouse fibroblasts were grown in Dulbecco's modified Eagle's
medium (DMEM) containing 10% calf serum, 100 U/mL penicillin (GIBCO
BRL, Grand Island, NY), and 100 µg/mL streptomycin
(GIBCO BRL). Bosc23 cells41 were grown in DMEM containing
10% fetal calf serum (FCS), 100 U/mL penicillin, and 100 µg/mL
streptomycin. Helper-free retroviruses were generated by transiently
transfecting retroviral vectors into BOSC-23 cells as
described.41
Bone marrow infection and transplantation.
Bone marrow cell infection and transplantation were performed as
previously described,42 with modifications. Bone marrow cells from 5-fluorouracil (5-FU)-treated male BALB/c (Taconic farm)
donor mice (6 to 9 weeks old) were infected at a concentration of 1 × 106 cells/mL for 24 hours in a cocktail consisting
of DMEM, 15% FCS, 5% WEHI-conditioned medium, 30% viral supernatant,
3 µg/mL polybrene, 2 mmol/L L-glutamine (GIBCO BRL), 100 µg/mL streptomycin, 100 U/mL penicillin, 0.25 µg/mL amphotericin B
(GIBCO BRL), 7 ng/mL IL-3 (Genzyme, Cambridge, MA), 12 ng/mL IL-6 (R&D
System, Minneapolis, MN), and 56 ng/mL stem cell factor
(SCF; R&D System). The infection was repeated once with freshly made
retrovirus-containing cocktail as described above. The infected bone
marrow cells were then washed once with phosphate-buffered saline (PBS;
GIBCO BRL) and were injected into lethally irradiated (2 doses of 450 rads each dose administered 4 hours apart) syngeneic mice (female
BALB/c; 6 to 8 weeks old) through the tail vein at 4 × 105 cells per mouse.
Pathological examination.
Tissues were fixed with 4% paraformaldehyde in PBS and processed for
paraffin-embedded sectioning at 3 to 5 µm in thickness, followed by
staining with hematoxylin and eosin (Fisher, Pittsburgh, PA). Tail-vein peripheral blood smears were stained with
LeukoStat from Fisher according to the manufacturer's instructions.
Flow cytometry.
Peripheral blood obtained from the orbital sinus and isolated bone
marrow cells were treated with red blood cell (RBC) lysis solution ACK
(0.15 mol/L NH4Cl, 1.0 mmol/L KHCO3, 0.1 mmol/L
Na2EDTA, pH 7.3). Spleen, liver, and lung were dissected
out from the diseased mice and rinsed with ice-cold PBS to remove
excess blood. Dissociated cells from these tissues were also treated
with ACK to lyse RBC. For flow cytometry analysis, all cells were
blocked with antimouse CD16/CD32 (Fc III/II receptor; Pharmingen, San
Diego, CA); stained with phycoerythrin
(PE)-conjugated antimouse CD45R/B220, CD90.2 (Thy-1.2),
CD11b (Mac-1 chain), Ly-6G (Gr-1), or TER-119; and then analyzed on
FACScan (Becton Dickinson, Franklin Lakes, NJ) or sorted on FACSorter
(Becton Dickinson).
Southern blot and genomic DNA polymerase chain reaction (PCR).
Peripheral blood obtained from the orbital sinus and dispersed cells
from spleen or liver were treated with ACK. High molecular weight DNA
from these cells was obtained by using the QIAamp Blood Kit (Qiagen,
Santa Clara, CA). For Southern blots, 15 µg of this DNA was digested
with EcoRI, separated on a 1% agarose gel, transferred to
Hybond-N+ membrane (Amersham, Arlington Heights,
IL), and hybridized with a probe of a 1.4-kb
EcoRI-Not I fragment containing IRES-gfp sequences derived from the retroviral vector or a 1.2-kb
SgrAI-Bgl II fragment from the 3 end of the
human c-abl cDNA. The washed membrane was exposed to x-ray
film. For genomic DNA PCR, 0.2 µg of the DNA was used as a template
in a 25 µL reaction, with primers
5 CTTGCAATAGGAACAAAACTC3 and
5 CAGCCCATCAGTTCGCTGCAG3 for the intron-3 of the
mouse c-abl gene and primers
5 TTCCCCCCTTTTTCTGGAGAC3 and
5 GGGGACGTGGTTTTCCTTTG3 for the gfp gene. The PCR reaction
was performed for 30 cycles at 94°C for 1 minute, 57°C for 2 minutes, and 72°C for 3 minutes, followed by 72°C for 5 minutes.
RNA isolation and reverse transcriptase-PCR (RT-PCR).
Total RNA was extracted from bone marrow or other tissues as indicated
in the results section by using the ULTRASPEC RNA isolation system
(Biotex, Houston, TX) according to the manufacturer's instructions. Briefly, about 100 mg of each tissue was homogenized, or 1 × 107 cells were lysed directly in the reagent, then
extracted with chloroform and precipitated with an equal volume of
2-propanol. Total RNA was dissolved in 2 mmol/L MgCl2,
treated with RNase-free DNase (GIBCO BRL) for 10 minutes at room
temperature, and then heated at 70°C for 10 minutes to inactivate
the DNase. Two micrograms of RNA was used as template for RT reaction
in 20 µL with Moloney murine leukemia virus (MMLV)
reverse transcriptase (GIBCO BRL) using random hexamer
oligonucleotides as primer. One to 2 µL of the RT reaction was
used for PCR reaction with Taq DNA polymerase (Boehringer
Mannheim, Indianapolis, IN). Primers
5 TCCAAGCTTCAATCAGTGGC3 and
5 GTTCCACGGTTAGGAGAGAC3 were used for examining IL-3 gene expression, 5 GCAGAATTTACTTTTCCTGGG3 and
5 CATTCAAAGGGGATATCAGTC3 for GM-CSF,
5 CTCATGCTTCTTAGGGCTAG3 and
5 TAAGCCTCCGACTTGTGAAG3 for IL-6,
5 GGGATGGATGTTTTGCCTAG3 and
5 AAGGCTCCAAAAGCAAAGCC3 for SCF,
5 CAAGTGAGGAAGATCCAGGC3 and
5 CGGAAGTGGAGAGAATGATC3 for G-CSF, and
5 CCATCACCATCATCCAGGAG3 and
5 CCTGCTTCACCACCTTCTTG3 for glyceraldehyde-3-phosphate
dehydrogenase (GAPDH). The PCR reaction was performed for 40 cycles at
94°C for 1 minute, 57°C (48°C in case of PCR IL-6 cDNA) for
2 minutes, and 72°C for 3 minutes, followed by 72°C for 5 minutes.
Immunoblotting.
NIH3T3 cells were collected and lysed in lysis buffer (50 mmol/L
N-2-hydroxyethylpiperazine-N -2-ethanesulfonic acid [HEPES], pH
7.4, 150 mmol/L NaCl, 10% glycerol, 1% Triton X-100, 1 mmol/L EGTA,
1.5 mmol/L MgCl2, 10 mmol/L NaF, 1 mmol/L sodium
orthovanadate, 1 mmol/L freshly made phenylmethylsulfonyl fluoride, 10 µg/mL aprotinin, and 10 µg/mL leupeptin). Lysates were adjusted to
contain equal amounts of total protein using the Coomassie Protein
Assay Reagent (Pierce, Rockford, IL) and were boiled for
5 minutes in an equal volume of 2× sodium dodecyl sulfate (SDS)
sample buffer as described.43 Proteins were separated on
8% SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and
electrophoretically transferred to nitrocellulose filter (Schleicher & Schuell, Keene, NH). The filter was probed with anti-Abl
monoclonal antibody Ab-3 (Oncogene Research Products, Cambridge, MA).
Bound antibodies were visualized using horseradish
peroxidase-conjugated antimouse IgG and ECL reagents as described by
the manufacturer (Amersham).
Enzyme-linked immunospecific assay (ELISA) for IL-3 and GM-CSF.
Peripheral blood from the orbital sinus was collected into an eppendorf
tube and incubated at room temperature for 4 hours and then 4°C
overnight. The samples were spun at 16,000 rpm in a microcentrifuge at
4°C. The supernatant was transferred into a new tube and frozen at
70°C until use. The serum levels of IL-3 and GM-CSF were
assayed using mouse IL-3 and GM-CSF ELISA kit from Endogen
(Woburn, MA).
 |
RESULTS |
Bcr-Abl/p210 effectively induces a myeloid leukemia resembling
human CML in mice.
CML is believed to be a neoplasm of hematopoietic stem cells. To target
Bcr-Abl/p210 into hematopoietic stem cells, we used the retroviral
vector, MSCV, to transduce the bcr-abl/p210 gene. MSCV was
chosen because it is derived from the murine stem cell virus and can
drive gene expression in embryonic carcinoma and embryonic stem
cells.39 To facilitate identification of
Bcr-Abl/p210-expressing cells and determination of virus titers, we
cloned into MSCV the bcr-abl/p210 oncogene linked together with
the gene encoding GFP by an internal ribosome entry site (IRES; Fig 1),
which allows both Bcr-Abl and GFP to be translated from the same
transcript. The 5-FU-treated primary bone marrow cells were infected
with the retrovirus by incubating bone marrow cells in
retrovirus-containing media and then transplanted to recipient mice
(see Material and Methods). We found that expression of Bcr-Abl/p210
induced a myeloid leukemia that resembles the chronic phase of human
CML in 100% of the bone marrow transplanted mice in about 3 weeks. The
general features of the leukemia were similar to the Bcr-Abl-induced
CML-like disease in mice described previously.31 Following
are our observations of these mice.
(1) Mice transplanted with bone marrow cells that were infected with
the MSCV-bcr-abl/p210-IRES-gfp retrovirus (Bcr-Abl-BMT) became
progressively moribund and died after about 3 weeks. We have examined a
total of 47 Bcr-Abl-BMT mice in five experiments. A typical survival
curve after bone marrow transplantation is shown in
Fig 2. In contrast, none of the control
mice transplanted with bone marrow cells that was infected with the
MSCV-IRES-gfp retrovirus (vector-BMT) showed signs of the disease in
the 10-month observation period. To examine the effect of different
amounts of MSCV-bcr-abl/p210-IRES-gfp retrovirus-infected bone marrow cells on disease development, we diluted the infected bone marrow cells
with various amounts of uninfected marrow cells. We found that even
mice transplanted with the greatest dilution tested (10-fold dilution)
still developed the disease with identical phenotypes, but had a longer
latency (up to 2 weeks longer; data not shown). This indicates that the
retroviruses used in our typical experiments were in excess for
inducing the disease and that the disease latency can be affected by
the numbers of transplanted cells.

