|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 92 No. 11 (December 1), 1998:
pp. 4003-4012
RAPID COMMUNICATION
The t(3;21) Fusion Product, AML1/Evi-1, Interacts With Smad3 and Blocks
Transforming Growth Factor- -Mediated Growth Inhibition of Myeloid
Cells
By
Mineo Kurokawa,
Kinuko Mitani,
Yoichi Imai,
Seishi Ogawa,
Yoshio Yazaki, and
Hisamaru Hirai
From the Department of Hematology & Oncology, Graduate School of
Medicine, University of Tokyo, Tokyo, Japan.
 |
ABSTRACT |
The t(3;21)(q26;q22) chromosomal translocation associated with
blastic crisis of chronic myelogenous leukemia results in the formation
of the AML1/Evi-1 chimeric protein, which is thought to play a
causative role in leukemic transformation of hematopoietic cells. Here
we show that AML1/Evi-1 represses growth-inhibitory signaling by
transforming growth factor- (TGF- ) in 32Dcl3 myeloid cells. The
activity of AML1/Evi-1 to repress TGF- signaling depends on the two
separate regions of the Evi-1 portion, one of which is the first zinc
finger domain. AML1/Evi-1 interacts with Smad3, an intracellular
mediator of TGF- signaling, through the first zinc finger domain,
and represses the Smad3 activity, as Evi-1 does. We also show that
suppression of endogenous Evi-1 in leukemic cells carrying inv(3)
restores TGF- responsiveness. Taken together, AML1/Evi-1 acts as an
inhibitor of TGF- signaling by interfering with Smad3 through the
Evi-1 portion, and both AML1/Evi-1 and Evi-1 repress TGF- -mediated
growth suppression in hematopoietic cells. Thus, AML1/Evi-1 may
contribute to leukemogenesis by specifically blocking growth-inhibitory
signaling of TGF- in the t(3;21) leukemia.
© 1998 by The American Society of Hematology.
 |
INTRODUCTION |
RECENT PROGRESS in elucidating the
details of growth control networks has uncovered diverse functions of
oncogenic proteins that act in the nucleus, including a variety of
transcription regulators. Many of them have been recognized through
their involvement in chromosomal translocations. The t(3;21)(q26;q22)
translocation, seen in the blastic crisis of chronic myelogenous
leukemia and myelodysplastic syndrome-derived leukemia,1,2
generates a fusion product of the distinct transcription regulators,
AML1 and Evi-1.3 In this translocation, Evi-1
becomes juxtaposed to the AML1 gene and is transcriptionally
activated as the AML1/Evi-1 chimera under control of the
AML1 promoter. A resultant fusion protein, AML1/Evi-1, is
envisioned to cause leukemic transformation of hematopoietic cells.
The AML1 gene is located on chromosome 21q22 and is recognized
as the most frequent target of chromosomal translocations associated with human leukemias.4 AML1 belongs to a family of
transcription factors which share high homology with a DNA-binding
region designated as the Runt-domain present in the Drosophila
pair-rule gene runt product.5 Through the
Runt-domain, AML1 forms a heterodimeric complex with PEBP2 (also
known as CBF ), which does not bind to DNA by itself but enhances DNA
binding of AML1.6,7 AML1 binds to and activates
transcription from the enhancer core motifs (TGT/cGGT), which are
present in numerous myeloid promoters and lymphoid
enhancers.8-13 A dominant inhibitory form of AML1, which competitively interferes with DNA binding of intact AML1, can abrogate
myeloid cell differentiation induced by granulocyte colony-stimulating factor (G-CSF),14 suggesting that AML1 performs a key role
in hematopoietic differentiation. In the AML1/Evi-1 chimera, AML1 is
disrupted at the end of the Runt-domain and fused with the entire Evi-1
protein.3
Evi-1 was first identified as a gene existing in a common locus
of retroviral integration in myeloid tumors in AKXD mice.15 This gene encodes a 145-kD nuclear-localized
protein.16,17 Although Evi-1 expression is barely
detectable in normal hematopoietic cells, its frequent transcriptional
activation is documented in a subset of myeloid malignancies. The human
Evi-1 gene is located on chromosome 3q26, and rearrangements
involving this region, including t(3;21), t(3;12), t(3;3), and inv(3),
often activate Evi-1 expression in myeloid leukemias and
myelodysplasias.18-21 Elevated expression of Evi-1
also occurs without cytogenetically evident translocations in some
myeloid malignancies.22,23 These facts suggest a critical
role of Evi-1 in malignant transformation of hematopoietic
cells as a dominant oncogene.
Structurally, Evi-1 possesses seven and three repeats of
Cys2His2-type zinc finger motifs separated into
two domains (ZF1-7 and ZF8-10)16 (Fig
1). Some evidence suggests that Evi-1 works as a negative regulator of gene expression,24,25 while
characteristics of Evi-1 as a transcriptional activator have also been
described. We have reported that Evi-1 elevates intracellular AP-1
activity and stimulates the c-fos promoter through the second
zinc finger domain,26 although the identity of authentic
target genes that Evi-1 may directly regulate has not been determined
yet. Thus far, several biological effects of Evi-1 have been described. As we have reported, Evi-1 causes cellular transformation when overexpressed in the Rat1 fibroblast cells.27 Overexpressed Evi-1 blocks granulocytic differentiation of a murine myeloid cell line
induced by G-CSF.28 Forced expression of Evi-1 in normal
hematopoietic progenitors renders a decrease in colony formation in
response to erythropoietin.29 From these findings, Evi-1 is
thought to possess the ability of growth promotion and differentiation
block in some types of cells.

View larger version (17K):
[in this window]
[in a new window]
| Fig 1.
