|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 92 No. 11 (December 1), 1998:
pp. 4080-4089
Enhanced Retroviral Transduction of 5-Fluorouracil-Resistant Human
Bone Marrow (Stem) Cells Using a Genetically Modified Packaging Cell
Line
By
Joanna Povey,
Nishanthi Weeratunge,
Chloe Marden,
Amita Sehgal,
Adrian Thrasher, and
Colin Casimir
From the Department of Haematology, Imperial College School of
Medicine, St Mary's Campus, Norfolk Place, London; and the Molecular
Immunology Unit, Institute of Child Health, Guilford St, London,
UK.
 |
ABSTRACT |
Pluripotent hematopoietic stem cells (PHSC) are rare cells capable
of multilineage differentiation, long-term reconstituting activity and
extensive self-renewal. Such cells are the logical targets for many
forms of corrective gene therapy, but are poor targets for retroviral
mediated gene transfer owing to their quiescence, as retroviral
transduction requires that the target cells be cycling. To try and
surmount this problem we have constructed a retroviral producer line
that expresses the membrane-bound form of human stem cell factor (SCF)
on its cell surface. These cells are capable, therefore, of delivering
a growth signal concomitant with recombinant retroviral vector
particles. In this report we describe the use of this cell line to
transduce a highly quiescent population of cells isolated from adult
human bone marrow using the 5-fluorouracil (FU) resistance technique of
Berardi et al. Quiescent cells selected using this technique were
transduced by cocultivation with retroviral producers expressing
surface bound SCF or with the parent cell line that does not. Following
coculture, the cells were plated in long-term bone marrow culture for a
further 5 weeks, before plating the nonadherent cells in semisolid
media. Colonies forming in the semisolid media over the next 14 days
were analyzed by polymerase chain reaction for the presence of the
retroviral vector genome. Over six experiments, the transduction
frequency of the quiescent 5-FU resistant cells using the
SCF-expressing producer line averaged about 20%, whereas those
transduced using the parent producer line showed evidence of reduced
levels or no transduction.
© 1998 by The American Society of Hematology.
| |
INTRODUCTION |
A MAJOR OBSTACLE TO the development of
gene therapy protocols for inherited hematopoietic disorders has been
the relative difficulty of introducing new genetic material into human
pluripotent hematopoietic stem cells (PHSC). Clinical gene marking and
large animal studies have suggested that only about 0.1% to 1% of
PHSC are routinely targeted.1,2 A major contributory factor
to this low efficiency is the quiescence of PHSC3 and the
inability of retroviral vectors to stably integrate into the genome of
nondividing cells.4,5 Although, some alternative vectors
(eg, AAV or HIV-based systems) are capable of infecting such cells,
they all have serious attendant problems, making the use of retroviral vectors still an attractive proposition, especially as they remain the
most highly developed of the vectors applicable to PHSC gene transfer
and have been proven safe enough for some limited clinical usage.6-8 Moreover, as retroviral vectors have been used
successfully in murine systems it seems likely that there is no
fundamental problem to their application in human gene therapy
protocols. To try and circumvent these difficulties, we have developed
a number of retroviral producer cells lines that also express human recombinant stem cell factor (SCF)9,10 in its
membrane-bound form.11,12 In this way we hoped to promote
cell cycling in PHSC simultaneous with their exposure to retroviral
vector and so facilitate their transduction.
Given that there is no unequivocal evidence indicating to what
cytokines PHSC respond, the choice of SCF was dictated by a number of
factors. Firstly, cells expressing high levels of SCF receptor are
highly enriched for PHSC.13 Secondly, cells selected by
their functional properties as human PHSC were shown to have high
levels of surface SCF receptor.3 In the mouse,
Steel mutants make no functional SCF with devastating
consequences for their hematopoietic system.10,14 In
addition, mice bearing the "dickie" allele of Steel make
a biologically active soluble form of SCF but fail to make the
membrane-bound form,15 yet they have a phenotype very
similar to individuals that are unable to make SCF at all, suggesting
that the membrane-associated form of the growth factor is more critical
for the maintenance and differentiation of PHSC.12
This paper reports the successful transduction of quiescent bone marrow
cells selected using the 5-fluorouracil (FU) technique of Berardi et
al,3 by using a retroviral producer line expressing human
recombinant SCF on its cell surface.
| |
MATERIALS AND METHODS |
Retroviral vectors and packaging lines.
Human SCF cDNA was obtained in a Bluescript SK-plasmid.16
This was excised and inserted into an expression vector pREP8 (Invitrogen, San Diego, CA), which contained the
histidinol resistance gene as a selectable marker. The resulting
plasmid pREP8 SCF was then used to transfect the amphotropic
retroviral producer cell line, 1MI, which is derived from the
AM1217 packaging line and produces a retroviral vector
(pBABE) carrying the p47phox gene as described
previously,18 but lacking a neo selectable marker.
The producer cells were transfected using the calcium phosphate
precipitation method. Several clones were isolated in Dulbecco's
modified Eagle's medium (DMEM), 10% fetal calf serum (Sigma, St
Louis, MO), containing histidinol (2.5 mmol/L) and were tested for SCF
expression by immunofluorescence. The best of these (clone 2) was
chosen for the following experiments and designated 1MI-SCF. These
were grown in DMEM and 10% fetal calf serum.
Northern and dot blotting.
RNA was extracted from murine retroviral producer fibroblasts by acid
phenol extraction, ethanol precipitated, and resuspended in sterile
distilled-deionized water that had been treated with diethyl
pyrocarbonate. RNA samples (10 µg) were separated by electrophoresis on 1% agarose-formaldehyde gels, transferred to nylon membrane by
capillary transfer, hybridized, washed, and exposed to x-ray film all
as described previously.18 For dot blots, fresh culture medium was added to confluent cultures of retroviral producer cells.