View larger version (14K):
[in this window]
[in a new window]
| Fig 2.
Survival of recipient mice after transplantation of bone
marrow cells that were infected with retroviruses containing various
genes as indicated. The number of mice (n) used in the experiment for
each retrovirus construct is indicated.
|
|
(2) The peripheral white blood cell (WBC) count of the diseased mice
was drastically elevated, ranging from 200,000 to 600,000 cells/µL
(as compared with the vector-BMT of ~20,000 cells/µL). Examination
of the peripheral blood smears showed that the majority of WBCs were
granulocytes but contained some myeloblasts and basophils (Fig 3A). Differential counts of four
diseased mice showed that cells in the peripheral blood were composed
of 89% ± 2.3% granulocytes, 6.6% ± 3.5% lymphocytes, and
4.4% ± 3.6% myeloblasts. To further identify and quantify various
types of WBCs, we analyzed the peripheral WBCs by flow cytometry for
expression of lineage-specific antigens and GFP. As shown in
Fig 4, the majority of the peripheral WBCs from the diseased mice were Mac-1 positive and, to a lesser extent, Gr-1 positive. A small fraction of Ter-119-positive cells (erythroid) were detected in the GFP-negative cell population. Few B220-positive or
Thy-1-positive cells were detected. Interestingly, both GFP-positive and GFP-negative myeloid cells were massively expanded. These GFP-negative cells were shown not to harbor the provirus, as described in a later section.

View larger version (130K):
[in this window]
[in a new window]
| Fig 3.
Pathological analysis of the Bcr-Abl-BMT mice. (a)
Peripheral blood smear from a primary Bcr-Abl-BMT mouse with the
myeloproliferative disorder (original magnification × 600). The
peripheral blood smear was stained with LeukoStat from Fisher. (B
through D) Histological sections (original magnification × 400) of
the spleen (b), liver (c), and lung (d) from a primary Bcr-Abl-BMT
mice with the myeloproliferative disorder. Histological sections were
stained with hematoxylin and eosin. Arrows in (c) point out mitotic
hematopoietic cells.
|
|

View larger version (32K):
[in this window]
[in a new window]
| Fig 4.
Immunophenotyping of leukemic cells from Bcr-Abl-BMT
mice by flow cytometry. Two-parameter dot-plots show expression of
lineage-specific antigens versus GFP as indicated. (Top panel) The
expression of B220, Thy1.2, Ter119, Mac-1, and Gr-1 versus GFP, as
indicated, in the peripheral WBCs from a primary Bcr-Abl-BMT mouse
with the myeloproliferative disorder. (Bottom panel) The expression of
Mac-1 versus GFP in the peripheral WBCs, spleen, liver, lung, and bone
marrow from a secondary Bcr-Abl-BMT mouse with the myeloproliferative
disorder.
|
|
(3) Examination of the abdomens of all the Bcr-Abl-BMT mice (dead or
moribund mice) showed massive splenomegaly, weighing 0.6 to 1.1 g (as
compared with the normal spleen of ~0.1 g), and enlarged liver,
weighing 1.9 to 2.7 g (as compared with the normal liver of ~1 g).
Lymphadenopathy was not observed. Pulmonary hemorrhages were seen in
all the diseased Bcr-Abl-BMT mice when the thorax of these mice were
examined. Thymic enlargement was not evident. Pathological examination
of the Bcr-Abl-BMT mice showed massive infiltration of myeloid cells
in the spleen, liver, and lung (Fig 3). Significant extramedullary
hematopoiesis was observed in these tissues. The extensive
accumulation of granulocytes in the spleen resulted in complete
destruction of the normal splenic architecture (Fig 3B). Immature
erythrocytes and megakaryocytes were also seen in the spleen.
Infiltration of myeloid cells in liver was not as extensive as in the
spleen, but paravasicular infiltration of granulocytes and foci of
extramedullary erythropoiesis were observed throughout hepatic lobules
(Fig 3C) and portal areas of the liver. In lung, excessive bleeding and
infiltration of granulocytes in interstitial spaces was observed (Fig
3D).
(4) To examine whether the myeloproliferative disease is
transplantable, we transferred bone marrow cells (at 8 × 105 cells per recipient mouse) from two primary
Bcr-Abl-BMT mice (BMT 5.2 and 5.3) with the CML-like
myeloproliferative disorder into a set of lethally irradiated secondary
recipient mice. Within 3 weeks, all nine mice transferred with the bone
marrow cells from one of the primary Bcr-Abl-BMT mice, BMT5.3,
developed a myeloproliferative disorder similar to the
disease seen in the parental mouse. Flow cytometric analysis of
dissociated cells of the spleen, liver, lung, and bone marrow from a
secondary Bcr-Abl-BMT mouse demonstrated a massive expansion of
myeloid cells in these tissues (Fig 4, bottom panel). The bone marrow
cells from the other diseased primary Bcr-Abl-BMT mouse, BMT5.2, also
generated transplantable myeloproliferative disease in three of nine
secondary recipient mice within 5 weeks (the other 6 mice died of
anemia with low WBC counts in peripheral blood, possibly due to the
failure of transferring radioprotective hematopoietic stem cells; data not shown).
(5) The affected tissues of the Bcr-Abl-BMT mice contain
bcr-abl/gfp proviral DNA as analyzed by Southern blot using
32P-labeled IRES-gfp sequences or a human c-abl
cDNA fragment as a probe (Fig 5). No
hybridization of both probes to normal murine genomic DNA was detected
(data not shown). The endogenous murine c-abl was not detected,
probably because the nucleotide sequence similarity between the murine
and human c-abl gene was not sufficient for cross-hybridization
under the high stringency conditions used in the experiment.
Interestingly, all the primary Bcr-Abl-BMT mice analyzed showed
multiple proviral integrates with different quantities (Fig 5A, B, and
D), suggesting that multiple infected cells were expanded to various
degrees. However, there were only one or two proviral integrates
detected in the secondary recipient mice (Fig 5A and B). It is notable
that the proviral DNA integration in the leukemic cell clone(s) found
in the secondary recipient mice was not detected in the parental mouse.
To further demonstrate that the expanded cells contained the
bcr-abl/p210 gene and to confirm that the multiple bands
hybridized with the IRES-gfp probe were not generated due to trivial
reasons, such as partial digestion or DNA degradation, we stripped the
IRES-gfp probe from the filters and reprobed them with
32P-labeled abl cDNA. We found that a single 7.2-kb
band (the EcoRI-digested bcr-abl/p210 DNA fragment) was
detected for the affected tissues from all the primary and secondary
Bcr-Abl-BMT mice (Fig 5C).

View larger version (96K):
[in this window]
[in a new window]

View larger version (51K):
[in this window]
[in a new window]

View larger version (40K):
[in this window]
[in a new window]

View larger version (54K):
[in this window]
[in a new window]
| Fig 5.
Analysis of MSCV-bcr-abl/p210-IRES-gfp proviral
integration in Bcr-Abl-BMT mice. The genomic DNA isolated from
peripheral WBCs or tissues of the Bcr-Abl-BMT mice was analyzed by
Southern blot with 32P-labeled IRES-gfp sequences (A, B,
and D) or a 1.2-kb SgrAI-Bgl II fragment from the
3 end of the human c-abl cDNA (C) as a probe. (A)
Peripheral WBCs of 5 primary Bcr-Abl-BMT (lanes 1 through 5) and 7 secondary recipient mice (lanes 6 through 12) transplanted with bone
marrow cells of BMT5.3 (lane 5). (B) Peripheral WBCs of the primary
Bcr-Abl-BMT mouse, BMT 5.2 (lane 1), and its secondary recipients,
BMT6.43 (lanes 4 and 5) and BMT6.50 (lane 6), and the liver (lane 2)
and spleen (lane 3) of BMT6.43. (C) The filter from (B) was stripped
and reprobed with 32P-labeled abl cDNA. (D)
Peripheral blood, spleen, and liver of the primary Bcr-Abl-BMT mice
4.27 and 4.28. P, peripheral WBCs; P1 and P2 specify the peripheral
WBCs taken from BMT6.43 in two different days; L, liver; S, spleen.
|
|
The provirus integration pattern of the genomic DNA extracted from the
spleen, liver, and peripheral WBCs of the primary Bcr-Abl-BMT mice
showed that the expanded myeloid cells in these tissues originated from
the same infected clones (Fig 5D). Similarly, the most leukemic cells
in the peripheral WBCs, spleen, and liver of the secondary recipient
mouse BMT6.43 were also shown to originate from the same clone (Fig
5B). However, a minor band appeared with the liver of BMT6.43 but not
with its spleen and peripheral blood (Fig 5B). This second band was
probably not generated by partial digestion, because there was only one
band present when the abl probe was used (Fig 5C). This
liver-specific band may be derived from expansion of a second leukemic
progenitor cell. Expression of Bcr-Abl/p210 proteins in peripheral WBCs
of the Bcr-Abl-BMT mice was detected by Western blot
(Fig 6A) as well as indirect
immunofluorescence (data not shown) using anti-Abl antibodies.

View larger version (28K):
[in this window]
[in a new window]
| Fig 6.
Expression of Bcr-Abl/p210 protein in the peripheral WBC
from a Bcr-Abl-BMT mouse with the myeloproliferative disorder and
expression of the wild-type and kinase-negative mutant Bcr-Abl/p210
proteins in NIH 3T3 cells. (A) Peripheral WBC from two Bcr-Abl-BMT
mice with the myeloproliferative disorder (BMT4.18 and BMT5.8) were
lysed directly in SDS sample buffer. The total cell lysates were
subjected to Western blot analysis with anti-Abl monoclonal antibody
Ab-3. The position of Bcr-abl/p210 and endogenous c-Abl is indicated.
Total cell lysates from uninfected NIH3T3 and NIH3T3 infected with
retrovirus containing the bcr-abl/p210 gene were used as negative and
positive controls, respectively. (B) NIH 3T3 cells infected with equal
amounts (1 mL) of MSCV-IRES-gfp (lane 1), MSCV-bcr-abl/p210-IRES-gfp
(lane 2), and MSCV-K1176R-IRES-gfp (lane 3) retroviral supernatants of
equal titer were subjected to Western blot analysis with anti-Abl
monoclonal antibody Ab-3.
|
|
The protein tyrosine kinase (PTK) activity of Bcr-Abl is required for
leukemogenesis.