Structures of the AML1/Evi-1 protein and its derivatives
are compared with Evi-1. ZF1-7 is a deletion mutant of AML1/Evi-1
that lacks the first zinc finger domain of Evi-1, while Rep is a
mutant lacks the repression domain of Evi-1. Distinct functional
domains of AML1/Evi-1 are presented. Zinc finger motifs are numbered
1-10.
|
|
Proliferation and differentiation of cells are tightly regulated by a
delicate balance of growth factors and growth inhibitory factors.
Transforming growth factor- (TGF- ) is one of the best characterized members of growth inhibitory factors. TGF- can inhibit
proliferation of a wide range of cell types including epithelial,
endothelial, and hematopoietic cells.29-32 The
intracellular components that transduce TGF- signals into the
nucleus have been unveiled in recent years. Genetic screens in
Drosophila isolated a protein called MAD by its involvement in
the signaling pathway of dpp.33 MAD-related
proteins in vertebrates are designated as Smad and define a novel
family that acts downstream of the receptors to mediate TGF-
signaling.34-36 Among Smad proteins, Smad2 and Smad3 are
directly phosphorylated by the receptor kinases in response to TGF- ,
form heteromeric complexes with Smad4, another member of the Smad
family, and then are translocated into the nucleus.37-42
Once in the nucleus, Smad complexes are thought to act as
transcriptional activators.43-45 Recently we reported that Evi-1 antagonizes growth-inhibitory effects of TGF- in the
epithelial cells that are highly sensitive to TGF- .46
Two separate regions of Evi-1 are responsible for this repression, one
of which is the first zinc finger domain. Through this domain, Evi-1
physically associates with Smad3, thereby suppressing the
transcriptional activity of Smad3. Thus, the interaction between Evi-1
and Smad3 is critical for repression of TGF- signaling.
Multiple mechanisms have been proposed for leukemogenesis in the
t(3;21) leukemia. Our previous study showed that AML1/Evi-1 dominantly
suppresses the transactivation by intact AML1, thereby leading to a
block of myeloid cell differentiation.47 AML1/Evi-1 shows a
higher affinity for PEBP2 /CBF than that of wild-type AML1, which
may account for one of the dominant effects of
AML1/Evi-1.48 We have also found that AML1/Evi-1 can
increase AP-1 activity and transform Rat-1 cells with dependence on the
second zinc finger domain of the Evi-1 portion.27,47 In
this study, we show that AML1/Evi-1 blocks TGF- -induced
transactivation of the responsive promoters, as Evi-1 does. AML1/Evi-1
abrogates responses to growth-suppressive signaling of TGF- in
hematopoietic cells. Two regions of the Evi-1 portion are required for
the AML1/Evi-1 repressor activity, one of which is the first zinc
finger domain. Through this domain, AML1/Evi-1 physically interacts
with Smad3, and this ability is necessary for its function in efficient
inhibition of TGF- signaling. Thus, AML1/Evi-1 may contribute to
leukemogenesis by interfering with TGF- -mediated growth inhibition.
 |
MATERIALS AND METHODS |
Plasmid constructions.
The cDNA of AML1/Evi-1 was identified and obtained from the
SKH-1 cell line.3 The Evi-1 cDNA was obtained from
the AML1/Evi-1 fusion cDNA.47 AML1/Evi-1
and Evi-1 were subcloned into the expression vectors,
pME18S49 (pME-AML1/Evi-1 and pME-Evi-1) and
pMV750 (pMV-AML1/Evi-1 and pMV-Evi-1), as described
elsewhere.26,47 For construction of AML1/Evi-1 deletion
mutant ZF1-7 (AML1/Evi-1 ZF1-7), the fragment from the
EcoRV to Nsp V sites of AML1/Evi-1 was replaced with
that of Evi-1 ZF1-7.46 AML1/Evi-1 Rep was generated by replacing the fragment from the EcoRV to Nsp V sites of
AML1/Evi-1 with that of Evi-1 (608-732).46 These mutants
were inserted into the EcoRI site of pME18S. Construction of
pMV-AML1/Evi-1 ZF8-10 were described previously.47 For
construction of expression vectors for Smad3-Flag and Smad4-Flag, the
BamHI-HindIII fragment of Smad3-Flag and the
EcoRI-HindIII fragment of Smad4-Flag were excised from
those placed in pRK541 (kind gifts from R. Derynck, University of California at San Francisco). The resultant
HindIII end of each fragment was changed into the Xho I
end and subcloned into pCMV5 (a kind gift from J.L. Wrana, Hospital for
Sick Children, Toronto, Ontario, Canada). p3TP-Lux was
kindly provided by K. Miyazono (Department of Biochemistry, The Cancer
Institute, Tokyo, Japanese Foundation for Cancer
Research).42
Cell lines, transfections, and oligonucleotide treatments.
HepG2 and COS7 cells were cultured in Dulbecco's Modified Eagle's
Medium (DMEM) supplemented with 10% fetal calf serum (FCS). MOLM-1
cells were maintained in PRMI1640 supplemented with 10% FCS. The
32Dcl3 cells were maintained in RPMI1640 with 10% FCS and 0.25 ng of
murine interleukin-3 (IL-3) per mL. The 32Dcl3 cells were cultured in 5 ng of human G-CSF per mL instead of IL-3 when indicated. The 32Dcl3
cells were transfected with pMV7 or pMV-Evi-1, and stable transfectants
were isolated as described previously.47 Establishment of
the 32Dcl3 clones that stably express AML1/Evi-1 (A51 and A53) or
AML1/Evi-1 ZF8-10 (B13 and B18) was described
elsewhere.47 Cell morphology of 32Dcl3 clones was
determined by staining cytospin preparations by
May-Grünwald-Giemsa solution. Phosphothioate oligonucleotides
were transfected into MOLM-1 cells by using SuperFect Transfection
Reagents (QIAGEN Inc, Valencia, CA) according to the
manufacturer's recommendation. The oligonucleotide sequences were as
follows: sense, TATCGCTGCGAAGACTGTGA; antisense, TCACAGTCTTCGCAGCGATA.