Following a 24-hour incubation, the supernatant was removed and
filtered through a 0.45-µm filter. The retroviral supernatant was
aliquoted and stored at  70°C. Supernatant was spotted under vacuum onto the surface of a nylon membrane using a dot blot manifold (GIBCO-BRL, Gaithersburg, MD). The filter was cross-linked with ultraviolet light using a Stratalinker (Stratagene Corp, La Jolla, CA)
and hybridized as described above for Northern blots.
Proliferation assays.
Bioassay of SCF was performed by 3H thymidine incorporation
essentially as described by Callard et al.19 Log-phase TF-1
cells (1 × 106) were washed twice with
phosphate-buffered saline (PBS) to remove all traces of cytokine.
Washed cells (5 × 105) were maintained in
media without cytokines for 24 hours. A total of 1 × 104 (100 µL) and the quiescent cells were then dispensed
in triplicate into a 24-well plate. The plates were incubated for 48 hours at 37°C in 5% CO2 in air, after which 1 µCi
3H-TdR (specific activity, 5 Ci/mmol; Amersham
International, UK) was added to each well. Following a further
incubation period of 12 to 18 hours, the labeled cells were harvested
onto glass-fiber discs using Dynatech Automash Cell Harvester (LabTech
Intl, UK). The incorporated 3H thymidine was counted on a
liquid scintillation counter (Wallac 1209 Rack Beta, Wallac, UK) and
expressed as disintegrations per minute (dpm) after correction for
quenching and efficiency of counting.
For experiments involving cocultivation, 24 hours before addition of
TF-1 cells, 105 producer fibroblasts were plated into wells
of a 24-well plate and allowed to adhere to the plastic. Following an
overnight incubation the cells were irradiated as described elsewhere.
In culture experiments using a Transwell (Costar, Cambridge, MA)
fibroblasts were added to the plate well as above and the TF-1 cells
were added to the insert, which is connected to the culture via a
3-µm semipermeable membrane.
Human bone marrow.
Normal human bone marrow cells were obtained from healthy adult
volunteers. Use of these samples was approved by The Research Ethical
Committee at Great Ormond Street Hospital and The Institute of Child
Health. Light density mononuclear cells were obtained by centrifugation
for 20 minutess at 2,000 rpm on Ficoll-paque (Pharmacia, Uppsala,
Sweden).
Stromal cells.
Stroma was allowed to form over a period of 2 weeks from bone marrow
cells separated on Ficoll, as described above and plated at 1 × 107 cells per T25 flask in modified McCoy's 5A medium
supplemented as below. Stromal monolayers were irradiated with 2,500 rads at 14 days.
CD34+ selection.
CD34+ cells were isolated from bone marrow cells separated
on Ficoll by positive selection on a MiniMACs immunomagnetic column (Miltenyi Biotec, Surrey, UK), as described by the manufacturers.
5-FU treatment.
CD34+ cells or unfractionated bone marrow cells were
selected in 5 FU, as described by Berardi et al.3 Briefly,
cells were incubated for 7 days at 37°C, 5% CO2 in
Iscove's modified Dulbecco's medium (IMDM; GIBCO) with 10% fetal
calf serum (Sigma) supplemented with SCF (100 ng/mL; R&D Systems,
Oxford, UK) and interleukin-3 (IL-3; 100 ng/mL) with or without 5-FU
(0.6 mg/mL; David Bull Laboratories, Warwick, UK).
Characterization of cell cycle and SCF receptor status.
Cycle status for 5-FU treated cells and untreated cells was determined
by 3H-thymidine incorporation. One microcurie of
3H-thymidine was added to 200 µL of treated or untreated
cells (2 to 4 × 107) and incubated for 24 hours.
Cells were then spun down, washed in PBS, and pelleted onto glass
slides using a Cytospin (Shandon Scientific, Runcorn, UK). SCF receptor
status was determined by staining with antihuman SCF receptor antibody
and fluorescein isothiocyanate (FITC)-conjugated anti-mouse Ig (Dako,
Bucks, UK ). Photographs were taken on a fluorescence microscope
(Olympus). Slides were dipped in photographic emulsion (50% solid
emulsion, 2% glycerol in H2O) and developed after 1 week.
Slides were counterstained with Wright's stain or Toluidine Blue.
Bright field images of cells were photographed. Counts on labeled cells
were performed on 30 random views under oil immersion. Approximately
400 cells were counted.
Transduction with retroviral vector.
Selected or unselected cells were cocultured with the irradiated
1MI-SCF, or the 1MI parent cell line, for 72 hours in supplemented McCoy's 5A medium. Cells were then obtained, washed in PBS, and resuspended in 10 mL supplemented McCoy's 5A medium.
Long-term marrow culture.
LTC-IC assays were performed by culturing transduced cells on
irradiated stroma for 5 weeks in McCoy's 5A medium supplemented with
12.5% fetal calf serum (Sigma), 12.5% horse serum (Sigma), 1% sodium
bicarbonate (GIBCO), 1% minimum essential medium (MEM), sodium pyruvate (100 mmol/L; GIBCO), 0.4% MEM nonessential amino acids
(10 mmol/L; GIBCO), 2 mmol/L L-glutamine (GIBCO), 1% MEM amino acids
with L glutamine (GIBCO), 1% MEM vitamins solution (GIBCO), 100 U/mL
penicillin (Sigma), 100 µg/mL streptomycin (Sigma), 0.25 µg/mL amphotericin B (Sigma), and 0.03% hydrocortisone (1 mg/mL in
DMSO; Sigma). LTMC were incubated at 37°C, 5% CO2, and fed weekly by removal of 50% of the media. Nonadherent cells were spun
down and returned to the culture in fresh media.