It has been shown that the Abl PTK activity in Bcr-Abl is essential for
transformation of cells in culture,44 suggesting that
phosphorylation of proteins by Bcr-Abl is essential for activating oncogenic pathways. However, certain in vivo functions of PTKs, such as
c-Src and c-Abl, have been shown to be
kinase-independent.45,46 Furthermore, it was shown that
Bcr-Abl was able to bind and activate the Src family protein tyrosine
kinase Hck in a kinase-independent manner and that Hck could
phosphorylate the kinase-negative mutant of Bcr-Abl and induce binding
of Grb2 to Tyr177 of Bcr-Abl.47 To assess the
role of the PTK activity of Bcr-Abl for inducing leukemia in vivo, we
tested if Bcr-Abl/p210 with a point mutation that inactivates the PTK
activity of Bcr-Abl (changing the lysine residue at position 1176 to
arginine, referred to K1176R) can induce CML using the mouse model
described above. The retroviral titer was quantified by measuring the
expression of GFP after infection of NIH 3T3 cells by flow cytometry.
The protein expression level of the K1176R mutant of Bcr-Abl/p210 was
the same as the wild-type Bcr-Abl/p210 in NIH 3T3 cells infected with
the same amounts of the viruses (Fig 6B). The wild-type Bcr-Abl/p210 migrated slower than the K1176R mutant, possibly due to
autophosphorylation of the wild-type Bcr-Abl/p210. When mice were
transplanted with bone marrow cells that were infected with the same
amounts of either wild-type or K1176R mutant
bcr-abl-containing viruses, the wild-type Bcr-Abl/p210 induced
a lethal CML-like disease in approximately 3 weeks, whereas the K1176R
mutant did not induce signs of disease over a 10-month observation
period (Fig 2). Expression of the gfp transcripts was detected
in the peripheral WBCs of the latter mice 10 months after
transplantation by RT-PCR (data not shown), indicating that the
hematopoietic stem cell(s) were successfully infected with the
MSCV-bcr-ablK1176R-IRES-gfp retrovirus. These results demonstrated that
the PTK activity is essential for Bcr-Abl/p210 to induce leukemia in
vivo.
Both infected and noninfected myeloid cells were expanded in mice
with Bcr-Abl/p210-induced myeloproliferative disorder.
As described above, both GFP-positive and GFP-negative myeloid cells in
the Bcr-Abl-BMT mice with the CML-like myeloproliferative disorder
were massively expanded. The percentage of expanded GFP-negative cells
varied between 10% and 80% among the primary Bcr-Abl-BMT mice. In
the secondary Bcr-Abl-BMT mice, there were generally more GFP-positive
cells, ranging from 69% to 90% (data not shown). To distinguish
whether the GFP-negative cells were expanded from noninfected bone
marrow cells or were derived from some bcr-abl/gfp retrovirus-infected bone marrow cells that failed to express detectable GFP proteins, we sorted GFP-positive and GFP-negative cells by flow
cytometry and tested for the presence of GFP-encoding sequences in
these cells by PCR on their genomic DNA. As shown in
Fig 7, while the total population of
peripheral WBCs and the GFP-positive cell population from the primary
Bcr-Abl-BMT mouse with the disease contains the gfp sequences, the
GFP-negative cells from the same mouse did not harbor the gfp sequences
in their genome. The same result was observed in three other primary
Bcr-Abl-BMT mice examined (data not shown). These results indicate
that both infected and noninfected myeloid cells can be expanded in
mice with Bcr-Abl/p210-induced myeloproliferative disorder, but
leukemic cells tend to outgrow bystander cells, as indicated by fewer
GFP-negative cells in the secondary Bcr-Abl-BMT mice with the
monoclonal myeloid leukemia.

View larger version (50K):
[in this window]
[in a new window]
| Fig 7.
Detection of gfp in the genomic DNA of the peripheral
WBCs from a Bcr-Abl-BMT mouse with the myeloproliferative disorder.
Genomic DNA isolated from the unsorted WBCs (lane 1) and sorted
GFP-negative (lane 2) and GFP-positive (lane 3) cells was subjected to
PCR analysis using a mixture of primers that amplify the gfp
gene (850 bp) and intron-3 of the mouse c-abl gene (500 bp).
The amplified c-abl product was used as an internal positive control
for the genomic DNA PCR.
|
|
Bcr-Abl induces production of excess IL-3 and GM-CSF in mice.
The fact that the bcr-abl/p210-induced leukemia displayed a
bystander effect suggested that excess growth factor(s) may be produced
in Bcr-Abl-BMT mice. To test this possibility, we first examined the
gene expression of growth factors known to promote survival,
proliferation, and differentiation of myeloid cells, such as IL-3,
GM-CSF, G-CSF, IL-6, and SCF, in the bone marrow of the Bcr-Abl-BMT
mice and the vector-BMT mice by RT-PCR. Although no IL-3 gene
expression was detected in the bone marrow cells of the vector-BMT
mice, significant amounts of IL-3 transcripts were detected in the bone
marrow cells of the Bcr-Abl-BMT mice (Fig
8). Both primary (Fig 8) and secondary (data not shown) Bcr-Abl-BMT mice had IL-3 transcripts detected in their bone marrow. Several additional vector-BMT mice were examined, and none of them had IL-3
transcripts detected in their bone marrow (data not shown). For GM-CSF,
low levels of GM-CSF transcripts were detected in the vector-BMT mice.
However, GM-CSF gene expression was significantly increased in
Bcr-Abl-BMT mice (Fig 8). In contrast, the same amounts of SCF (Fig 8)
and G-CSF (data not shown) transcripts were detected in both
Bcr-Abl-BMT mice and vector-BMT mice. IL-6 transcripts were not
detected in all the transplanted mice examined, whereas they were
detected in an IL-6-producing cell line, J558L/IL-6 (R. Gerstein,
unpublished data), under the same RT-PCR conditions (data
not shown).

View larger version (34K):
[in this window]
[in a new window]
| Fig 8.
Detection of gene expression of cytokines in bone marrow
of transplanted mice by RT-PCR. Bone marrow cells from Bcr-Abl-BMT
mice (BMT5.1 [lanes 1 and 2], BMT5.4 [lanes 3 and 4], and BMT5.6
[lanes 5 and 6]) and a vector-BMT mouse (BMT5.35 [lanes 7 and 8])
was collected, and RNA was extracted as described in Materials and
Methods. The RT-PCR products generated with (RT+) or without (RT )
reverse transcriptase were subjected to agarose gel electrophoresis,
stained with ethidium bromide, and photographed by Gel Doc 1000 (Bio-Rad, Hercules, CA) with inverse gray scale. The
RT-PCR products of IL-3, GM-CSF, and SCF are indicated. GAPDH was used
as a control for the quality and quantity of the RNA samples and the
RT-PCR reactions.
|
|
It has been shown that, under physiological conditions, IL-3 is not
produced by the bone marrow stroma and that there is no detectable IL-3
in the blood.48 Because significant amounts of IL-3
transcripts and increased amounts of GM-CSF transcripts were detected
in the bone marrow of Bcr-Abl-BMT mice with the CML-like disease, we
went on to examine the production of IL-3 and GM-CSF proteins in these
mice. We examined the serum level of IL-3 and GM-CSF in the
Bcr-Abl-BMT mice with ELISA. As expected, the vector-BMT mice examined
had a below-detection level of IL-3 and a very low level of GM-CSF in
their sera, but the Bcr-Abl-BMT mice contained a significant amount of
IL-3 and GM-CSF in their sera (Tables 1 and
2).
To determine whether IL-3 and GM-CSF are produced by leukemic cells in
response to Bcr-Abl/p210 signaling or by noninfected cells in response
to leukemia and/or tissue destruction, we sorted GFP-positive
and GFP-negative bone marrow cells from Bcr-Abl-BMT mice by flow
cytometry and tested for the presence of IL-3 and GM-CSF transcripts in
these cells by RT-PCR. As shown in Fig 9, while the
GFP-positive cells from Bcr-Abl-BMT mice with the CML-like disease
contained IL-3 and GM-CSF transcripts, the GFP-negative cells from the
same mice had undetectable IL-3 and very low levels of GM-CSF
transcripts. This result demonstrated that the
MSCV-bcr-abl/p210-IRES-gfp retrovirus-infected cells express excess
IL-3 and GM-CSF.

View larger version (71K):
[in this window]
[in a new window]
| Fig 9.
Detection of gene expression of IL-3 and GM-CSF in
GFP-positive and GFP-negative bone marrow cells from Bcr-Abl-BMT mice.
Bone marrow cells from Bcr-Abl-BMT mice (BMT8.40 [lanes 1 through 4]
and BMT8.41 [lanes 5 through 8]) were isolated and treated with ACK
to lyse RBC. GFP-positive and GFP-negative bone marrow cells were
sorted by flow cytometry and their RNA was extracted as described in
Materials and Methods. The RT-PCR was performed and analyzed as in Fig
8. The RT-PCR products of IL-3, GM-CSF, GFP, and GAPDH are indicated.
|
|
 |
DISCUSSION |
In this study we describe an improved murine model for CML. Expression
of Bcr-Abl/p210 can induce a transplantable myeloproliferative disorder
resembling CML efficiently, reproducibly, and with an experimentally
convenient latency. This efficient murine model for CML will be useful
for delineating the molecular mechanisms by which the bcr-abl
oncogene acts in the pathogenesis of CML. In particular, the model
system will help to assess the roles and relative importance of the
domains of Bcr-Abl, of its interacting proteins, of
Bcr-Abl-activated signaling pathways, and of host factors such as
cytokines in developing CML. This model will also be useful for
identifying the target cell(s) of Bcr-Abl that give rise to the
clinical phenotypes of CML by analyzing the oncogenic potential of
Bcr-Abl in various hematopoietic cell types and the subsequent
pathology that arises from each cell type. Our first use of this model
for analysis of the molecular mechanisms involved in CML demonstrated
that the protein tyrosine kinase activity of Bcr-Abl/p210 was essential
for its leukemogenic potential in vivo and that Bcr-Abl/p210 induced
production of excess IL-3 and GM-CSF in the diseased mice.
