|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 92 No. 11 (December 1), 1998:
pp. 4178-4187
R to Q Amino Acid Substitution in the GFFKR Sequence of the
Cytoplasmic Domain of the Integrin  IIb Subunit in a
Patient With a Glanzmann's Thrombasthenia-Like Syndrome
By
O. Peyruchaud,
A.T. Nurden,
S. Milet,
L. Macchi,
A. Pannochia,
P.F. Bray,
N. Kieffer, and
F. Bourre
From The UMR 5533 CNRS, Hôpital Cardiologique,
Pessac, France; The Division of Hematology, Department of Medicine, The
Johns Hopkins University School of Medicine, Baltimore, MD; The
Laboratoire Franco-Luxembourgeois de Recherche Biomédicale,
Centre Universitaire, Luxembourg; and The Dipartimento di Medicina ed
Oncologia Sperimentale, Sezione de Ematologia, University of
Turin, Turin, Italy.
 |
ABSTRACT |
The integrin  IIb 3 mediates platelet
aggregation through its fibrinogen and adhesive protein-binding
properties. Particular interest concerns the role of the cytoplasmic
domains of IIb and 3. We now report the
molecular analysis of IIb3 from a patient
with a Glanzmann's thrombasthenia-like syndrome for whom the principal
characteristics are an approximate 50% total platelet content of
IIb3 but with a much lower proportion in
the surface pool (Hardisty et al, Blood 80:696, 1992).
Polymerase chain reaction (PCR) single-strand conformational
polymorphism and DNA sequencing showed a heterozygous mutation giving
rise to amino acid substitution R995 to Q in the GFFKR
sequence of the cytoplasmic domain of IIb. Reverse
transcriptase-PCR and polymorphism analysis only detected mRNA for the
mutated allele of the IIb gene and a single allele of
the 3 gene in his platelets, suggesting other
unidentified defects. Site-directed mutagenesis followed by transient
expression of the mutated IIb together with wild-type
3 in Cos-7 cells resulted in a markedly decreased
expression of the complex at the cell surface when compared with cells
transfected with wild-type IIb and 3.
Flow cytometry with PAC-1 and a stable Chinese hamster ovary-transfected cell line showed that the mutated receptor was not
locked into a high activation state, although it became so in the
presence of the activating antibody, anti-LIBS6. This is the first
reported natural mutation in the highly conserved GFFKR sequence of the
IIb cytoplasmic domain.
© 1998 by The American Society of Hematology.
| |
INTRODUCTION |
GLANZMANN'S THROMBASTHENIA is an
inherited bleeding disorder in which quantitative or qualitative
defects of the fibrinogen receptor, IIb3
(the platelet glycoprotein [GP] IIb-IIIa complex), result in the
absence of the aggregation response after platelet activation.1-3 A member of the integrin family,
IIb3 is formed through the noncovalent
association of two subunits encoded by different genes, both of which
are localized on chromosome 17.4 Binding studies with
monoclonal antibodies (MoAbs) showed that about 50,000 copies of this
receptor are present at the surface of resting platelets.5
An internal pool of about the same size is associated with membranes of
the surface-connected canalicular system, -granules, and dense
granules.6,7 After activation of platelets by physiological
agonists such as adenosine diphosphate, a conformational change in the
surface receptor enables binding of fibrinogen (or other adhesive
proteins) and aggregation.8 With strong agonists such as
thrombin, the internal pool is also mobilized, providing more
IIb3 complexes to participate in
platelet-platelet interactions.9
Transcription of the IIb and 3 genes
occurs in megakaryocytes and the two proteins are assembled and then
glycosylated in the endoplasmic reticulum. Endoproteolytic
cleavage of IIb in the Golgi apparatus leads to the
separation of heavy and light chains which remain disulfide
bonded.10 It is the light chain that carries the
transmembrane and cytoplasmic domains of IIb. Post-translational modifications, including glycosylations and the
association of the two glycoproteins into a heterodimeric complex, are
necessary for cell-surface expression of the receptor.10,11 Molecular abnormalities described in patients with Glanzmann's thrombasthenia have provided information on structural domains essential for IIb3 complex formation and
expression. For example, two amino acid substitutions adjacent to the
first and the fourth calcium binding sites of IIb
altered the conformation of the complex and prevented its transport to