Transient transfection into COS7 cells was performed by the
diethylaminoethyl (DEAE)-dextran method51 as
described previously.27
Growth inhibition assays.
Cells were seeded in 96-well culture plates at a density of 1 × 104 per well in the complete medium supplemented with 10%
FCS. TGF- at the different concentrations was added to the cells 12 hours later and cells were incubated for 24 hours. During the last 2 hours cells were labeled with 1 µCi/mL [3H]thymidine
(Amersham, Arlington Heights, IL). Thereafter, cells were
obtained and 3H radioactivity was measured in a liquid
scintillation -counter (Aloka, Mitaka, Tokyo, Japan).
Western blot analysis, immunoprecipitation, and metabolic labeling.
Polyclonal antisera to Evi-1 were raised in rabbit against
maltose-binding protein fusion of the protein as described
previously.26 For detection of Evi-1 and Flag-tagged Smad3,
cells indicated were lysed in the TNE buffer (10 mmol/L Tris-HCl pH
7.4, 150 mmol/L NaCl, 1% NP40, 1 mmol/L ethylenediamide-tetraacetic
acid) containing phosphatase inhibitors (12.5 mmol/L
-glycerophosphate, 1 mmol/L sodium orthovanadate) and a cocktail of
proteinase inhibitors (10 U/mL aprotinin, 1 mmol/L phenylmethylsulfonyl
fluoride, 5 µg/mL leupeptin, 1 µg/mL pepstatin A, 2 mmol/L
benzamidine, 1 µg/mL antipain, 1 µg/mL chymostatin, and 2 µg/mL
soybean trypsin inhibitor). Protein concentrations of cell extracts
were quantified using Protein Assay Dye (Bio-Rad, Hercules,
CA). Whole-cell extracts containing 100 µg of protein
were subjected to either 7.5% sodium dodecyl sulfate-polyacrylamide
gel electrophoresis (SDS-PAGE) for Evi-1 or 10% SDS-PAGE for
Flag-tagged Smad3, and transferred to polyvinylidene difluoride
membranes (Immobilon; Millipore, Bedford, MA). The
membranes were blocked with 10% skim milk, treated with the
anti-Evi-1 antibody or the anti-Flag M2 monoclonal antibody (Sigma, St
Louis, MO), washed, and reacted with the donkey anti-IgG antibody coupled to horseradish peroxydase. The blots were visualized with the enhanced chemiluminescence method (Amersham). For the anti-Flag immunoprecipitation, cells were lysed in the TNE buffer and
subjected to immunoprecipitation with anti-Flag followed by absorption
to Protein G-Sepharose (Pharmacia, Uppsala, Sweden). Immunoprecipitates were then washed and separated by a 7.5%
SDS-polyacrylamide gel. Subsequent detection of Evi-1 in the
precipitates was carried out as described above.
Transcriptional response assays.
For TGF- -inducible luciferase reporter assays, HepG2 cells were
seeded at a density of 2 × 105 per 6-cm plate. Cells were
transfected 18 hours after seeding with 5 µg of the reporter plasmids
(p3TP-Lux) along with the effector plasmids (2.4 µg for
pME-AML1/Evi-1 or the equivalent molar for their derivatives, and 2 µg for Flag-tagged Smads in pCMV5), using LipofectAMINE (GIBCO-BRL,
Gaithersburg, MD) according to the manufacturer's recommendation. For analysis of the luciferase activity derived from
cotransfection with several expression plasmids, the equivalent-molar plasmids were transfected and the total amount of DNA in terms of
weight was adjusted to be equal by adding the plasmid pUC13. As an
internal control of transfection efficiency, a plasmid expressing -galactosidase driven by SR promoter (1 µg) was cotransfected. Cells were added 15 hours later with equal volume of DMEM containing 4% FCS, and incubated for additional 9 hours. Thereafter, cells were
washed with phosphate-buffered saline twice and incubated for 24 hours
in the absence or presence of TGF- in DMEM containing 0.2% FCS.
Cells were then obtained and assayed for the luciferase activity using
the luciferase assay system (Promega, Madison, WI) and a
luminometer (Lumat; Berthold, Badwildbod, Germany). To
control transfection efficiencies, the data were normalized to the
-galactosidase activities measured by the method described previously.26 All transfection experiments were performed
at least three times and similar results were obtained.
 |
RESULTS |
AML1/Evi-1 inhibits TGF- -mediated transcriptional
activation of the target promoter.