Our new model for CML, based on previously described retroviral
transduction methods, is much more effective and efficient than earlier
methods. This is probably due to the use of a different retroviral
vector. Because CML is believed to be a neoplasm of hematopoietic stem
cells, it is likely that CML-specific disease can only be induced when
Bcr-Abl expression is targeted into hematopoietic stem cells or
pluripotent progenitor cells. The MSCV vector we now use for this
procedure can drive expression of transduced genes in embryonic stem
cells.39 It is clear that the retroviruses were targeted
into the hematopoietic stem cells, because we can detect by RT-PCR the
expression of gfp in the peripheral WBCs of mice transplanted
with bone marrow cells infected with either MSCV-IRES-gfp or
MSCV-bcr-ablK1176R-IRES-gfp 10 months after transplantation (data not
shown). It is possible that the ability of MSCV to target gene
expression in stem cells makes the induction of CML-like disease more
effective. Systematic comparison of the disease phenotypes that result
from targeting Bcr-Abl into different hematopoietic cell types will
help to address this question.
Human CML is a clonal myeloproliferative disorder. However, it is not
known how that clonal disease develops. It is striking that, in our
model system, there is an apparent change of clonality from the
polyclonal disease in the primary recipient mice to primarily monoclonal disease in the secondary recipients. Interestingly, the
leukemic cell clone(s) found in the secondary recipients was not even
expanded sufficiently in the parental Bcr-Abl-BMT mice to be detected
by Southern blot analysis. These results suggest that Bcr-Abl/p210 can
promote proliferation and/or survival of many cell types, but
only certain Bcr-Abl/p210-expressing cells are capable of continuous
expansion and there is a delay of the expansion of such cells. One
possible explanation is that malignant transformation requires
secondary mutations. Therefore, only one or two clones became leukemic
and thus capable of continued expansion in the secondary recipients.
For human CML, it is generally believed that Bcr-Abl is necessary but
not sufficient to cause CML. A mathematical model based on
epidemiological data predicts that three mutations in a stem cell are
necessary for the disease and progression to blast crisis is caused by
only one more stem cell mutation or mutations restricted to committed
cells.49 However, by this notion it is hard to explain why
the expanded clone in the secondary recipients was not derived from one
of the already massively expanded clones seen in the primary recipient
(more cells should have more chances to acquire secondary mutations). A
second possibility is that multiple expanded clones were malignantly
transformed and capable of continued expansion, but only one or two
clones outgrew all other clones in the secondary recipients due to an unknown selective process. A third possibility is that Bcr-Abl/p210 does not immortalize cells when it causes disease, but rather it
promotes proliferation, differentiation, and/or survival of many types of hematopoietic cells, including rare hematopoietic stem
cells and committed precursor cells, without changing the self-renewal
potential of the original cell type. The myeloid precursor cells may
expand even earlier and faster than stem cells, but lack the ability to
repopulate secondary recipients. As a result, only the
Bcr-Abl/p210-expressing hematopoietic stem cell(s) or primitive
progenitor cell(s) can continue to expand in secondary recipients. Such
a change of clonality may occur within one animal if it can live long
enough. Under this scenario, the reason that the disease became
monoclonal is at least partly due to limited targeting of Bcr-Abl/p210
into the hematopoietic stem cells. The phenomenon we observed here that
expansion of the leukemic progenitor cell clone(s) is delayed in the
primary recipient mice as compared with the largely expanded clones
that are not transplantable to the second recipients is consistent with
the clinical phenotype of CML, in which the amplification of CML stem
cells is constrained but the differentiation of the CML stem cells and
the expansion of maturational compartments is
enhanced.50-52 The development of clonal myeloproliferative
disorder may be a complex process. The possibilities discussed above
are not mutually exclusive. For example, assuming more than one stem
cell is initially infected, an additional process must occur for all
the secondary recipient mice to develop the same monoclonal disease. In
any case, the leukemic clone(s) that repopulates in the secondary
recipient animals in our system must bear additional unique properties. Identifying the target cell(s) that can be malignantly transformed by
Bcr-Abl/p210 and give rise to a transplantable CML-like disease should
provide important understanding about the pathogenesis of CML.
The cardinal features of the myeloproliferative disorder in our model
resemble the chronic phase of human CML. However, differences still
exist between our model and human CML. The development of the
myeloproliferative disorder in the mouse model is very fast and the
leukemic mice die without progression to blast phase. These phenotypes
could be due to the overexpression of Bcr-Abl/p210 from a retroviral
promoter, rather than expression of Bcr-Abl from the endogenous c-Bcr
promoter as in human CML. It has been shown in cultured cells that
Bcr-Abl induced different biological effects in a dose-dependent
manner.53 The lack of blast transformation in the mouse
model may be due to insufficient time for acquiring secondary genetic
abnormalities. Another difference is that pulmonary hemorrhages, which
may be a main cause of death of the leukemic mice, were consistently
observed in the CML mouse model. The cause of the pulmonary hemorrhage
in the leukemic mice is not known. In humans, pulmonary hemorrhage
occurs, although rarely, in patients with acute leukemias, with acute
promyelocytic leukemia treated with all-trans retinoic acid, and with
allogeneic bone marrow transplantation.54-58 It was
suggested that pulmonary hemorrhage in humans may be caused by blast or
basophilic degranulation.56 In addition, development of
pulmonary leukostasis, which can lead to extensive pulmonary
hemorrhages in experimental myelocytic leukemia in the Brown-Norway
rat, has been reported.59 Similarly, the pulmonary
hemorrhage observed in the CML mouse model may be caused by rapid
development of leukostasis or blast or basophilic degranulation.
An expansion of macrophages in the liver was frequently observed in
association with the myeloproliferative disease in the previous CML
model.31 However, such macrophage tumors were not observed
in our system. Pear et al59a found that the macrophage
expansion was more frequently associated with the cocultivation method
used to infect bone marrow cells and that the macrophage expansion
disappeared in secondary recipients, suggesting that the macrophage
expansion is not a characteristic of murine CML. We infect bone marrow
cells with retroviruses simply by incubating the cells in
retrovirus-containing media, which may have eliminated the problem of
the concomitant macrophage tumors not seen in human CML.
The excess expression of IL-3 and GM-CSF in Bcr-Abl-BMT mice raises
the possibility that abnormal expression of hematopoietic growth
factors may contribute to the genesis and/or clinical
phenotypes of CML. IL-3 and GM-CSF are multilineage acting
hematopoietic growth factors.48,60-62 IL-3 is a cytokine
produced in response to certain pathological conditions and is not
required for normal hematopoiesis.61 It was shown that IL-3
plays an important role in mast and basophil development and immunity
under parasitic infection.63 GM-CSF is not essential for
basal hematopoiesis either, except for the proper function of alveolar
macrophages. GM-CSF-deficient mice show no major perturbation of
hematopoiesis but develop pulmonary alveolar
proteinosis.64,65 Although IL-3 and GM-CSF are not
essential for basal hematopoiesis, they are potent cytokines that can
support proliferation, survival, and differentiation of a broad
spectrum of hematopoietic lineages. Abnormal expression of IL-3 and
GM-CSF may cause an imbalance of hematopoiesis. It has been shown that
enforced expression of IL-3 or GM-CSF can induce myeloproliferative
disorders in mice.19,22 In juvenile myelomonocytic leukemia
(JMML), the autocrine production of GM-CSF seems to play a pivotal role
in leukemogenesis.66,67 The production of IL-3 and GM-CSF
induced by Bcr-Abl/p210 may also play an important role in development
of CML.
The production of excess GM-CSF in the murine CML model is in agreement
with results obtained in human CML. Excess production of GM-CSF is
often detected in CML patients.15-18 However, CML patients
have not been demonstrated to have increased serum levels of IL-3. It
is notable that the half-life of both IL-3 mRNA in cells and protein in
sera is relatively short.48,68 So, it is possible that
human CML cells produce low levels of IL-3 that is below detection.
Such IL-3 production may have been exaggerated in the murine CML model.
Clearly, the murine CML is a more aggressive disease, in which many
disease phenotypes of CML are exaggerated. This may be caused partially
by overexpression of Bcr-Abl/p210 in cells. In addition, although IL-3
was not detected in sera in human CML, it may still play an important
role in disease development if local production of IL-3 occurs in bone
marrow, the site of most hematopoietic target cells. In any case, the
role of the abnormal production of hematopoietic growth factors in the
genesis of CML can be examined experimentally now with the development of this murine CML model.
IL-3 and GM-CSF are not normally expressed in resting
cells.48,60 Upon activation, T lymphocytes, natural killer
cells, and mast cells are normal resources of IL-3, whereas these cells and macrophages, megakaryocytes, as well as fibroblast and endothelial cells can produce GM-CSF.60 Certain leukemic cells also
produce GM-CSF or IL-3. Juvenile CML cells and acute myeloid leukemia (AML) blasts produce GM-CSF and ALL blasts with t(5:14)
produce IL-3.60 Our results demonstrated that the
MSCV-bcr-abl/p210-IRES-gfp retrovirus-infected cells express excess
IL-3 and GM-CSF. Because the expanded cells infected with the
MSCV-bcr-abl/p210-IRES-gfp retrovirus are predominantly, if not all,
myeloid cells, it is very likely that Bcr-Abl/p210 induces the gene
expression of IL-3 and GM-CSF in myeloid cells. This is in agreement
with the in vitro results that Bcr-Abl can induce production of GM-CSF
and/or IL-3 in myeloid cell lines.12-14 In vivo, it
has previously been shown that Bcr-Abl induced GM-CSF gene expression
in reticulum cell sarcomas of macrophage origin, which induced a
CML-like syndrome due to a bystander effect.32
The IL-3 and GM-CSF genes are located near each other. A DNase
hypersensitive site, which contains a NF-AT binding site, is located
between the IL-3 and GM-CSF genes. Several transcription regulatory
elements are common between IL-3 and GM-CSF promoters. These include
Ets, CBF/AML-1, CK-1, and CK-2 binding sites and Octamer-1.60 It is possible that Bcr-Abl-activated
signaling pathway(s) activates certain transcription factor(s) that
leads to activation of gene expression of both IL-3 and GM-CSF. Further study of these signaling processes and evaluating the functional role
of excess hematopoietic growth factor(s) in development of CML will
help to elucidate the molecular mechanism by which Bcr-Abl induces CML.