Methylcellulose assays.
Cells from LTMC were spun down and resuspended in 500 µL Iscove's
medium together with 2.5 mL STEMGEM medium (obtained from Dr
J. Hatzfeld, Paris, France) containing 5 U IL-3, 30 U IL-6, 10 U
granulocyte-macrophage colony-stimulating factor (GM-CSF), 6 to 12 U
erythropoietin (EPO), 18 ng SCF, 30 µL iron-saturated transferrin, 2 mmol/L glutamine, 5 × 10 5 mol/L
2-mercapto-ethanol, 3 mg bovine serum albumin, 30% fetal calf serum,
and 1% methylcellulose. Cells were incubated at 37°C, 5%
CO2, and saturated humidity for 2 to 4 weeks.
Analysis of retroviral infection.
Efficiency of infection was determined by polymerase chain reaction
(PCR) analysis of colonies or single cells picked from methylcellulose
assays into lysis buffer (50 mmol/L Tris pH 8.0, 1 mmol/L EDTA, 0.5%
Tween 20, 200 µg/mL proteinase K) incubated 1 hour at 55°C, then
10 minutes at 95°C. Successful transfer of the
p47phox gene was detected by amplification of a
region of the vector that included sequences of both retroviral and
p47phox cDNA. A nested PCR strategy was also
employed using a forward primer (ATGGCCAACCTTTAACGTCGGATG) derived from
the gag region of the retroviral vector and a reverse primer
taken from internal p47phox sequence
(GTTTTATGGAACTCGTAGATCTCG). The nested upstream primer (GAGCACTGGAGGCCACCCAGT) was taken from the 5 untranslated region of the p47phox cDNA. The expected size of the
product of the first amplification was 454 bp and the final product
size was 180 bp. PCR reactions were performed in 50-µL total volume,
containing 1 µmol/L primers, 0.1 mmol/L dNTPs (Promega, Madison, WI),
1 × KCL buffer 1.5 mmol/L MgCl2, and 2 U Taq
polymerase (Bioline, London, UK). PCR products were run on 2% agarose
gels containing 1 µg/mL ethidium bromide in 1× TAE buffer (40 mmol/L Tris pH7.8, 20 mmol/L sodium acetate, 2 mmol/L EDTA) and
visualized on a 300-nm ultraviolet transilluminator.
| |
RESULTS |
Construction of a retroviral producer cell line (1MI-SCF) expressing
human SCF on its cell surface.
To develop a retroviral producer cell line expressing surface SCF, we
first constructed a mammalian expression plasmid encoding the
membrane-bound form of human SCF. The membrane-bound isoform of human
SCF cDNA is an 814-bp fragment encoding a splice variant lacking exon
6. Exon 6 contains a proteolytic cleavage site that enables the
molecule to be cleaved from the cell surface to produce the soluble
growth factor. This cDNA was cloned into the expression vector pREP8
(Invitrogen) using HindIII and BamH1
(Fig 1A). pREP8 encodes a marker conferring
resistance to the drug histidinol. This plasmid (pREP8-SCF) was then
introduced into our retroviral producer cell line 1MI, by calcium
phosphate transfection. The 1MI cell line is a retroviral producer line
derived from AM1217 by transfection with a retroviral
vector encoding p47phox (Fig 1B), the molecule most
commonly affected in the autosomal recessive form of chronic
granulomatous disease. The transfected cells were then selected in
histidinol and individual clones isolated by ring cloning. The
resulting clones were tested for their expression of SCF by
immunofluorescence using an anti-SCF antibody on permeabilized (Fig 2A through C) and unpermeabilized (Fig
2D and E) cells to confirm the surface expression of SCF. Intense
fluorescence was visible in transfected cells, shown both before (Fig
2A) and after (Fig 2B) selection and cloning. Untransfected cells are
just visible in the unselected culture and staining of the parent line
is shown in Fig 2C. Note that in the permeabilized cells the staining
indicates a major accumulation of SCF in a nuclear-adjacent region,
probably the Golgi, whereas in unpermeabilized cells the strongest
staining regions are the junctions between cells.
View larger version (16K):
[in this window]
[in a new window]
| Fig 1.
Construction of retroviral producer cells expressing
membrane-bound SCF. (A) Schematic of plasmid pREP8- SCF. (B)
Evolution of cell line 1MI-SCF from AM12 packaging line.
|
|
View larger version (61K):
[in this window]
[in a new window]
View larger version (93K):
[in this window]
[in a new window]
| Fig 2.
Immunofluorescent detection of SCF on retroviral producer
cells. Fibroblasts were stained with FITC-conjugated antibody to human
SCF with (A through C) or without (D and E) permeabilization and viewed
under the fluorescence microscope (×400). (A) 1MI cells following
transfection but before selection in histidinol; (B) 1MI-SCF cells
following selection and cloning; (C) untransfected 1MI cells. (B) and
(C) were photographed under exactly the same exposure conditions; (D)
1MI-SCF cells following selection and cloning; (E) untransfected 1MI
cells. (E) Is overexposed to make the cells more visible.
|
|
Expression of SCF was also analyzed by Northern blotting on RNA
extracted from four independently arising clones
(Fig 3A). The level of
expression of SCF mRNA detected in the Northern blot was also in good
agreement with the relative immunofluorescent intensity of the
different clones. The retroviral titer of these four clones was also
checked to ensure that the 1MI-SCF cells were still able to generate
retrovirus. Retroviral supernatants were used to prepare a dot blot,
which was hybridized with a radiolabeled p47phox probe. All
four clones showed only slight variations in titer from the parent 1MI
line and in no case was an increase in titer observed. On the basis of
these analyses the clone with the best balance of expression and titer,
clone 2, was used for all the subsequent experiments; this cell line
was termed 1MI-SCF.