We have reported that Evi-1 represses TGF- signaling in epithelial
cells.46 Because AML1/Evi-1 fusion protein contains the
whole Evi-1 sequence (Fig 1), it is plausible that AML1/Evi-1 can also
affect TGF- signaling. To examine potential roles of AML1/Evi-1 in
the TGF- signaling pathway, we evaluated the effects of AML1/Evi-1
on the TGF- -mediated transcriptional response using transient
cotransfection assays. We made use of p3TP-Lux, a luciferase reporter
plasmid that contains three repeats of a 12-O-tetradecanoylphorbol 13-acetate (TPA) response element and a fragment from positions 636
to 740 of the human plasminogen activator inhibitor-1 (PAI-1) promoter.52 This construct has been shown to be efficiently stimulated by TGF- through its receptors in a variety of cell lines.52-55 p3TP-Lux was transiently transfected either
alone or together with Evi-1 expression vector (pME-Evi-1), and
luciferase activity was measured in the extracts from untreated cells
or cells treated with 5 ng of TGF- per mL for 24 hours. As a model for these experiments, we used HepG2 cells, which are frequently used
for studies on TGF- -induced transactivation because they express
TGF- receptors and are highly responsive to TGF- .56 When p3TP-Lux alone was transfected into HepG2 cells, a 25-fold increase in luciferase activity was observed in the presence of TGF- , similar to the previous report40 (Fig
2). These transactivations were
substantially repressed when pME-Evi-1 was cotransfected as we have
reported previously.46 When AML1/Evi-1 was transfected, TGF- activation of the PAI-1 promoter was also repressed back to the
control level. We have identified the two separate regions that are
responsible for the Evi-1 inhibition of TGF- signaling: one is the
first zinc finger domain and the other is a 125-amino acid contact
region located N-terminally to the second zinc finger domain,46 which we refer to as the repression domain in
this report. As shown in Fig 2, the mutant AML1/Evi-1 protein that lacks the first zinc finger domain of Evi-1 failed to suppress TGF-
activation of the PAI-1 promoter. Deletion of the repression domain
also abolished the repressor activity of AML1/Evi-1. These results
indicate that AML1/Evi-1 can interfere with TGF- signaling depending
on the two separate region of the Evi-1 portion.

View larger version (18K):
[in this window]
[in a new window]
| Fig 2.
TGF- -mediated transcriptional responses are
suppressed by AML1/Evi-1. p3TP-Lux was cotransfected into HepG2 cells
along with either the empty pME18S, Evi-1, AML1/Evi-1, or its
derivatives in pME18S. Cells were incubated for 24 hours in the
presence or absence of 5 ng of TGF- per mL. Relative luciferase
activities were measured in cell extracts, normalized to the
-galactosidase activity. Values and error bars depict the means and
the standard deviations, respectively, of four separate experiments.
|
|
Constitutive expression of Evi-1 or AML1/Evi-1 in 32Dcl3 cells
overcomes TGF- -mediated inhibition of cellular growth.
Given the data from the cotransfection experiments indicating that
AML1/Evi-1, as Evi-1, can perturb TGF- signaling, we examined whether AML1/Evi-1 and Evi-1 affect the antiproliferative effects of
TGF- in hematopoietic cells. To this end, we used 32Dcl3 cells, a
murine IL-3-dependent immature myeloid cell line, which undergo growth
arrests in response to TGF- .57
We introduced the Evi-1 expression vector that enables concomitant
expression of the neomycin resistant gene (pMV-Evi-1) into 32Dcl3 cells
and selected them for neomycin resistance in the presence of G418.
Individual G418-resistant clones were screened for expression of Evi-1,
and several stable 32Dcl3 cell lines that express Evi-1 were isolated.
Of these clones, Western blot analyses using the antiserum against
Evi-126 showed that E1 and E11 are representative clones
expressing high levels of Evi-1 (Fig 3A, lanes 3 and
4). We had established elsewhere the 32Dcl3 clones that stably express the AML1/Evi-1 protein, which were designated as A51 and A53.47 Expression of AML1/Evi-1 in
A51 and A53 was also replicated (Fig 3A, lanes 3 and 4) as presented previously.47 Two independent clones, P1 and P2, which were transfected with the empty pMV7 vector, were used as controls. In these
experiments, intrinsic Evi-1 was under the detectable level in the
native 32Dcl3 cells. When cultured in complete medium without TGF-
treatment, all these clones showed comparable viabilities and
proliferative abilities with each other (data not shown). In the
absence of TGF- , all the Evi-1- or AML1/Evi-1-expressing clones
required IL-3 for proliferation and viability, as well as the
mock-transfected 32Dcl3 cells. We evaluated growth-inhibitory effects
of TGF- on these 32Dcl3 clones using [3H]thymidine
incorporation assays. Shown in Fig 3B are the effects on
[3H]thymidine uptake when the 32Dcl3 clones were exposed
to increasing amounts of TGF- . The growth of the two control clones,
P1 and P2, was inhibited by 1 ng of TGF- per mL. In contrast, E1 and E11, which express high levels of Evi-1, showed diminished
responsiveness to the TGF- growth-inhibitory signaling. The
AML1/Evi-1-expressing clones, A51 and A53, were also resistant to
TGF- -mediated growth inhibition to a similar extent as E1 and E11.
These data indicate that AML1/Evi-1 can interrupt growth-inhibitory
signals triggered by TGF- and that both AML1/Evi-1 and Evi-1 can
release hematopoietic cells from growth-arrested states induced by
TGF- .

View larger version (23K):
[in this window]
[in a new window]
| Fig 3.
Constitutive expression of AML1/Evi-1 in 32Dcl3 cells
overcomes TGF- -mediated inhibition of cell growth. (A) Expression
of the Evi-1 and the AML1/Evi-1 proteins in stable 32Dcl3
transfectants. Clones P1 (lane 1) and P2 (lane 2) are control lines
obtained from 32Dcl3 cells transfected with pMV7 followed by G418
selection. Clones E1 (lane 3) and E11 (lane 4) were established from
cells transfected with pMV-Evi-1, while clones A51 (lane 5) and A53
(lane 6) were from cells transfected with pME-AML1/Evi-1. The arrows
indicate the location of Evi-1 and AML1/Evi-1, and the positions of
molecular-weight standards are shown at left. (B) Analysis of growth
inhibition in response to TGF- . The 32Dcl3 clones stably transfected
with Evi-1 (E1 and E11) or AML1/Evi-1 (A51 and A53), and control clones
(P1 and P2) were subjected to a [3H]thymidine
incorporation assay in the presence of different concentrations of
TGF- . Results are expressed as percentages relative to values
observed in control cultures that did not receive TGF- .