Our finding of abnormal production of IL-3 and GM-CSF induced by
Bcr-Abl/p210 raises the possibility that abnormal cytokine production
may contribute to the clinical phenotypes of human CML; thus,
correcting such abnormal cytokine production may have therapeutic
values.
 |
ACKNOWLEDGMENT |
The authors thank Dr W. Pear for technical assistance and for sharing
results before publication, Drs M. Scott and H. Dong for pathological
consultations, Dr R. Gerstein for kindly providing the IL-6-expressing
cell line, Dr J. Jacob and Dr B. Chen in Dr Baltimore's laboratory for
kindly providing the modified GFP construct, Dr J. Chen and G. Paradis
for helping on flow cytometry, P. Skourides for analyzing the
expression of Bcr-Abl/p210 in leukemic cells by indirect
immunofluorescence, and A. Gross for critically reading this
manuscript. The flow cytometric analyses were performed in the flow
cytometry core facility at the Massachusetts Institute of Technology
center for cancer research.
 |
FOOTNOTES |
Submitted April 30, 1998;
accepted July 7, 1998.
Supported by National Cancer Institute Grant No. CA68008 (to
R.R.). R.R. is a recipient of American Cancer Society Junior Faculty Research Award.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Ruibao Ren, MD, PhD,
Rosenstiel Center, Brandeis University, Waltham, MA 02254; e-mail:
ren{at}hydra.rose.brandeis.edu.
 |
REFERENCES |
1.
Goldman JM:
Chronic myeloid leukemia.
Curr Opin Hematol
4:277, 1997[Medline]
[Order article via Infotrieve]
2.
Cortes JE, Talpaz M, Kantarjian H:
Chronic myelogenous leukemia: A review.
Am J Med
100:555, 1996[Medline]
[Order article via Infotrieve]
3.
Enright H, McGlave PB:
Chronic myelogenous leukemia.
Curr Opin Hematol
3:303, 1996[Medline]
[Order article via Infotrieve]
4.
Melo JV:
The diversity of Bcr-Abl fusion proteins and their relationship to leukemia phenotype.
Blood
88:2375, 1996[Free Full Text]
5.
Gotoh A, Broxmeyer HE:
The function of Bcr-Abl and related proto-oncogenes.
Curr Opin Hematol
4:3, 1997[Medline]
[Order article via Infotrieve]
6.
Raitano AB, Whang YE, Sawyers CL:
Signal transduction by wild-type and leukemogenic Abl proteins.
Biochim Biophys Acta
1333:201, 1997
7.
Sattler M, Salgia R:
Activation of hematopoietic growth factor signal transduction pathways by the human oncogene BCR/ABL.
Cytokine Growth Factor Rev
8:63, 1997[Medline]
[Order article via Infotrieve]
8.
Metcalf D, Moore MAS, Sheridan JW, Spitzer G:
Responsiveness of human granulocytic leukemic cells to colony-stimulating factor.
Blood
43:847, 1974[Abstract/Free Full Text]
9.
Moore MA, Williams N, Metcalf D:
In vitro colony formation by normal and leukemic human hematopoietic cells: Characterization of the colony-forming cells.
J Natl Cancer Inst
50:603, 1973
10.
Goldman JM, Th'ng KH, Lowenthal RM:
In vitro colony forming cells and colony stimulating factor in chronic granulocytic leukaemia.
Br J Cancer
30:1, 1974[Medline]
[Order article via Infotrieve]
11.
Lansdorp PM, Oosterhof F, Zeijlemaker WP:
Colony-forming cells in chronic granulocytic leukemia I. Proliferative responses to growth factors.
Leuk Res
9:1337, 1985[Medline]
[Order article via Infotrieve]
12.
Anderson S, Mladenovic J:
The Bcr-Abl oncogene requires both kinase activity and src-homology 2 domain to induce cytokine secretion.
Blood
87:238, 1996[Abstract/Free Full Text]
13.
Hariharan IK, Adams JM, Cory S:
bcr-abl oncogene renders myeloid cell line factor independent: Potential autocrine mechanism in chronic myeloid leukemia.
Oncogene Res
3:387, 1988[Medline]
[Order article via Infotrieve]
14.
Sirard C, Laneuville P, Dick JE:
Expression of bacr-abl abrogates factor-dependent growth of human hematopoietic M07E cells by an autocrine mechanism.
Blood
83:1575, 1994[Abstract/Free Full Text]
15.
Metcalf D:
Hemopoietic colonies: In vitro cloning of normal and leukemic cells.
Rec Results Cancer Res
61:120, 1977
16.
Lajmanovich A, Berthier R, Schweitzer A, Leger J, Hollard D:
Constitutive expression of GM-CSF mRNA by CML blast cells is correlated with endogenous megakaryocytic colony formation.
Leukemia
7:1211, 1993[Medline]
[Order article via Infotrieve]
17.
el-Ahmady O, Mansour M, Kamel H, Baker A:
Granulocyte-macrophage colony stimulating factor and interleukin-6 enhanced white blood cell synthesis of leukotrienes in chronic myelogenous leukemia.
Anticancer Res
17:3179, 1997[Medline]
[Order article via Infotrieve]
18.
Jonuleit T, Peschel C, Schwab R, van der Kuip H, Buchdunger E, Fischer T, Huber C, Aulitzky WE:
Bcr-Abl kinase promotes cell cycle entry of primary myeloid CML cells in the absence of growth factors.
Br J Haematol
100:295, 1998[Medline]
[Order article via Infotrieve]
19.
Wong PMC, Chung S-W, Dunbar CE, Bodine DM, Ruscetti S, Nienhuis AW:
Retrovirus-mediated transfer and expression of the interleukin-3 gene in mouse hematopoietic cells result in a myeloproliferative disorder.
Mol Cell Biol
9:798, 1989[Abstract/Free Full Text]
20.
Hawley RG, Fong AZC, Burns BF, Hawley TS:
Transplantable myeloproliferative disease induced in mice by an interleukin 6 retrovirus.
J Exp Med
176:1149, 1992[Abstract/Free Full Text]
21.
Chang JM, Metcalf D, Gonda TJ, Johnson GR:
Long term exposure ro retrovirally expressed granulocyte-colony-stimulating factor induces a nonneoplastic granulocytis and progenitor cell hyperplasia without tissue damage in mice.
J Clin Invest
84:1488, 1989
22.
Lang RA, Metcalf D, Cuthbertson RA, Lyons I, Stanley E, Kelso A, Kannourakis G, Williamson DJ, Klintworth GK, Gonda TJ, Dunn AR:
Transgenic mice expressing a hemopoietic growth factor gene (GM-CSF) develop accumulations of macrophages, blindness, and a fatal syndrome of tissue damage.
Cell
51:675, 1987[Medline]
[Order article via Infotrieve]
23.
Johnson GR, Gonda TJ, Metcalf D, Hariharan IK, Cory S:
A lethal myeloproliferative syndrome in mice transplanted with bone marrow cells infected with a retrovirus expressing granulocyte-macrophage colony stimulating factor.
EMBO J
8:441, 1989[Medline]
[Order article via Infotrieve]
24.
Daley G, Baltimore D:
Transformation of an interleukin 3-dependent hematopoietic cell line by the chronic myelogenous leukemia-specific P210 bcr/abl protein.
Proc Natl Acad Sci USA
85:9312, 1988[Abstract/Free Full Text]
25.
McLaughlin J, Chianese E, Witte ON:
In vitro transformation of immature hematopoietic cells by the P210 bcr/abl oncogene product of the Philadelphia chromosome.
Proc Natl Acad Sci USA
84:6558, 1987[Abstract/Free Full Text]
26.
McLaughlin J, Chianese E, Witte ON:
Alternative forms of the bcr-abl oncogene have quantitatively different potencies for stimulation of immature lymphoid cells.
Mol Cell Biol
9:1866, 1989[Abstract/Free Full Text]
27.
Young JC, Witte ON:
Selective transformation of primitive lymphoid cells by the bcr/abl oncogene expressed in long-term lymphoid or myeloid cultures.
Mol Cell Biol
8:4079, 1988[Abstract/Free Full Text]
28.
Kelliher MA, Weckstein DJ, Knott AG, Wortis HH, Rosenberg N:
ABL oncogenes directly stimulate two distinct target cells in bone marrow from 5-fluorouracil-treated mice.
Oncogene
8:1249, 1993[Medline]
[Order article via Infotrieve]
29.
Lugo TG, Witte ON:
The bcr-abl oncogene transforms rat-1 cells and cooperates with v-myc.
Mol Cell Biol
9:1263, 1989[Abstract/Free Full Text]
30.
Renshaw MW, Mcwhirter JR, Wang JYJ:
The human leukemia oncogene bcr-abl abrogates the anchorage requirement but not the growth factor requirement for proliferation.
Mol Cell Biol
15:1286, 1995[Abstract]
31.
Daley GQ, Van Etten RA, Baltimore D:
Induction of chronic myelogenous leukemia in mice by the P210 bcr/abl gene of the Philadelphia chromosome.
Science
247:824, 1990[Abstract/Free Full Text]
32.
Elefanty AG, Hariharan IK, Cory S:
bcr-abl, the hallmark of chronic myeloid leukemia in man, induces multiple hematopoietic neoplasms in mice.
EMBO J
9:1069, 1990[Medline]
[Order article via Infotrieve]
33.
Kelliher MA, McLaughlin J, Witte ON, Rosenberg N:
Induction of a chronic myelogenous leukemia-like syndrome in mice with v-abl and BCR/ABL.
Proc Natl Acad Sci USA
87:6649, 1990[Abstract/Free Full Text]
34.
Gishizky ML, Johnson-White J, Witte ON:
Efficient transplantation of Bcr-Abl-induced chronic myelogenous leukemia-like syndrome in mice.
Proc Natl Acad Sci USA
90:3755, 1993[Abstract/Free Full Text]
35.
Hariharan IK, Harris AW, Crawford M, Abud H, Webb E, Cory S, Adams JM:
A bcr-v-abl oncogene induces lymphomas in transgenic mice.
Mol Cell Biol
9:2798, 1989[Abstract/Free Full Text]
36.
Honda H, Fujii T, Takatoku M, Mano H, Witte ON, Yazaki Y, Hirai H:
Expression of p210bcr-abl by metallothionein promoter induced T-cell leukemia in transgenic mice.
Blood
85:2853, 1995[Abstract/Free Full Text]
37.
Voncken JW, Kaartinen V, Pattengale PK, Germeraad WT, Groffen J, Heisterkamp N:
BCR/ABL P210 and P190 cause distinct leukemia in transgenic mice.
Blood
86:4603, 1995[Abstract/Free Full Text]
38.
Honda H, Oda H, Suzuki T, Takahashi T, Witte ON, Ozawa K, Ishikawa T, Yazaki Y, Hirai H:
Development of acute lymphoblastic leukemia and myeloproliferative disorder in transgenic mice expressing p210bcr/abl: A novel transgenic model for human Ph1-positive leukemias.