the golgi apparatus,12,13 whereas a mutation
located between the second and the third calcium binding site greatly
slowed the maturation kinetics.14 Further information on
the functional domains of the complex have been provided by studies on
variant forms of the disease. Thus, mutations in the extracellular
domain of 3 are associated with a failure of the
constituted complex to bind fibrinogen when stimulated and a mutation
in the cytoplasmic domain of 3 leads to defective "inside-out" signaling.15-17
We now report the molecular analysis of
IIb3 from a patient with an atypical form
of Glanzmann's thrombasthenia. As we previously reported, the
patient's platelets were characterized by (1) a total platelet
IIb3 content of less than 50% of normal
levels and (2) an altered partition of the residual
IIb3 receptor within the different
platelet membrane systems.18 Only approximately 15% of the
normal levels of this receptor was found at the platelet surface,
although the internal pool remained substantial. The residual receptor
was functional and aggregation was observed after in vitro activation
of platelets by physiological agonists, although the kinetics were slow
and only small aggregates formed. The patient's platelets did not bind
fibrinogen spontaneously. Among the abnormalities that we have found
for this patient is a heterozygous point mutation, G to A located at
nucleotide 3078 of the cDNA (numbering according to Frachet et
al19), leading to an R995 to Q amino acid
substitution in the IIb cytoplasmic domain. Site-directed mutagenesis and transient expression in Cos-7 cells showed that the mutation was likely to be directly involved in the low
surface expression on his platelets. In view of the purported role of
the cytoplasmic domains of IIb and 3 in
controlling the activation state of the complex,20,21 we
also prepared a stable transfected Chinese hamster ovary (CHO) cell
line expressing the mutated receptor. Flow cytometry showed that the
cells only bound appreciable amounts of PAC-1, a marker of the
activated complex,22 in the presence of an
IIb3-activating antibody.
This is the first time that a mutation in the cytoplasmic domain of
IIb has been reported in Glanzmann's thrombasthenia. The interest of the R995 to Q substitution and the reduced
cell-surface expression of IIb3 is
reinforced by its location in the GFFKR sequence which is conserved in
the cytoplasmic domain of all integrin subunits.
| |
MATERIAL AND METHODS |
Case Report
The case report and specific features that characterize the platelets
of patient A.P., a young Italian man, were given by Hardisty et
al.18 His father (F.P.) and mother (M.P.) were also studied. There is no evidence of consanguinity and no family history of
bleeding. However, the patient has suffered from occasional bleeding
since early childhood although blood transfusion has never been
performed. Bleeding mostly occurred after knocks or small trauma and
was not spontaneous. As detailed earlier, the main features of A.P.'s
platelets are a total IIb3 content that is about half that observed with normal platelets yet with a surface expression that is sparse compared with the size of the internal pool.18 The platelet aggregation response is poor but not
absent and this is why he was originally referred to as having a
"thrombasthenia-like" syndrome. His unactivated
platelets did not bind fibrinogen spontaneously. Platelets from his
parents aggregated normally, although the number of
IIb3 receptors, as determined in
MoAb-binding studies, was lower than is usually seen: approximately
28,000 for his father's platelets and approximately 20,000 for his
mother's platelets.18 Control donors were adult members of
our hospital staff. Informed consent was obtained.
Polymerase Chain Reaction-Single-Strand Conformational Polymorphism
(PCR-SSCP) and DNA Sequencing
Genomic DNA from the propositus, both parents and healthy volunteers,
was isolated from whole blood using the QIAmp blood kit (Qiagen,
Chatsworth, CA) according to the manufacturer's instructions. A total
of 43 pairs of oligonucleotides allowed the amplification of each exon
together with the intronic splicing signals. After 30 cycles of
amplification, an aliquot of each product was loaded onto a
2% agarose gel.23 After electrophoresis, bands were
visualized under ultraviolet light after ethidium bromide coloration.