Representative values from four independent experiments are shown.
|
|
32Dcl3 cells are known to differentiate into mature granulocytes when
cultured in the presence of G-CSF.58 We previously reported
that AML1/Evi-1 can affect granulocytic differentiation of 32Dcl3 cells
with dependence of the second zinc finger domain of the Evi-1
portion.47 When treated with G-CSF, AML1/Evi-1-expressing 32Dcl3 cells rapidly die within a week without obvious granulocytic differentiation. In contrast, 32Dcl3 cells that express the mutant AML1/Evi-1, which lacks the second zinc finger domain of the Evi-1 portion (AML1/Evi-1 ZF8-10), continuously proliferate without maturation in response to G-CSF. We examined effects of TGF- on
growth and differentiation of these stable transfectants of 32Dcl3
cells. In the presence of IL-3, P1, P2, A51, A53, and the clones that
stably express AML1/Evi-1 ZF8-10 (B13 and B18) proliferated exponentially in a comparable manner (data not shown), as described previously.47 When deprived of IL-3, they died completely
within 3 days without granulocytic differentiation, either in the
absence or the presence of TGF- (data not shown). When cultured with a combination of IL-3 and TGF- , A51, A53, B13, and B18 clones exponentially proliferated without losing viability and did not show
any morphological change (Fig 4A). These
results are compatible with the fact that the first zinc finger and the
repression domains of Evi-1 are responsible for AML1/Evi-1 repression
of TGF- signaling. In contrast, control P1 and P2 clones showed
decline in viable cell number in 2 days and mostly died within a week
(Fig 4A). No morphological differentiation into granulocytes was seen
in P1 and P2 clones (data not shown), suggesting that TGF- does not
affect differentiation stages of 32Dcl3 cells in the presence of IL-3.
When cultured with G-CSF instead of IL-3, P1 and P2 underwent terminal
differentiation into morphologically mature granulocytes and showed
gradual decline in viable cell number (Fig 4B), as described
previously.14,47 In contrast, A51 and A53 lost viability and rapidly died without maturation, whereas B13 and B18 proliferated continuously in an immature state.47 When both G-CSF and
TGF- were added to these clones, control P1 and P2 clones
immediately lost viability and completely died within 5 days, showing
granulocytic differentiation as seen in the presence of G-CSF alone
(Fig 4C). A51 and A53 also died promptly in the presence of G-CSF and
TGF- (Fig 4C). In contrast to P1 and P11, however, they showed no
morphological differentiation into granulocytes, as in the presence of
G-CSF alone (data not shown). B13 and B18 clones showed continuous
proliferation without differentiation, reflecting unresponsiveness of
B13 and B18 to the antiproliferative effect of TGF- and the
maturation signal of G-CSF. These results indicate that TGF- does
not significantly influence G-CSF-induced granulocytic differentiation
but may simply inhibit growth of 32Dcl3 cells at any differentiation
stage.

View larger version (15K):
[in this window]
[in a new window]
| Fig 4.
Growth curve of 32Dcl3 cells in response to TGF- in
the presence IL-3 or G-CSF. (A) The indicated cells were cultured with
0.25 ng of IL-3 per mL, 10 ng of TGF- per mL, and 10% FCS. Cultures
were diluted when the cell number reached 1 × 106 cells
per mL. Viable cells were counted by the trypan blue exclusion method
at each time point. Clones B13 and B18 are established from cells
transfected with pMV-AML1/Evi-1 ZF8-10. Two independent experiments
were performed and similar results were obtained. Representative data
are shown. (B and C) The indicated cells were washed twice with
phosphate-buffered saline and subsequently cultured with 5 ng of G-CSF
per mL either alone (B) or together with 10 ng of TGF- per mL (C) in
the presence of 10% FCS. Cultures were diluted when the cell number
reached 1 × 106 cells per mL.
|
|
Suppression of endogenous Evi-1 expression in inv(3) leukemic cells
recovers their responsiveness to TGF- .
From the data above, AML1/Evi-1 and Evi-1 can potentially block growth
inhibition of hematopoietic cells mediated by TGF- . We further
investigated whether the naturally expressed Evi-1 can also act as an
inhibitor of TGF- signaling. MOLM-1 cells are a human
megakaryoblastoid cell line carrying the inv(3)(q21q26) chromosomal
aberration. As a result of inv(3), MOLM-1 cells uniquely express the
truncated from of the Evi-1 protein in which the C-terminal 44 amino
acids of wild-type Evi-1 were replaced by five amino acids.20 The Evi-1 protein in MOLM-1 cells retains both the first zinc finger domain and the repression domain, which are the
requirements for repression of TGF- signaling. It was also shown to
increase AP-1 activity when expressed in NIH3T3 cells as wild-type
Evi-1.20 These facts allow us to expect it to possess the
ability to inhibit TGF- signaling. To modulate endogenous gene
expression of Evi-1 in MOLM-1 cells, we used the antisense gene
inhibition by oligonucleotides.59 As shown in Fig
5A, the endogenous Evi-1 expression in
MOLM-1 cells was effectively diminished by treatment with the antisense
oligonucleotide that is complementary to the sequence encoding the N
terminus of the first zinc finger domain of Evi-1, compared with cells
that received the corresponding sense oligonucleotide or no
oligonucleotide (Fig 5A). We determined TGF- responsiveness using
[3H]thymidine incorporation assays in these cells. In the
presence of TGF- , [3H]thymidine uptake was
significantly reduced in the MOLM-1 cells in which Evi-1 expression has
been suppressed by the antisense oligonucleotide treatment, compared
with those of cells treated with no or the sense oligonucleotide (Fig
5B). These results indicate that Evi-1 that is endogenously expressed
in leukemic cells acts as an antagonist for TGF- signaling and
strongly support a model that Evi-1 contributes to leukemic
transformation of hematopoietic cells by inhibiting TGF- signaling.