Blood
91:2067, 1998[Abstract/Free Full Text]
39.
Hawley RG, Lieu FHL, Fong AZC, Hawley TS:
Versatile retroviral vectors for potential use in gene therapy.
Gene Ther
1:136, 1995
40.
Chen BK, Feinberg MB, Baltimore D:
The kappaB sites in the human immunodeficiency virus type 1 long terminal repeat enhance virus replication yet are not absolutely required for viral growth.
J Virol
71:5495, 1997[Abstract]
41.
Pear WS, Nolan GP, Scott ML, Baltimore D:
Production of high-titer helper-free retroviruses by transient transfection.
Proc Natl Acad Sci USA
90:8392, 1993[Abstract/Free Full Text]
42.
Pear WS, Aster JC, L. SM, Hasserjian RP, Soffer B, Sklar J, Baltimore D:
Exclusive development of T cell neoplasms in mice transplanted with bone marrow expressing activated Notch alleles.
J Exp Med
183:2283, 1996[Abstract/Free Full Text]
43.
Ren R, Ye Z, Baltimore D:
Abl protein-tyrosine kinase selects the Crk adapter as a substrate using SH3-binding sites.
Genes Dev
8:783, 1994[Abstract/Free Full Text]
44.
Lugo TG, Pendergast A-M, Muller AJ, Witte ON:
Tyrosine kinase activity and transformation potency of bcr-abl oncogene products.
Science
247:1079, 1990[Abstract/Free Full Text]
45.
Schwartzberg PL, Xing L, Hoffmann O, Lowell CA, Garrett L, Boyce BF, Varmus HE:
Rescue of osteoclast function by transgenic expression of kinase-deficient Src in src / mutant mice.
Genes Dev
11:2835, 1997[Abstract/Free Full Text]
46.
Hoffmann FM:
Drosophila abl and genetic redundancy in signal transduction.
Trends Genet
7:351, 1991[Medline]
[Order article via Infotrieve]
47.
Warmuth M, Bergmann M, Prie A, Häuslmann K, Emmerich B, Hallek M:
The Src family kinase Hck interacts with Bcr-Abl by a kinase-independent mechanism and phosphorylates the Grb2-binding site of Bcr.
J Biol Chem
272:33260, 1997[Abstract/Free Full Text]
48.
Lindemann A, Mertelsmann R:
Interleukin-3 and its receptor.
Cancer Treat Res
80:107, 1995[Medline]
[Order article via Infotrieve]
49.
Vickers M:
Estimation of the number of mutations necessary to cause chronic myeloid leukaemia from epidemiological data.
Br J Haematol
94:1, 1996[Medline]
[Order article via Infotrieve]
50.
Strife A, Lambek C, Wisniewski D, Wachter M, Gulati SC, Clarkson BD:
Discordant maturation as the primary biological defect in chronic myelogenous leukemia.
Cancer Res
48:1035, 1988[Abstract/Free Full Text]
51.
Strife A, Clarkson B:
Biology of chronic myelogenous leukemia: Is discordant maturation the primary defect?
Semin Hematol
25:1, 1988[Medline]
[Order article via Infotrieve]
52.
Eaves CJ, Eaves AC:
Stem cell kinetics.
Clin Haematol
10:233, 1997
53.
Cambier N, Chopra R, Strasser A, Metcalf D, Elefanty AG:
BCR-ABL activates pathways mediating cytokine independence and protection against apoptosis in murine hematopoietic cells in a dose-dependent manner.
Oncogene
16:335, 1998[Medline]
[Order article via Infotrieve]
54.
Hildebrand FLJ, Rosenow ECd, Habermann TM, Tazelaar HD:
Pulmonary complications of leukemia.
Chest
98:1233, 1990[Free Full Text]
55.
Elsner HA, Duhrsen U, Hollwitz B, Kaulfers PM, Hossfeld DK:
Fatal pulmonary hemorrhage in patients with acute leukemia and fulminant pneumonia caused by Stenotrophomonas maltophilia.
Ann Hematol
74:155, 1997[Medline]
[Order article via Infotrieve]
56.
Bernini JC, Timmons CF, Sandler ES:
Acute basophilic leukemia in a child. Anaphylactoid reaction and coagulopathy secondary to vincristine-mediated degranulation.
Cancer
75:110, 1995[Medline]
[Order article via Infotrieve]
57.
Warrell RPJ, Maslak P, Eardley A, Heller G, Miller WHJ, Frankel SR:
Treatment of acute promyelocytic leukemia with all-trans retinoic acid: An update of the New York experience.
Leuk Suppl
2:33, 1994
58.
Srivastava A, Gottlieb D, Bradstock KF:
Diffuse alveolar haemorrhage associated with microangiopathy after allogeneic bone marrow transplantation.
Bone Marrow Transplant
15:863, 1995[Medline]
[Order article via Infotrieve]
59.
van Buchem MA, Hogendoorn PC, Levelt CN, van Hengel P, Colly LP, Kluin PM, Willemze R:
Development of pulmonary leukostasis in experimental myelocytic leukemia in the Brown-Norway rat.
Leukemia
6:142, 1992[Medline]
[Order article via Infotrieve]
59a.
Pear WS, Miller JP, Xu L, Pui JC, Soffer B, Quackenbush RC, Pendergast AM, Bronson R, Aster JC, Scott ML, Baltimore D:
Efficient and rapid induction of a chronic myelogenous leukemia-like myeloproliferative disease in mice receiving P210 bcr/abl-transduced bone marrow.
Blood
92:3780, 1998[Abstract/Free Full Text]
60.
Nimer SD, Uchida H:
Regulation of granulocyte-macrophage colony-stimulating factor and interleukin 3 expression.
Stem Cells
13:324, 1995[Medline]
[Order article via Infotrieve]
61.
Hara T, Miyajima A:
Function and signal transduction mediated by the interleukin 3 receptor system in hematopoiesis.
Stem Cells
14:605, 1996[Medline]
[Order article via Infotrieve]
62.
Miyajima A, Kinoshita T, Wakao H, Hara T, Yoshimura A, Nishinakamura R, Murray R, Mui A:
Signal transduction by the GM-CSF, IL-3 and IL-5 receptors.
Leuk Suppl
3:418, 1997
63.
Lantz CS, Boesiger J, Song CH, Mach N, Kobayashi T, Mulligan RC, Nawa Y, Dranoff G, Galli SJ:
Role for interleukin-3 in mast-cell and basophil development and in immunity to parasites.
Nature
392:90, 1998[Medline]
[Order article via Infotrieve]
64.
Draoff G, Crawford AD, Sadelain M, Ream B, Rashid A, Bronson RT, Dickersin GR, Bachurski CJ, Mark EL, Whitsett JA, et al:
Involvement of granulocyte-macrophage colony-stimulating factor in pulmonary homeostasis.
Science
264:713, 1994[Abstract/Free Full Text]
65.
Stanley E, Lieschke GJ, Grail D, Metcalf D, Hodgson G, Gall JA, Maher DW, Cebon J, Sinickas V, Dunn AR:
Granulocyte/macrophage colony-stimulating factor-deficient mice show no major perturbation of hematopoiesis but develop a characteristic pulmonary pathology.
Proc Natl Acad Sci USA
91:5592, 1994[Abstract/Free Full Text]
66.
Iversen PO, Rodwell RL, Pitcher L, Taylor KM, Lopez AF:
Inhibition of proliferation and induction of apoptosis in juvenile myelomonocytic leukemic cells by the granulocyte-macrophage colony-stimulating factor analogue E21R.
Blood
88:2634, 1996[Abstract/Free Full Text]
67.
Iversen PO, Lewis ID, Turczynowicz S, Hasle H, Niemeyer C, Schmiegelow K, Bastiras S, Biondi A, Hughes TP, Lopez AF:
Inhibition of granulocyte-macrophage colony-stimulating factor prevents dissemination and induces remission of juvenile myelomonocytic leukemia in engrafted immunodeficient mice.
Blood
90:4910, 1997[Abstract/Free Full Text]
68.
Metcalf D, Nicola NA:
The Hemopoietic Colony-Stimulating Factors. From Biology to Clinical Applications. Cambridge, MA, Cambridge, 1995.

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
S. Mumprecht, C. Schurch, J. Schwaller, M. Solenthaler, and A. F. Ochsenbein
Programmed death 1 signaling on chronic myeloid leukemia-specific T cells results in T-cell exhaustion and disease progression
Blood,
August 20, 2009;
114(8):
1528 - 1536.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Jagani, K. Song, J. L. Kutok, M. R. Dewar, A. Melet, T. Santos, A. Grassian, S. Ghaffari, C. Wu, R. Ren, et al.
Proteasome Inhibition Causes Regression of Leukemia and Abrogates BCR-ABL-Induced Evasion of Apoptosis in Part through Regulation of Forkhead Tumor Suppressors
Cancer Res.,
August 15, 2009;
69(16):
6546 - 6555.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Miyazaki, N. Yamasaki, H. Oda, T. Kuwata, Y. Kanno, M. Miyazaki, Y. Komeno, J. Kitaura, Z.-i. Honda, S. Warming, et al.
Enhanced expression of p210BCR/ABL and aberrant expression of Zfp423/ZNF423 induce blast crisis of chronic myelogenous leukemia
Blood,
May 7, 2009;
113(19):
4702 - 4710.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Mumprecht, C. Claus, C. Schurch, V. Pavelic, M. S. Matter, and A. F. Ochsenbein
Defective homing and impaired induction of cytotoxic T cells by BCR/ABL-expressing dendritic cells
Blood,
May 7, 2009;
113(19):
4681 - 4689.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. J. Lavallard, L. A. Pradelli, A. Paul, M. Beneteau, A. Jacquel, P. Auberger, and J.-E. Ricci
Modulation of Caspase-Independent Cell Death Leads to Resensitization of Imatinib Mesylate-Resistant Cells
Cancer Res.,
April 1, 2009;
69(7):
3013 - 3020.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. H. Kim, W. Xu, C. Ma, X. Liu, K. Siminovitch, H. A. Messner, and J. H. Lipton
Genetic variants in the candidate genes of the apoptosis pathway and susceptibility to chronic myeloid leukemia
Blood,
March 12, 2009;
113(11):
2517 - 2525.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Q.-Y. Zhang, J.-H. Mao, P. Liu, Q.-H. Huang, J. Lu, Y.-Y. Xie, L. Weng, Y. Zhang, Q. Chen, S.-J. Chen, et al.