View larger version (71K):
[in this window]
[in a new window]
View larger version (48K):
[in this window]
[in a new window]
View larger version (28K):
[in this window]
[in a new window]
| Fig 3.
(A) Expression of SCF mRNA by retroviral
producer cells. 1MI cells transfected with the plasmid pREP8SCF were
selected in histidinol and individual clones isolated. RNA was
extracted from four independently isolated clones and analyzed by
Northern blot. The blot was hybridized to an SCF cDNA probe. Lane C,
pREP8SCF plasmid DNA digested with BamH1 and HindIII
to release the SCF cDNA fragment; lanes 1 through 4, four independent
clones of transfected 1MI cells. (B) Retroviral titer of fibroblast
clones isolated following transfection with pREP8SCF. Culture
supernatants were collected from four independent clones of 1MI cells
following transfection with plasmid pREP8SCF. Twenty-five
microliters (top row) or 2.5 µL (bottom row) of supernatant was
spotted onto the surface of a nylon filter using a dot blot manifold
and hybridized with a probe for p47phox. Lanes 1 through 4, supernatants from four independently isolated clones; (+), retroviral
genomic DNA plasmid containing p47phox cDNA ; () , wild-type retroviral genomic DNA plasmid. (C) Proliferation assay on
TF-cells. Biological activity of the membrane-bound growth factor on
the surface of the 1MI-SCF cell line was assayed by 3H
thymidine incorporation into quiescent TF-1 cells. sSCF, TF-1 cells
stimulated with 50 ng/mL recombinant human SCF; 1MI-SCF, TF-1 cells
cocultured for 24 hours with the 1MI-SCF cell line; 1MI-SCF + sSCF, TF-1 cells cocultured for 24 hours with the 1MI-SCF cell line
and 50 ng/mL recombinant human SCF; 1MI-SCF + Transwell,
TF-1 cells cocultured for 24 hours with the 1MI-SCF cell line, where
the TF-1 cells were suspended in a Transwell. Incorporation was
corrected for background values obtained with unstimulated TF-cells and
1MI-SCF cells, as appropriate.
|
|
The biological activity of the surface SCF expressed by 1MI-SCF was
confirmed by proliferation assay on the TF-1 cell line20 (Fig 3C). Compared with soluble human recombinant SCF, similar levels
of stimulation were obtained by coculture of TF-1 with 1MI-SCF
cells. Addition of soluble SCF to TF-1/1MI-SCF cocultures did not
produce any increase in proliferation, suggesting that TF-1 cells were
maximally stimulated by 1MI-SCF. Furthermore, coculture of TF-1 with
1MI-SCF cells using a Transwell to separate the target cells and
prevent cell-cell contact significantly reduced the proliferative
effect of the 1MI-SCF cells.
Isolation of 5-FU-resistant marrow cells.
To obtain a target cell population of highly enriched stem cells with
which to test our modified producers we adopted the method of Berardi
et al.3 This method is attractive because it selects
specifically for quiescent cells in the marrow and makes few
assumptions about the surface phenotype of PHSC, which remains somewhat
contentious.
Aspirated bone marrow cells were separated on Ficoll and the
mononuclear cell fraction isolated. These cells were then incubated for
7 days in medium supplemented with soluble human SCF, IL-3, and 5-FU. A
sample of cells from a such a culture at 4 days of incubation is shown
in Fig 4A (top right panel), together with a control culture in which the 5-FU was omitted (Fig 4A, top left panel), by way of comparison. A strikingly different picture was observed in the presence of 5-FU with the majority of the surviving cells being terminally differentiated cells such as erythrocytes and
polymorphs. Large cells with expanded nuclei and prominent cytoplasm
frequent in the untreated cultures were conspicuous by their absence.
To show that the cells surviving the 5-FU treatment were quiescent, 24 hours before harvesting, tritiated thymidine was added to the cultures
to label any dividing cells. After 7 days of culture in the selective
medium, the cells were collected onto microscope slides by Cytospin and
dipped in autoradigraphic emulsion. Prominent clusters of silver grains
could be seen in untreated control cultures (Fig 4A, middle left
panel), whereas cells from the 5-FU-treated culture were unlabeled
(Fig 4A, middle right panel). The cells were also analyzed for
high-level expression of the SCF receptor, a marker for the
5-FU-resistant cells.3 As shown in Fig 4A, the
5-FU-resistant cells (bottom right panel) all showed bright
fluorescence with a FITC-conjugated anti-SCF receptor antibody, whereas
the untreated controls (bottom left panel) showed a wide spectrum of
intensities, confirming that 5-FU selects a subset of cells with a
higher level of expression of SCF receptor.
View larger version (121K):
[in this window]
[in a new window]
View larger version (131K):
[in this window]
[in a new window]
| Fig 4.
(A) Selection of quiescent bone marrow cells using 5-FU.