View larger version (20K):
[in this window]
[in a new window]
| Fig 5.
Inhibition of endogenous Evi-1 restores responsiveness of
MOLM-1 cells to TGF- . (A) MOLM-1 cells were treated with no ( ),
the sense (S), or the antisense (AS) oligonucleotide for Evi-1.
Whole-cell extracts containing 100 µg of proteins were subjected to
SDS-PAGE and immunoblotting with the anti-Evi-1 antibody. The amount
of the Evi-1 protein expressed in these cells is shown. The arrow
indicates the migration of the Evi-1 protein, and the positions of
molecular-weight standards are shown at left. (B) Analysis of growth
inhibition in response to TGF- . MOLM-1 cells treated with the
indicated oligonucleotide were subjected to a
[3H]thymidine incorporation assay in the presence of
different concentrations of TGF- . Results are expressed as
percentages relative to values observed in control cultures that did
not receive TGF- . Representative values from four independent
experiments are shown.
|
|
AML1/Evi-1 physically interacts with Smad3 through the first zinc
finger domain of the Evi-1 portion.
To explore a potential role of the ability of Evi-1 to interact with
Smad3 in the AML1/Evi-1 repression of TGF- signaling, we examined
whether AML1/Evi-1 is also able to associate with Smad3. To this end,
we transfected Smad3 tagged C-terminally with the Flag peptide
(Smad3-Flag) into COS7 cells in the absence or the presence of the
AML1/Evi-1 expression plasmid. Smad3-Flag was expressed efficiently
along with AML1/Evi-1 in the transfected cells, as can be seen by
immunoblotting with the anti-Flag or the anti-Evi-1 antibody (Fig
6A, middle and bottom, lanes
1 through 3). Whole extracts from these cells were immunoprecipitated
with the anti-Flag antibody and the precipitates were analyzed by
immunoblotting with the anti-Evi-1 antibody. As shown in Fig 6A, we
observed that AML1/Evi-1 and Smad3 were specifically
coimmunoprecipitated. We have reported elsewhere that the Evi-1-Smad3
association is mediated by the first zinc finger domain.46
On the other hand, the first zinc finger domain and the repression
domain of AML1/Evi-1 are required for TGF- signaling, as shown in
Fig 2. To confirm roles of these domains in the interaction between
AML1/Evi-1 and Smad3, we tested the Smad3 binding ability of the
AML1/Evi-1 mutants that lack these domains. These mutants were
coexpressed with Smad3-Flag in COS7 cells, and the whole cell extracts
were subjected to immunoprecipitation using the anti-Flag antibody. By
immunoblotting with the anti-Evi-1 antibody, the mutants are
recognized to be expressed at the levels comparable to each other at
the predicted sizes (Fig 6A, bottom, lanes 4 and 5). As seen in Fig 6A,
AML1/Evi-1 Rep was coimmunoprecipitated with Smad3 (Fig 6A, top, lane
5), whereas AML1/Evi-1 ZF1-7 could not (Fig 6A, top, lane 4). Thus,
deletion extending the entire of the first zinc finger domain of the
Evi-1 portion completely abolishes the AML1/Evi-1-Smad3 association, as
is the case with Evi-1.46 These results indicate that the
first zinc finger of the Evi-1 portion is essential for the interaction
of AML1/Evi-1 and Smad3.

View larger version (20K):
[in this window]
[in a new window]
| Fig 6.
AML1/Evi-1 physically interacts with Smad3 and
inhibits the Smad3 activity. (A) Association between AML1/Evi-1 and
Smad3 in vivo. Twenty micrograms of pME18S (lane 2), AML1/Evi-1 (lanes
1 and 3), AML1/Evi-1 ZF1-7 (lane 4), or AML1/Evi-1 Rep (lane 5) in
pME18S was transfected into 4 × 106 of COS7 cells with 20 µg of the empty pCMV5 (lane 1) or Smad3-Flag in pCMV5 (lanes 2 to 5).
Cells were obtained 48 hours later and subjected to the
immunoprecipitation procedure with the anti-Flag antibody.
Immunoprecipitates were resolved by SDS-PAGE, and detected by the
anti-Evi-1 antiserum (top). Expression of Smad3-Flag and Evi-1 is
monitored with the anti-Flag (middle) and the anti-Evi-1 (bottom)
antibodies, respectively. The location of Smad3 is shown at right, and
the positions of molecular-weight standard at left. (B) AML1/Evi-1
inhibits Smad3/4-induced TGF- responses. Either the empty pME18S,
Evi-1, AML1/Evi-1, or AML1/Evi-1 ZF1-7 in pME18S in combination with
p3TP-Lux was cotransfected into HepG2 cells together with pCMV5 or
Smad3 plus Smad4 (Smad3/4). Relative luciferase activities were
measured in cell extracts, normalized to the -galactosidase
activity. Values and error bars depict the means and the standard
deviations, respectively, of four separate experiments.
|
|
To evaluate the functional consequence of the interaction between
AML1/Evi-1 and Smad3, we examined the AML1/Evi-1 effect on the Smad3
activity. It is known that Smad3 can activate the PAI-1 promoter by
itself and that this activation is potentiated when Smad4 is
cotransfected.41 Coexpressed Smad3 and Smad4 (Smad3/4) synergized to induce about a 16-fold increase of the PAI-1 promoter activity without TGF- , and this transactivation was effectively repressed in the presence of Evi-1, as is consistent with the previous
studies.41,46 We examined whether AML1/Evi-1 can inhibit these Smad3/4-mediated promoter activation. As shown in Fig 6B, cotransfection of AML1/Evi-1 fully inhibited Smad3/4-dependent transcriptional activation. In contrast to full-length AML1/Evi-1 and
Evi-1, AML1/Evi-1 ZF1-7, which has lost the ability to interact with
Smad3, was unable to inhibit Smad3/4-induced activation of the PAI-1
promoter (Fig 6B). These findings indicate that AML1/Evi-1 blocks
TGF- responses by inactivating Smad3 functions through the
interaction with Smad3.