A systems biology understanding of the synergistic effects of arsenic sulfide and Imatinib in BCR/ABL-associated leukemia
PNAS,
March 3, 2009;
106(9):
3378 - 3383.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Quintas-Cardama and J. Cortes
Molecular biology of bcr-abl1-positive chronic myeloid leukemia
Blood,
February 19, 2009;
113(8):
1619 - 1630.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Li, A. Dutra, E. Pak, J. E. Labrie III, R. M. Gerstein, P. P. Pandolfi, L. D. Recht, and A. H. Ross
EGFRvIII expression and PTEN loss synergistically induce chromosomal instability and glial tumors
Neuro-oncol,
January 1, 2009;
11(1):
9 - 21.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. W. Wong, S. A. Krawczyk, C. Kitidis-Mitrokostas, G. Ge, E. Spooner, C. Hug, R. Gimeno, and H. F. Lodish
Identification and characterization of CTRP9, a novel secreted glycoprotein, from adipose tissue that reduces serum glucose in mice and forms heterotrimers with adiponectin
FASEB J,
January 1, 2009;
23(1):
241 - 258.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Minami, S. A. Stuart, T. Ikawa, Y. Jiang, A. Banno, I. C. Hunton, D. J. Young, T. Naoe, C. Murre, C. H. M. Jamieson, et al.
BCR-ABL-transformed GMP as myeloid leukemic stem cells
PNAS,
November 18, 2008;
105(46):
17967 - 17972.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Acquaviva, X. Chen, and R. Ren
IRF-4 functions as a tumor suppressor in early B-cell development
Blood,
November 1, 2008;
112(9):
3798 - 3806.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Agarwal, T. G. P. Bumm, A. S. Corbin, T. O'Hare, M. Loriaux, J. VanDyke, S. G. Willis, J. Deininger, K. I. Nakayama, B. J. Druker, et al.
Absence of SKP2 expression attenuates BCR-ABL-induced myeloproliferative disease
Blood,
September 1, 2008;
112(5):
1960 - 1970.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Lu, L. J.-S. Huang, and H. F. Lodish
Dimerization by a Cytokine Receptor Is Necessary for Constitutive Activation of JAK2V617F
J. Biol. Chem.,
February 29, 2008;
283(9):
5258 - 5266.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Parikh, R. Subrahmanyam, and R. Ren
Oncogenic NRAS, KRAS, and HRAS Exhibit Different Leukemogenic Potentials in Mice
Cancer Res.,
August 1, 2007;
67(15):
7139 - 7146.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Yan, J.-K. Luo, K. J. Ritchie, I. Sakai, K. Takeuchi, R. Ren, and D.-E. Zhang
Ubp43 regulates BCR-ABL leukemogenesis via the type 1 interferon receptor signaling
Blood,
July 1, 2007;
110(1):
305 - 312.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Modi, T. McDonald, S. Chu, J.-K. Yee, S. J. Forman, and R. Bhatia
Role of BCR/ABL gene-expression levels in determining the phenotype and imatinib sensitivity of transformed human hematopoietic cells
Blood,
June 15, 2007;
109(12):
5411 - 5421.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Wang, D. Cai, C. Brendel, C. Barett, P. Erben, P. W. Manley, A. Hochhaus, A. Neubauer, and A. Burchert
Adaptive secretion of granulocyte-macrophage colony-stimulating factor (GM-CSF) mediates imatinib and nilotinib resistance in BCR/ABL+ progenitors via JAK-2/STAT-5 pathway activation
Blood,
March 1, 2007;
109(5):
2147 - 2155.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Shackelford, C. Kenific, A. Blusztajn, S. Waxman, and R. Ren
Targeted Degradation of the AML1/MDS1/EVI1 Oncoprotein by Arsenic Trioxide
Cancer Res.,
December 1, 2006;
66(23):
11360 - 11369.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Parikh, R. Subrahmanyam, and R. Ren
Oncogenic NRAS rapidly and efficiently induces CMML- and AML-like diseases in mice
Blood,
October 1, 2006;
108(7):
2349 - 2357.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. J. Griswold, M. MacPartlin, T. Bumm, V. L. Goss, T. O'Hare, K. A. Lee, A. S. Corbin, E. P. Stoffregen, C. Smith, K. Johnson, et al.
Kinase domain mutants of bcr-abl exhibit altered transformation potency, kinase activity, and substrate utilization, irrespective of sensitivity to imatinib.
Mol. Cell. Biol.,
August 1, 2006;
26(16):
6082 - 6093.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Xu, Y. Yu, S. Zheng, X. Zhao, Q. Dong, Z. He, Y. Liang, Q. Lu, Y. Fang, X. Gan, et al.
Overexpression of Shp2 tyrosine phosphatase is implicated in leukemogenesis in adult human leukemia
Blood,
November 1, 2005;
106(9):
3142 - 3149.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Deininger, E. Buchdunger, and B. J. Druker
The development of imatinib as a therapeutic agent for chronic myeloid leukemia
Blood,
April 1, 2005;
105(7):
2640 - 2653.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. W. Harder, C. Quilici, E. Naik, M. Inglese, N. Kountouri, A. Turner, K. Zlatic, D. M. Tarlinton, and M. L. Hibbs
Perturbed myelo/erythropoiesis in Lyn-deficient mice is similar to that in mice lacking the inhibitory phosphatases SHP-1 and SHIP-1
Blood,
December 15, 2004;
104(13):
3901 - 3910.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Wong, J. McLaughlin, D. Cheng, C. Zhang, K. M. Shokat, and O. N. Witte
Sole BCR-ABL inhibition is insufficient to eliminate all myeloproliferative disorder cell populations
PNAS,
December 14, 2004;
101(50):
17456 - 17461.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Ren
Restraining CML by adhesives
Blood,
October 1, 2004;
104(7):
1917 - 1918.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Guo, G. Z. Ferl, R. Deora, M. Riedinger, S. Yin, J. L. Kerwin, J. A. Loo, and O. N. Witte
A phosphorylation site in Bruton's tyrosine kinase selectively regulates B cell calcium signaling efficiency by altering phospholipase C-{gamma} activation
PNAS,
September 28, 2004;
101(39):
14180 - 14185.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Ramaraj, H. Singh, N. Niu, S. Chu, M. Holtz, J. K. Yee, and R. Bhatia
Effect of Mutational Inactivation of Tyrosine Kinase Activity on BCR/ABL-Induced Abnormalities in Cell Growth and Adhesion in Human Hematopoietic Progenitors
Cancer Res.,
August 1, 2004;
64(15):
5322 - 5331.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. P. Million, N. Harakawa, S. Roumiantsev, L. Varticovski, and R. A. Van Etten
A Direct Binding Site for Grb2 Contributes to Transformation and Leukemogenesis by the Tel-Abl (ETV6-Abl) Tyrosine Kinase
Mol. Cell. Biol.,
June 1, 2004;
24(11):
4685 - 4695.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. C. Matte, J. Cormier, B. E. Anderson, I. Athanasiadis, J. Liu, S. G. Emerson, W. Pear, and W. D. Shlomchik
Graft-versus-leukemia in a retrovirally induced murine CML model: mechanisms of T-cell killing
Blood,
June 1, 2004;
103(11):
4353 - 4361.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. B. Sykes and M. P. Kamps
E2a/Pbx1 Induces the Rapid Proliferation of Stem Cell Factor-Dependent Murine Pro-T Cells That Cause Acute T-Lymphoid or Myeloid Leukemias in Mice
Mol. Cell. Biol.,
February 1, 2004;
24(3):
1256 - 1269.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Guasch, B. Delaval, C. Arnoulet, M.-J. Xie, L. Xerri, D. Sainty, D. Birnbaum, and M.-J. Pebusque
FOP-FGFR1 tyrosine kinase, the product of a t(6;8) translocation, induces a fatal myeloproliferative disease in mice
Blood,
January 1, 2004;
103(1):
309 - 312.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Zhang, M. Socolovsky, A. W. Gross, and H. F. Lodish
Role of Ras signaling in erythroid differentiation of mouse fetal liver cells: functional analysis by a flow cytometry-based novel culture system
Blood,
December 1, 2003;
102(12):
3938 - 3946.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Goldman and J. V. Melo
Chronic Myeloid Leukemia -- Advances in Biology and New Approaches to Treatment
N. Engl. J. Med.,
October 9, 2003;
349(15):
1451 - 1464.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Wong, J. McLaughlin, D. Cheng, K. Shannon, L. Robb, and O. N. Witte
IL-3 receptor signaling is dispensable for BCR-ABL-induced myeloproliferative disease
PNAS,
September 30, 2003;
100(20):
11630 - 11635.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. A. Wertheim, S. A. Perera, D. A. Hammer, R. Ren, D. Boettiger, and W. S. Pear
Localization of BCR-ABL to F-actin regulates cell adhesion but does not attenuate CML development
Blood,
September 15, 2003;
102(6):
2220 - 2228.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. J. P. Huntly, A. Bench, and A. R. Green
Double jeopardy from a single translocation: deletions of the derivative chromosome 9 in chronic myeloid leukemia
Blood,
August 15, 2003;
102(4):
1160 - 1168.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Wong, J. McLaughlin, D. Cheng, and O. N. Witte
Cell context-specific effects of the BCR-ABL oncogene monitored in hematopoietic progenitors
Blood,
May 15, 2003;
101(10):
4088 - 4097.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. E. Hirst, M. S. Buzza, C. H. Bird, H. S. Warren, P. U. Cameron, M. Zhang, P. G. Ashton-Rickardt, and P. I. Bird
The Intracellular Granzyme B Inhibitor, Proteinase Inhibitor 9, Is Up-Regulated During Accessory Cell Maturation and Effector Cell Degranulation, and Its Overexpression Enhances CTL Potency
J. Immunol.,
January 15, 2003;
170(2):
805 - 815.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Mayotte, D.-C. Roy, J. Yao, E. Kroon, and G. Sauvageau
Oncogenic interaction between BCR-ABL and NUP98-HOXA9 demonstrated by the use of an in vitro purging culture system
Blood,
December 1, 2002;
100(12):
4177 - 4184.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Jiang, E. Ng, C. Yip, W. Eisterer, Y. Chalandon, M. Stuible, A. Eaves, and C. J. Eaves
Primitive interleukin 3 null hematopoietic cells transduced with BCR-ABL show accelerated loss after culture of factor-independence in vitro and leukemogenic activity in vivo
Blood,
November 15, 2002;
100(10):
3731 - 3740.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. J. P. Huntly, A. J. Bench, E. Delabesse, A. G. Reid, J. Li, M. A. Scott, L. Campbell, J. Byrne, E. Pinto, A. Brizard, et al.