Bone marrow mononuclear cells were incubated for 7 days in IMDM either
supplemented with IL-3, SCF, and 5-FU to kill dividing cells
(right-hand panels) or not (left-hand panels). At 4 days of incubation
an aliquot was spun onto microscope slides and stained with Wright's
stain (top panels). Twenty-four hours before harvesting, 3H
thymidine was added to the cultures. Following 7 days incubation cells
were obtained and spun onto microscope slides. The slides were dipped
in photographic emulsion and exposed for 7days before being developed,
counterstained with Wright's stain, and visualized under the light
microscope (middle panels). (Bottom panels) Cells as above, but stained
with antibody to c-kit and viewed under fluorescence. (B)
Long-term culture. 5-FU-selected cells were plated on monolayers of
bone marrow derived fibroblast as described in Materials and Methods
and used to initiate long-term bone marrow cultures. The arrows show
areas of extensive lipid deposition characteristic of these types of
culture. Arrowheads identify "cobblestone areas," clusters of
developing hematopoietic cells.
|
|
Very few cells survived this procedure. Indeed, as assayed by Trypan
blue staining of a small sample, all visible cells were found to be
nonviable. However, when used to initiate long-term cultures on
preformed, irradiated stroma, this population of cells proved very
active in establishing hematopoiesis as evidenced by extensive lipid
deposition and characteristic "cobblestone" areas (Fig 4B).
Induction of cycling in 5-FU-resistant cells.
To successfully transduce the 5-FU-resistant cells it was necessary to
induce them to cycle. To test whether this was possible using soluble
cytokines, we used a standard mixture of IL-3, IL-6, and SCF, as well
as coculturing the cells with the retroviral producer line 1MI and
soluble SCF or the 1MI-SCF line alone. To detect cells that divided
during the period of exposure to growth factor, we used
3H-thymidine incorporation and examined the cells under the
light microscope for the deposition of silver grains
(Fig 5). Only the cells cocultivated with
the 1MI-SCF producers showed evidence for 3H-thymidine
incorporation in significant numbers, the average of two experiments
being 28.4%. Much lower levels of cell division were detected using
the parent cell line, 1MI, even when cells were cocultivated in the
presence of added exogenous soluble SCF where only 6.6% of cells
showed incorporation of label. Representative views are shown for cells
stimulated by 1MI-SCF (Fig 5, top panels) and 1MI (Fig 5, bottom
panels). Stimulation, in liquid culture using some other combinations
of cytokines, did not give rise to labeled cells (not shown).
View larger version (120K):
[in this window]
[in a new window]
| Fig 5.
3H Thymidine labeling of 5-FU cells. Bone
marrow cells selected in 5-FU, IL-3, and SCF were incubated for 48 hours on monolayers of retroviral producer cells and labeled for 24 hours in the presence of 3H thymidine. (Top panels) Cells
incubated with producer line 1MI-SCF. (Bottom panels) Cells
incubated with producer line 1MI and exogenous soluble SCF (100 ng/mL).
(Left-hand panels) Photographed at 400× original magnification;
(right-hand panels) 1,000× (oil immersion). Arrowheads indicate
examples of labeled cells.
|
|
Retroviral transduction of quiescent 5-FU-resistant bone marrow
cells.
Having isolated a population highly enriched for quiescent stem cells,
we then wished to test whether they could be transduced with
retroviruses using our 1MI-SCF producer line. A schematic of the
experiment is shown in Fig 6A.
5-FU-resistant bone marrow cells, selected as described above, were
incubated for 72 hours with retroviral producers either 1MI-SCF or
the parent 1MI cell line. Following incubation with the retroviral
producers, the cells were plated onto an irradiated, heterologous human
stromal monolayer. The cells were allowed to establish a long-term
marrow culture and the culture continued for 5 weeks. After this time, cells in the supernatant were obtained and plated for colony assay in
semisolid media. Colonies were allowed to develop for 2 to 3 weeks then
plucked from the semisolid media, using a glass capillary tube, into
individual microcentrifuge tubes containing cell dissociation buffer.
This material was then subjected to analysis by PCR using a nested
primer strategy. The initial amplification used an upstream primer
specific for the gag region of the retroviral vector and a downstream
primer specific for the p47phox cDNA insert. A
small aliquot of this first reaction was then used for a second round
of PCR amplification using the same downstream primer and a second
upstream primer also derived from the p47phox cDNA.
Four control amplifications were routinely performed, three containing
different amounts of the retroviral genome in the form of plasmid DNA
and one using genomic DNA from the 1MI producer line that contains an
integrated copy of the retroviral genome. A typical example of the
colony analysis is shown in Fig 6B and a more complete description of
the transduction results in Table 1. It is
apparent from these data that 5-FU-resistant cells could be
successfully transduced and that a noticeable enhancement was obtained
by using the 1MI-SCF producers that express surface SCF. In two out
of four experiments the background level of transduction achieved using
the 1MI parent line was below our level of detection (<1/30). It
seems likely that in the remaining two experiments, where a significant
background transduction frequency was observed, the 5-FU failed to kill
all the dividing cells in the marrow aspirate. If this background is
subtracted from the 1MI-SCF result transduction frequencies of 27%
and 30%, respectively, are obtained. This correlates well with the
results obtained in the other four experiments, which remained quite
consistent, ranging from 13% to 25% of colonies scoring positive.
View larger version (19K):
[in this window]
[in a new window]
View larger version (118K):
[in this window]
[in a new window]
| Fig 6.