 |
DISCUSSION |
In the present study, we have found that the AML1/Evi-1 functions as a
negative regulator of TGF- signaling. We have also shown that both
Evi-1 and AML1/Evi-1 can repress TGF- -mediated growth inhibition in
hematopoietic cells. AML1/Evi-1 physically interacts with Smad3, a
mediator of TGF- signaling, as Evi-1 does, and this interaction
contributes to the AML1/Evi-1 repression of TGF- signaling. These
observations will provide a novel insight into a molecular basis for
the t(3;21) leukemia.
In this study, we identified a relationship between the two distinct
transcription regulators, AML1/Evi-1 and Smad3. Recent studies on
transcriptional networks have shown a growing number of instances of
functional antagonism between transcriptional regulators. For example,
it was reported that c-Jun inhibits myogenesis by interfering with the
MyoD function through the physical interaction.60 There are
several ways by which transcriptional repressors can block gene
expression.61 The simplest one is competitive DNA binding,
where binding of the repressor to the promoter prevents binding of
other activators. Indeed, sequence-specific transcriptional repression
by Evi-1 has been documented in transient cotransfection experiments
with reporter constructs containing the artificial binding sequences
for Evi-1.25 However, it seems unlikely that AML1/Evi-1
inhibits TGF- -mediated gene expression by binding directly to the
target promoters, because DNA consensus sequences for Evi-1 binding are
not found in the PAI-1 promoter used in this study. Recent studies have
suggested that Smad3 can be a DNA-binding protein and potentially
regulates gene expression through DNA binding.62-64
Therefore, it is highly likely that AML1/Evi-1 blocks TGF- signaling
by preventing Smad3 from interacting with DNA, as Evi-1 does. These
findings define a novel function of AML1/Evi-1 to regulate
transcription by the protein-protein interaction. The association of
AML1/Evi-1 with Smad3 is mediated by the first zinc finger domain of
the Evi-1 portion. Remarkably, the repression domain of Evi-1 is
dispensable for the association, indicating that the minimal
Smad3-binding domain of Evi-1 is not sufficient for inhibition of
TGF- signaling. These findings suggest several possibilities: the
repression domain may contribute to masking a domain of Smad3
responsible for interaction with DNA or transcriptional partners, and
AML1/Evi-1 needs to interact with corepressors through this region to
efficiently block the Smad3 activity.
Members of the TGF- superfamily are potent regulators of growth and
differentiation in various types of cells. The spatial and temporal
controls of their activities are thus important in the normal cellular
proliferation. A variety of mechanisms exist to affect the activities
of these proteins, including the cytoplasmic protein FKBP12 that
inhibits TGF- signaling by interacting with its
receptor,65,66 and the viral oncoprotein E1A that
circumvents ligand-induced growth inhibition by blocking negative
regulators of cell proliferation.67 Recently, it was
reported that Smad6 and Smad7 associate with the TGF- receptor and
function as an antagonist for TGF- signaling, which suggests the
existence of intracellular control mechanisms that may contribute to
cell-type specific responses to ligand stimuli.68-70 In
this report, we showed that AML1/Evi-1 can block the two distinct
responses induced by TGF- ; activation of the PAI-1 promoter and
inhibition of hematopoietic cell proliferation. Together with the fact
that AML1/Evi-1 interacts with Smad3, AML1/Evi-1 is now shown to belong
to a new class of regulators of TGF- signaling: a chimeric nuclear
oncoprotein48 derived from a chromosomal translocation that
inhibits the intracellular signaling component of TGF- signaling.
TGF- is one of the most studied cytokines that can negatively
regulate hematopoietic cell proliferation. It is also a potent
inhibitor of the number and ploidy of megakaryocytes.71,72
It is suggested that elevated expression of the Evi-1 proteins is
associated with dysmegakaryopoiesis in some myeloid
malignancies,73 as is typically seen in the 3q21q26
syndrome.74 Hence, disturbance of TGF- signaling by AML1/Evi-1 may account for one of the mechanisms of AML1/Evi-1-induced leukemogenesis and dysmegakaryopoiesis.
The TGF- receptor and its downstream components can be targets for
mutations in some types of cancer. For instance, the gene encoding the
TGF- receptor type II is commonly inactivated in colon
cancer.75 Smad2 and Smad4 genes have also been found
inactivated or deleted in colon cancer, suggesting their roles as a
tumor suppressor.38,76,77 Smad4 has been shown to be a
candidate tumor suppressor gene of human pancreatic
cancer78 and its mutations have been reported in various
types of tumors including head and neck, lung, and esophageal
cancers.79-84 Some of these naturally occurring mutations
are proved to impair the activities of Smad proteins,38,85,86 suggesting that alteration of Smad
functions will contribute to oncogenesis. Recently it was also reported that Smad5 is involved in the TGF- -mediated inhibition of primitive human hematopoietic progenitor cell proliferation.87
Although definite involvement of Smad proteins in hematological
malignancies remains yet to be determined, disintegration of the
TGF- signaling pathways may contribute to the progression toward
certain types of leukemias. Our findings also provide an important clue
for a role of Smad proteins in leukemogenesis.
 |
ACKNOWLEDGMENT |
The authors thank L. Wrana for the pCMV5 vector, R. Derynck for
providing Flag-tagged Smad3 and Smad4, and K. Miyazono for p3TP-Lux.
 |
FOOTNOTES |
Submitted July 9, 1998;
accepted September 9, 1998.