Derivative chromosome 9 deletions in chronic myeloid leukemia: poor prognosis is not associated with loss of ABL-BCR expression, elevated BCR-ABL levels, or karyotypic instability
Blood,
May 29, 2002;
99(12):
4547 - 4553.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. P. Million, J. Aster, D. G. Gilliland, and R. A. Van Etten
The Tel-Abl (ETV6-Abl) tyrosine kinase, product of complex (9;12) translocations in human leukemia, induces distinct myeloproliferative disease in mice
Blood,
May 29, 2002;
99(12):
4568 - 4577.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. S. Holtz, M. L. Slovak, F. Zhang, C. L. Sawyers, S. J. Forman, and R. Bhatia
Imatinib mesylate (STI571) inhibits growth of primitive malignant progenitors in chronic myelogenous leukemia through reversal of abnormally increased proliferation
Blood,
May 15, 2002;
99(10):
3792 - 3800.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. A. Wertheim, K. Forsythe, B. J. Druker, D. Hammer, D. Boettiger, and W. S. Pear
BCR-ABL-induced adhesion defects are tyrosine kinase-independent
Blood,
May 13, 2002;
99(11):
4122 - 4130.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Chalandon, X. Jiang, G. Hazlewood, S. Loutet, E. Conneally, A. Eaves, and C. Eaves
Modulation of p210BCR-ABL activity in transduced primary human hematopoietic cells controls lineage programming
Blood,
May 1, 2002;
99(9):
3197 - 3204.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. He, J. A. Wertheim, L. Xu, J. P. Miller, F. G. Karnell, J. K. Choi, R. Ren, and W. S. Pear
The coiled-coil domain and Tyr177 of bcr are required to induce a murine chronic myelogenous leukemia-like disease by bcr/abl
Blood,
April 15, 2002;
99(8):
2957 - 2968.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. M. F. Mow, J. Chandra, P. A. Svingen, C. G. Hallgren, E. Weisberg, T. J. Kottke, V. L. Narayanan, M. R. Litzow, J. D. Griffin, E. A. Sausville, et al.
Effects of the Bcr/abl kinase inhibitors STI571 and adaphostin (NSC 680410) on chronic myelogenous leukemia cells in vitro
Blood,
January 15, 2002;
99(2):
664 - 671.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. M. Kelly, Q. Liu, J. L. Kutok, I. R. Williams, C. L. Boulton, and D. G. Gilliland
FLT3 internal tandem duplication mutations associated with human acute myeloid leukemias induce myeloproliferative disease in a murine bone marrow transplant model
Blood,
January 1, 2002;
99(1):
310 - 318.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. M. Sinclair, J. A. Lee, A. Goldstein, D. Xing, S. Liu, R. Ju, P. W. Tucker, E. J. Neufeld, and R. H. Scheuermann
Lymphoid apoptosis and myeloid hyperplasia in CCAAT displacement protein mutant mice
Blood,
December 15, 2001;
98(13):
3658 - 3667.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. J. P. Huntly, A. G. Reid, A. J. Bench, L. J. Campbell, N. Telford, P. Shepherd, J. Szer, H. M. Prince, P. Turner, C. Grace, et al.
Deletions of the derivative chromosome 9 occur at the time of the Philadelphia translocation and provide a powerful and independent prognostic indicator in chronic myeloid leukemia
Blood,
September 15, 2001;
98(6):
1732 - 1738.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Schwaller, E. Anastasiadou, D. Cain, J. Kutok, S. Wojiski, I. R. Williams, R. LaStarza, B. Crescenzi, D. W. Sternberg, P. Andreasson, et al.
H4(D10S170), a gene frequently rearranged in papillary thyroid carcinoma, is fused to the platelet-derived growth factor receptor {beta} gene in atypical chronic myeloid leukemia with t(5;10)(q33;q22)
Blood,
June 15, 2001;
97(12):
3910 - 3918.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Schmidt, A. Hochhaus, A. Nitsche, R. Hehlmann, and A. Neubauer
Expression of nuclear transcription factor interferon consensus sequence binding protein in chronic myeloid leukemia correlates with pretreatment risk features and cytogenetic response to interferon-{alpha}
Blood,
June 1, 2001;
97(11):
3648 - 3650.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. C. Zhao, Y. Jiang, and C. M. Verfaillie
A model of human p210bcr/ABL-mediated chronic myelogenous leukemia by transduction of primary normal human CD34+ cells with a BCR/ABL-containing retroviral vector
Blood,
April 15, 2001;
97(8):
2406 - 2412.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. H. Tomasson, I. R. Williams, S. Li, J. Kutok, D. Cain, S. Gillessen, G. Dranoff, R. A. Van Etten, and D. G. Gilliland
Induction of myeloproliferative disease in mice by tyrosine kinase fusion oncogenes does not require granulocyte-macrophage colony-stimulating factor or interleukin-3
Blood,
March 1, 2001;
97(5):
1435 - 1441.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Li, S. Gillessen, M. H. Tomasson, G. Dranoff, D. G. Gilliland, and R. A. Van Etten
Interleukin 3 and granulocyte-macrophage colony-stimulating factor are not required for induction of chronic myeloid leukemia-like myeloproliferative disease in mice by BCR/ABL
Blood,
March 1, 2001;
97(5):
1442 - 1450.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Zhang, R. Subrahmanyam, R. Wong, A. W. Gross, and R. Ren
The NH2-Terminal Coiled-Coil Domain and Tyrosine 177 Play Important Roles in Induction of a Myeloproliferative Disease in Mice by Bcr-Abl
Mol. Cell. Biol.,
February 1, 2001;
21(3):
840 - 853.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
T. L. Holyoake, X. Jiang, H. G. Jorgensen, S. Graham, M. J. Alcorn, C. Laird, A. C. Eaves, and C. J. Eaves
Primitive quiescent leukemic cells from patients with chronic myeloid leukemia spontaneously initiate factor-independent growth in vitro in association with up-regulation of expression of interleukin-3
Blood,
February 1, 2001;
97(3):
720 - 728.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Zhang, R. Wong, S. X. Hao, W. S. Pear, and R. Ren
The SH2 domain of Bcr-Abl is not required to induce a murine myeloproliferative disease; however, SH2 signaling influences disease latency and phenotype
Blood,
January 1, 2001;
97(1):
277 - 287.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. W. N. Deininger, J. M. Goldman, and J. V. Melo
The molecular biology of chronic myeloid leukemia
Blood,
November 15, 2000;
96(10):
3343 - 3356.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Di Bacco, K. Keeshan, S. L. McKenna, and T. G. Cotter
Molecular Abnormalities in Chronic Myeloid Leukemia: Deregulation of Cell Growth and Apoptosis
Oncologist,
October 1, 2000;
5(5):
405 - 415.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
V. Sexl, R. Piekorz, R. Moriggl, J. Rohrer, M. P. Brown, K. D. Bunting, K. Rothammer, M. F. Roussel, and J. N. Ihle
Stat5a/b contribute to interleukin 7-induced B-cell precursor expansion, but abl- and bcr/abl-induced transformation are independent of Stat5
Blood,
September 15, 2000;
96(6):
2277 - 2283.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. P. Million and R. A. Van Etten
The Grb2 binding site is required for the induction of chronic myeloid leukemia-like disease in mice by the Bcr/Abl tyrosine kinase
Blood,
July 15, 2000;
96(2):
664 - 670.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. X. Hao and R. Ren
Expression of Interferon Consensus Sequence Binding Protein (ICSBP) Is Downregulated in Bcr-Abl-Induced Murine Chronic Myelogenous Leukemia-Like Disease, and Forced Coexpression of ICSBP Inhibits Bcr-Abl-Induced Myeloproliferative Disorder
Mol. Cell. Biol.,
February 15, 2000;
20(4):
1149 - 1161.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
P. G. Lutz, C. Moog-Lutz, E. Coumau-Gatbois, L. Kobari, Y. Di Gioia, and Y. E. Cayre
Myeloblastin is a granulocyte colony-stimulating factor-responsive gene conferring factor-independent growth to hematopoietic cells
PNAS,
February 15, 2000;
97(4):
1601 - 1606.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. B. Sinclair, E. P. Nacheva, M. Leversha, N. Telford, J. Chang, A. Reid, A. Bench, K. Champion, B. Huntly, and A. R. Green
Large deletions at the t(9;22) breakpoint are common and may identify a poor-prognosis subgroup of patients with chronic myeloid leukemia
Blood,
February 1, 2000;
95(3):
738 - 743.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Jiang, A. Lopez, T. Holyoake, A. Eaves, and C. Eaves
Autocrine production and action of IL-3 and granulocyte colony-stimulating factor in chronic myeloid leukemia
PNAS,
October 26, 1999;
96(22):
12804 - 12809.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. W. Gross, X. Zhang, and R. Ren
Bcr-Abl with an SH3 Deletion Retains the Ability To Induce a Myeloproliferative Disease in Mice, yet c-Abl Activated by an SH3 Deletion Induces Only Lymphoid Malignancy
Mol. Cell. Biol.,
October 1, 1999;
19(10):
6918 - 6928.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Q. Sun, K. Jones, B. McClure, B. Cambareri, B. Zacharakis, P.O. Iversen, F. Stomski, J.M. Woodcock, C.J. Bagley, R. D'Andrea, et al.
Simultaneous Antagonism of Interleukin-5, Granulocyte-Macrophage Colony-Stimulating Factor, and Interleukin-3 Stimulation of Human Eosinophils by Targetting the Common Cytokine Binding Site of Their Receptors
Blood,
September 15, 1999;
94(6):
1943 - 1951.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. S. Pear, J. P. Miller, L. Xu, J. C. Pui, B. Soffer, R. C. Quackenbush, A. M. Pendergast, R. Bronson, J. C. Aster, M. L. Scott, et al.
Efficient and Rapid Induction of a Chronic Myelogenous Leukemia-Like Myeloproliferative Disease in Mice Receiving P210 bcr/abl-Transduced Bone Marrow
Blood,
November 15, 1998;
92(10):
3780 - 3792.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Dai, P. Kerzic, W. G. Schroeder, and I. K. McNiece
Deletion of the Src Homology 3 Domain and C-terminal Proline-rich Sequences in Bcr-Abl Prevents Abl Interactor 2 Degradation and Spontaneous Cell Migration and Impairs Leukemogenesis
J. Biol. Chem.,
July 27, 2001;
276(31):
28954 - 28960.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|