Retroviral transduction of 5-FU-selected bone marrow
cells. (A) Schematic of experimental plan for analysis of retroviral
transduction of 5-FU-selected bone marrow cells. (B) PCR analysis of
5-week LTC-IC-derived colonies plated in semisolid media. Individual
colonies arising from 5-FU-selected cells plated in 5-week long-term
cultures were picked into separate tubes and the genomic DNA subjected
to PCR with primers specific for the retroviral genome. The PCR
products were separated by electrophoresis on 2% agarose gels, stained
with ethidium bromide, and visualized under ultraviolet light. Lanes 1 through 11, colonies picked from semisolid media, following
transduction on 1MI-SCF cell line; lane 0, DNA (1 µg) from AM12
cell line; lane C, DNA (1µg) from 1MI parent cell line; lane M,
HindIII digest of phage  DNA and HaeIII digest of
phage  X174 DNA used as size markers. The arrow denotes the expected
size of the PCR product specific to the p47phox-containing
retroviral genome.
|
|
| |
DISCUSSION |
Stem cells, defined by their functional ability to provide long-term
hematopoietic reconstitution, are difficult to isolate. Many in vitro
assay systems and flow cytometry approaches have been developed to
substitute for this cumbersome and time consuming methodology, but do
not appear to identify true PHSC.21 For example, highly
efficient transduction of LTC-IC or CD34+ populations by
retroviruses has been observed in a number of cases,2,22-24
but this has translated into very poor levels of retrovirally marked
cells in transplanted individuals.2,8,23,25 The 5-FU
technique of Berardi et al,3 which takes a functional approach to the isolation of stem cells by exploiting their quiescence, has proven straightforward to perform, does not require the use of
sophisticated equipment, and is highly efficient. On the basis of the
experiments described here though we should include a caveat that on
some occasions up to one third of the cells purified with a single dose
of 5-FU may still be cycling. This could probably be improved by adding
fresh 5-FU during the selection period, or by preselecting for
CD34+ cells, so that the density of cells in the selective
media is significantly reduced. Preliminary results of ours have
indicated that the latter strategy is indeed more efficient at removing cycling cells (N.W. and C.C., unpublished observation, January 1998)
An unfortunate consequence of the quiescence of the 5-FU-selected
cells (and presumably all PHSC) is that it makes them difficult targets
for retroviral transduction. We have sought to overcome this by
stimulating these cells to divide simultaneously with their exposure to
retrovirus. The stimulating growth factor we have used is SCF, which
creates something of a paradox, as SCF is used in the 5-FU selection
process, yet it is also clear that the cells that survive selection
also express SCF receptors3 (and Fig 4).
SCF has classically been described as a survival factor rather than as
a mitogen per se,26 though SCF has been shown to induce
cycling directly in human CD34+ cells,27 and
particular attention has been drawn to its ability to synergize with
other growth factors to amplify their response.28-31 Some
lines of evidence indicate that SCF does, indeed, play a role in the
cycling of PHSC. For example, Bodine et al have shown that repopulating
cells in the mouse are highly enriched in a "kit bright"
fraction13 and that the absolute number of PHSC can be
influenced by SCF.32 Crucially, Miller et al have shown that the SCF receptor is implicated in stem-cell cycling in a competitive repopulating mouse model using W/Wv
mice.33
The murine Steel-dickie mutant provides evidence to suggest
that it is the membrane-associated form of SCF rather than the soluble
form that is vital for stem-cell function. These mice carry an
interstitial deletion that render them incapable of synthesising a
membrane-bound growth factor, whilst retaining a biologically active
soluble form. Despite this they still display an anemia that is
virtually identical to those animals that bear complete deletions of
the SCF gene.11,34 The membrane-bound growth factor has
also been shown to support early hematopoiesis more effectively than
the soluble growth factor both with cell lines35 and with cultured primary murine marrow.12 Indeed, an increased
level of retroviral gene transfer to rhesus monkey PHSC has been
reported using membrane-bound SCF in a system similar to our
own.36 One potentially crucial difference, however, is that
these authors chose to modify a murine stromal cell line (derived from
a steel mouse), thus losing any benefit of delivering
retrovirus from the same cells as those stimulating growth.
Additionally, stromal cells might be expected to exert potent
inhibitory effects on stem-cell cycling, as in the normal stromal
environment stem cells are predominantly quiescent.
Other investigators have been able to highlight the greater potency and
longer lasting effects of the membrane-bound growth factor on target
cells.37 This may originate from the fact that SCF
receptors are rapidly internalized and only replaced by de novo protein
synthesis,38 a process that may be much less efficient when
the growth factor is itself anchored.
Whether SCF is capable on its own of inducing G0 stem cells
to cycle remains unclear. A significant factor in the context of the
experiments described here is the IL-6 known to be produced by
retroviral packaging cell lines.39 The effects of murine IL-6 production could possibly account for the variable background level of transduction seen in the absence of SCF, though this is hardly
consistent with the poor levels of gene transfer to PHSC seen by
others, where recombinant IL-6 has often been included as a stimulatory
factor. In addition, we have not performed transduction experiments
under serum-free conditions, which still leaves open the possibility
that the membrane-bound SCF is interacting with cytokines, known or as
yet unknown, present in serum. We are continuing to refine the
transduction protocol to reliably achieve higher levels of gene
transfer to 5-FU-resistant cells but hope that the levels observed
thus far still represent a step further on the road to gene therapy for
disorders necessitating gene transfer to PHSC.
| |
ACKNOWLEDGMENT |
Our thanks to Prof Sunitha Wickramasinghe and Dr Vivien Hodges for
their appraisal of this manuscript. Thanks also to Immunex Corp
(Seattle, WA) for making available the SCF cDNA, Prof David Linch (UCL)
for the kind gift of IL-3, to Prof Mary Collins (UCL) for supplying the
AM12 packaging line, and to Profs Jacques and Antoinette Hatzfeld for
the STEMGEM and advice on long-term culture.
| |
FOOTNOTES |
Submitted April 6, 1998;
accepted July 25, 1998.
Supported by the Medical Research Council, the Birth Defects
Foundation, and the Chronic Granulomatous Disorder Research Trust.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Colin Casimir, PhD, Department
of Haematology, Imperial College School of Medicine, St Mary's Campus,
Norfolk Place, London W2 1PG, UK; e-mail: c.casimir{at}ic.ac.uk.
| |
REFERENCES |
1.
van Beusechem VW, Bart Baumeister JA, Bakx TA, Kaptein LC, Levinsky RJ, Valerio D:
Gene transfer into nonhuman primate CD34+CD11b- bone marrow progenitor cells capable of repopulating lymphoid and myeloid lineages.