Supported in part by Grants-in-Aid for Cancer Research from the
Ministry of Health and Welfare and from the Ministry of Education, Science, and Culture of Japan.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Hisamaru Hirai, MD, Department of
Hematology & Oncology, Graduate School of Medicine, University of
Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-8655, Japan.
 |
REFERENCES |
1.
Rubin CM, Larson RAJ, Anatasi-Winter JN, Thangavelu M, Vardiman JW, Rowley JD, Le Beau MM:
t(3;21)(q26;q22): A recurring chromosomal abnormality in therapy-related myelodysplastic syndrome and acute myeloid leukemia.
Blood
76:2594, 1990[Abstract/Free Full Text]
2.
Schneider NR, Bowman WP, Frenkel EP:
Translocation (3;21)(q26;q22) in secondary leukemia.
Ann Genet
34:256, 1991[Medline]
[Order article via Infotrieve]
3.
Mitani K, Ogawa S, Tanaka T, Miyoshi H, Kurokawa M, Mano H, Yazaki Y, Ohki M, Hirai H:
Generation of the AML1-EVI-1 fusion gene in the t(3;21)(q26;q22) causes blastic crisis in chronic myelocytic leukemia.
EMBO J
13:504, 1994[Medline]
[Order article via Infotrieve]
4.
Look AT:
Oncogenic transcription factors in the human acute leukemias.
Science
278:1059, 1997[Abstract/Free Full Text]
5.
Kagoshima H, Shigesada K, Satake M, Ito Y, Miyoshi M, Ohki M, Pepling M, Gergen P:
The Runt-domain identifies a new family of heterodimeric transcriptional factor.
Trends Genet
9:338, 1993[Medline]
[Order article via Infotrieve]
6.
Ogawa E, Inuzuka M, Maruyama M, Satake M, Naito FM, Ito Y, Shigesada K:
Molecular cloning and characterization of PEBP2 , the heterodimeric partner of a novel Drosophila runt-related DNA binding protein PEBP2 .
Virology
194:314, 1993[Medline]
[Order article via Infotrieve]
7.
Wang S, Wang Q, Crute BE, Melnikova IN, Keller SR, Speck NA:
Cloning and characterization of subunits of the T-cell receptor and murine leukemia virus enhancer core-binding factor.
Mol Cell Biol
13:3324, 1993[Abstract/Free Full Text]
8.
Hsiang YH, Spencer D, Wang S, Speck NA, Raulet DH:
The role of viral enhancer "core" motif-related sequences in regulating T cell receptor-gamma and -delta gene expression.
J Immunol
150:3905, 1993[Abstract]
9.
Meyers S, Downing JR, Hiebert SW:
Identification of AML-1 and the (8;21) translocation protein (AML-1/ETO) as sequence-specific DNA-binding proteins: The runt homology domain is required for DNA binding and protein-protein interactions.
Mol Cell Biol
13:6336, 1993[Abstract/Free Full Text]
10.
Nuchprayoon I, Meyers S, Scott LM, Suzow J, Hiebert S, Friedman AD:
PEBP2/CBF, the murine homolog of the human myeloid AML1 and PEBP2 /CBF proto-oncoproteins, regulates the murine myeloperoxidase and neutrophil elastase genes in immature myeloid cells.
Mol Cell Biol
14:5558, 1994[Abstract/Free Full Text]
11.
Suzow J, Friedman AD:
The murine myeloperoxidase promoter contains several functional elements, one of which binds a cell type restricted transcription factor, myeloid nuclear factor 1 (MyNF1).
Mol Cell Biol
13:2141, 1993[Abstract/Free Full Text]
12.
Uchida H, Zhang J, Nimer SD:
AML1A and AML1B can transactivate the human IL-3 promoter.
J Immunol
158:2251, 1997[Abstract]
13.
Zhang DE, Hetherington CJ, Shapiro LH, Chen HM, Look AT, Tenen DG:
CCAAT enhancer-binding protein (C/EBP) and AML1 (CBF 2) synergistically activate the macrophage colony-stimulating factor receptor promoter.
Mol Cell Biol
16:1231, 1994[Abstract]
14.
Tanaka T, Tanaka K, Ogawa S, Kurokawa M, Mitani K, Nishida J, Shibata Y, Yazaki Y, Hirai H:
An acute myeloid leukemia gene, AML1, regulates hemopoietic myeloid cell differentiation and transcriptional activation antagonistically by two alternative spliced forms.
EMBO J
14:341, 1995[Medline]
[Order article via Infotrieve]
15.
Mucenski ML, Taylor BA, Ihle JN, Hartley JW, Morse H3, Jenkins NA, Copeland NG:
Identification of a common ecotropic viral integration site, Evi-1, in the DNA of AKXD murine myeloid tumors.
Mol Cell Biol
8:301, 1988[Abstract/Free Full Text]
16.
Morishita K, Parker DS, Mucenski ML, Jenkins NA, Copeland NG, Ihle JN:
Retroviral activation of a novel gene encoding a zinc finger protein in IL-3-dependent myeloid leukemia cell lines.
Cell
54:831, 1988[Medline]
[Order article via Infotrieve]
17.
Morishita K, Parganas E, Douglass EC, Ihle JN:
Unique expression of the human Evi-1 gene in an endometrial carcinoma cell line: sequence of cDNAs and structure of alternatively spliced transcripts.
Oncogene
5:963, 1990[Medline]
[Order article via Infotrieve]
18.
Morishita K, Parganas E, William CL, Whittaker MH, Drabkin H, Oval J, Taetle R, Valentine MB, Ihle JN:
Activation of EVI1 gene expression in human acute myelogenous leukemias by translocations spanning 300-400 kilobases on |