Hum Gene Ther
5:295, 1994[Medline]
[Order article via Infotrieve]
2.
Dunbar CE, Cottler Fox M, O'Shaughnessy JA, Doren S, Carter C, Berenson R, Brown S, Moen RC, Greenblatt J, Stewart FM, et al:
Retrovirally marked CD34-enriched peripheral blood and bone marrow cells contribute to long-term engraftment after autologous transplantation.
Blood
85:3048, 1995[Abstract/Free Full Text]
3.
Berardi AC, Wang A, Levine JD, Lopez P, Scadden DT:
Functional isolation and characterization of human hematopoietic stem cells.
Science
267:104, 1995[Abstract/Free Full Text]
4.
Miller DG, Adam MA, Miller AD:
Gene transfer by retrovirus vectors occurs only in cells that are actively replicating at the time of infection.
Mol Cell Biol
10:4239, 1990[Abstract/Free Full Text]
5.
Roe T, Reynolds TC, Yu G, Brown PO:
Integration of murine leukemia virus DNA depends on mitosis.
EMBO J
12:2099, 1993[Medline]
[Order article via Infotrieve]
6.
Blaese RM, Culver KW, Miller AD, Carter CS, Fleisher T, Clerici M, Shearer G, Chang L, Chiang Y, Tolstoshev P, et al:
T lymphocyte-directed gene therapy for ADA-SCID: Initial trial results after 4 years.
Science
270:475, 1995[Abstract/Free Full Text]
7.
Bordignon C, Notarangelo LD, Nobili N, Ferrari G, Casorati G, Panina P, Mazzolari E, Maggioni D, Rossi C, Servida P, et al:
Gene therapy in peripheral blood lymphocytes and bone marrow for ADA-immunodeficient patients.
Science
270:470, 1995[Abstract/Free Full Text]
8.
Kohn DB, Weinberg KI, Nolta JA, Heiss LN, Lenarsky C, Crooks GM, Hanley ME, Anette G, Brooks JS, El Khoureiy A, Lawrence K, Wells S, Moen RC, Bastian J, Williams Herman DE, Elder M, Wara D, Bowen T, Hershfield MS, Mullen C-A, Blaese RM, Parkman R:
Engraftment of gene-modified umbilical cord blood cells in neonates with adenosine deaminase deficiency.
Nat Med
1:1017, 1995[Medline]
[Order article via Infotrieve]
9.
Zsebo KM, Williams DA, Geissler EN, Broudy VC, Martin FH, Atkins HL, Hsu RY, Birkett NC, Okino KH, Murdock DC, et al:
Stem cell factor is encoded at the Sl locus of the mouse and is the ligand for the c-kit tyrosine kinase receptor.
Cell
63:213, 1990[Medline]
[Order article via Infotrieve]
10.
Williams DE, de Vries P, Namen AE, Widmer MB, Lyman SD:
The Steel factor.
Dev Biol
151:368, 1992[Medline]
[Order article via Infotrieve]
11.
Cheng HJ, Flanagan JG:
Transmembrane kit ligand cleavage does not require a signal in the cytoplasmic domain and occurs at a site dependent on spacing from the membrane.
Mol Biol Cell
5:943, 1994[Abstract]
12.
Toksoz D, Zsebo KM, Smith KA, Hu S, Brankow D, Suggs SV, Martin FH, Williams DA:
Support of human hematopoiesis in long-term bone marrow cultures by murine stromal cells selectively expressing the membrane-bound and secreted forms of the human homolog of the steel gene product, stem cell factor.
Proc Natl Acad Sci U S A
89:7350, 1992[Abstract/Free Full Text]
13.
Orlic D, Fischer R, Nishikawa S, Nienhuis AW, Bodine DM:
Purification and characterization of heterogeneous pluripotent hematopoietic stem cell populations expressing high levels of c-kit receptor.
Blood
82:762, 1993[Abstract/Free Full Text]
14.
Fleischman RA:
From white spots to stem cells:the role of the Kit receptor in mammalian development.
Trends Genet
9:285, 1993[Medline]
[Order article via Infotrieve]
15.
Brannan CI, Lyman SD, Williams DE, Eisenman J, Anderson DM, Cosman D, Bedell MA, Jenkins NA, Copeland NG:
Steel-Dickie mutation encodes a c-kit ligand lacking transmembrane and cytoplasmic domains.
Proc Natl Acad Sci U S A
88:4671, 1991[Abstract/Free Full Text]
16.
Anderson DM, Williams DE, Tushinski R, Gimpel S, Eisenman J, Cannizzaro LA, Aronson M, Croce CM, Huebner K, Cosman D, et al:
Alternate splicing of mRNAs encoding human mast cell growth factor and localization of the gene to chromosome 12q22-q24.
Cell Growth Differ
2:373, 1991[Abstract]
17.
Markowitz D, Goff S, Bank A:
Construction and use of a safe and efficient amphotropic packaging cell line.
Virology
167:400, 1988[Medline]
[Order article via Infotrieve]
18.
Thrasher A, Chetty M, Casimir C, Segal AW:
Restoration of superoxide generation to a chronic granulomatous disease-derived B-cell line by retrovirus mediated gene transfer.
Blood
80:1125, 1992[Abstract/Free Full Text]
19.
Callard RE, Kotowicz KT, Smith SH:
Assays for human B cell responses to cytokines, in
Balkwill FR
(ed):
Cytokines: A Practical Approach. Oxford, UK, IRL, 1995, p 143.
20.
Tajima Y, Onoue H, Kitamura Y, Nishimune Y:
Biologically active kit ligand growth factor is produced by mouse Sertoli cells and is defective in SId mutant mice.
Development
113:1031, 1991[Abstract]
21.
Orlic D, Bodine DM:
What defines a pluripotent hematopoietic stem cell (PHSC): will the real PHSC please stand up! [editorial].
Blood
84:3991, 1994[Free Full Text]
22.
Porter CD, Parkar MH, Collins MK, Levinsky RJ, Kinnon C:
Efficient retroviral transduction of human bone marrow progenitor and long-term culture-initiating cells: partial reconstitution of cells from patients with X-linked chronic granulomatous disease by gp91-phox expression.
Blood
87:3722, 1996[Abstract/Free Full Text]
23.
Hoogerbrugge PM, von Beusechem VW, Kaptein LC, Einerhand MP, Valerio D:
Gene therapy for adenosine deaminase deficiency.
Br Med Bull
51:72, 1995[Abstract/Free Full Text]
24.
Xu LC, Kluepfel Stahl S, Blanco M, Schiffmann R, Dunbar C, Karlsson S:
Growth factors and stromal support generate very efficient retroviral transduction of peripheral blood CD34+ cells from Gaucher patients.
Blood
86:141, 1995[Abstract/Free Full Text]
25.
Brenner MK, Cunningham JM, Sorrentino BP, Heslop HE:
Gene transfer into human hemopoietic progenitor cells.
Br Med Bull
51:167, 1995[Abstract/Free Full Text]
26.
Keller JR, Ortiz M, Ruscetti FW:
Steel factor (c-kit ligand) promotes the survival of hematopoietic stem/progenitor cells in the absence of cell division.
Blood
86:1757, 1995[Abstract/Free Full Text]
27.
Gore SD, Amin S, Weng LJ, Civin CI:
Steel factor supports the cycling of isolated human CD34+ cells in the absence of other growth factors.
Exp Hematol
23:413, 1995[Medline]
[Order article via Infotrieve]
28.
Li ML, Cardoso A, Sansilvestri P, Hatzfeld A, Kisselev S, Batard P, Levesque JP, Hatzfeld J:
Co-stimulatory effects of steel factor, the c-kit ligand, on purified human hematopoietic progenitors in low cell density culture.
Nouv Rev Fr Hematol
35:81, 1993
29.
Abboud MR, Xu F, Payne A, Laver J:
Effects of recombinant human Steel factor (c-kit ligand) on early cord blood hematopoietic precursors.
Exp Hematol
22:388, 1994[Medline]
[Order article via Infotrieve]
30.
Broxmeyer HE, Maze R, Miyazawa K, Carow C, Hendrie PC, Cooper S, Hangoc G, Vadhan Raj S, Lu L:
The kit receptor and its ligand, steel factor, as regulators of hemopoiesis.
Cancer Cells
3:480, 1991[Medline]
[Order article via Infotrieve]
31.
Simmons PJ, Aylett GW, Niutta S, To LB, Juttner CA, Ashman LK:
c-kit is expressed by primitive human hematopoietic cells that give rise to colony-forming cells in stroma-dependent or cytokine-supplemented culture.
Exp Hematol
22:157, 1994[Medline]
[Order article via Infotrieve]
32.
Bodine DM, Seidel NE, Zsebo KM, Orlic D:
In vivo administration of stem cell factor to mice increases the absolute number of pluripotent hematopoietic stem cells.
Blood
82:445, 1993[Abstract/Free Full Text]
33.
Miller CL, Rebel VI, Lemieux ME, Helgason CD, Lansdorp PM, Eaves CJ:
Studies of W mutant mice provide evidence for alternate mechanisms capable of activating hematopoietic stem cells.
Exp Hematol
24:185, 1996[Medline]
[Order article via Infotrieve]
34. Williams DA, Majumdar MK: Analysis of steel factor (stem cell
factor) isoforms in the hematopoietic microenvironment. Stem Cells Dayt
12 Suppl 1:67, 1994
35.
Caruana G, Ashman LK, Fujita J, Gonda TJ:
Responses of the murine myeloid cell line FDC-P1 to soluble and membrane-bound forms of steel factor (SLF).
Exp Hematol
21:761, 1993[Medline]
[Order article via Infotrieve]
36.
Bodine DM, Moritz T, Donahue RE, Luskey BD, Kessler SW, Martin DI, Orkin SH, Nienhuis AW, Williams DA:
Long-term in vivo expression of a murine adenosine deaminase gene in rhesus monkey hematopoietic cells of multiple lineages after retroviral mediated gene transfer into CD34+ bone marrow cells.
Blood
82:1975, 1993[Abstract/Free Full Text]
37.
Miyazawa K, Williams DA, Gotoh A, Nishimaki J, Broxmeyer HE, Toyama K:
Membrane-bound Steel factor induces more persistent tyrosine kinase activation and longer life span of c-kit gene-encoded protein than its soluble form.
Blood
85:641, 1995[Abstract/Free Full Text]
38.
Shimizu Y, Ashman LK, Du Z, Schwartz LB:
Internalization of Kit together with stem cell factor on human fetal liver-derived mast cells: New protein and RNA synthesis are required for reappearance of Kit.
J Immunol
156:3443, 1996[Abstract]
39.
Einerhand MP, Bakx TA, Valerio D:
IL-6 production by retrovirus packaging cells and cultured bone marrow cells.
Hum Gene Ther
2:301, 1991[Medline]
[Order article via Infotrieve]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
|
|
Top
Abstract
Introduction