SSCP analysis was performed using the Pharmacia Phast System and
precast minigels (Pharmacia-Biotech, Saint-Quentin en Yvelines, France)
as we previously described.23-25 The oligonucleotide
primers for amplifying exon 3 of the 3 gene and exons 21 and 26 of the IIb gene are given
elsewhere.23,24 Genotyping for the HPA-1 and HPA-3
alloantigen systems was performed using an Allele-Specific Restriction
Assay (ASRA) as previously described (also see below).23,24 The primers used to amplify exon 30 of the IIb gene were
5 CAGCAAATCATCTGTATACCCT3 (sense,
hybridizing in intron 29) and
5 CCCAAAGCTTGGAGGCAACT3 (antisense,
hybridizing downstream of exon 30). DNA amplification products
exhibiting an altered migration pattern in the SSCP analysis were
directly sequenced using a fentomol DNA sequencing kit (Promega-France, Lyon, France). To ensure that those mutations detected in heterozygous form were not artifacts of the sequencing methodology, we cloned the
corresponding amplification products into the pGem-T vector (Promega-France) and sequenced 12 independent clones using the T7
Sequencing kit (Pharmacia-Biotech).
Transfection of Cos-7 Cells and Transient Expression of
Recombinant
IIb3
Site-directed mutagenesis was performed as before,25 using
the pALTER-1 Vector system (Promega-France) in which we had previously cloned wild-type cDNA for IIb. A
CTTCAAGCAGAACCGGC oligonucleotide was used to generate the
IIb mutation (the mutated base is indicated in bold
case). After selection, full-length cDNAs were entirely sequenced to be
certain that only the desired mutations were present. Wild-type or
mutated cDNAs for IIb and 3 were
subcloned between EcoRI and HindIII sites of the
eukaryotic expression vector pSM as we previously
constructed.25 Cos-7 cells, cultivated in Dulbecco's modified Eagle's medium (Life Technologies, Cergy-Pontoise, France) supplemented with 7% fetal calf serum, were transfected as follows: 3 × 105 cells per 3.5-cm petri dish were seeded 24 hours before transfection which was performed during 4 hours with 3 µg of one plasmid or 1.5 µg of each plasmid (one carrying
IIb cDNA and the other 3 cDNA) and Transfectam
(Promega-France) according to the manufacturer's conditions. Surface
membrane expression of IIb3 was analyzed by flow cytometry and total cell expression by Western blotting, both
after 72 hours of culture.
In some experiments, Cos-7 cells were also cotransfected with pSV-
plasmid (Promega) coding for -galactosidase. Transfection efficiency
was measured on a fraction of the cells using an
anti--galactosidase MoAb (Promega) after cell permeabilization
using the Fix and Perm Cell Permeabilization Kit (Caltag
Laboratories, Burlingame, CA) and flow cytometry.
Flow cytometry.
Cos-7 cells were harvested after a 10-minute incubation at room
temperature after the addition of phosphate-buffered saline (PBS)
containing 5 mmol/L EDTA. The cells were washed twice with PBS-0.1%
(wt/vol) bovine serum albumin (BSA) and counted. Volumes (0.5 mL)
containing 400,000 cells in PBS-0.1% BSA was then incubated for 30 minutes under saturating conditions with EDU-3, an MoAb specific for
the IIb3 complex (a gift from Dr Villela,
Barcelona, Spain); SZ22 (Immunotech, Marseille, France), specific for
IIb; or XIIF9 (prepared by our laboratory), specific for
3. Cells were washed twice with PBS-0.1% BSA before
being incubated for 30 minutes in 0.5 mL PBS-BSA containing fluorescein
isothiocyanate (FITC)-conjugated F(ab)2 antibody to mouse
IgG (Silenius Laboratories, Hawthorn, Australia) and analyzed after
another round of centrifugation using a Becton-Dickinson FACscan
(Becton-Dickinson, Le Pont de Claix, France).25 In each
experiment 10,000 cells were counted across the laser. The limit of
positivity was defined as the maximum observed fluorescence when Cos-7
cells were transfected by the expression vector alone.
Western blotting.
Transfected Cos-7 cells were obtained as described above, sedimented,
and resuspended in 50 µL of 10 mmol/L Tris-HCl, pH 7, containing 150 mmol/L NaCl, 3 mmol/L EDTA, and 2% (wt/vol) sodium dodecyl sulfate
(SDS). Samples (50 µg) were loaded onto a 7% polyacrylamide gel and
the proteins separated by electrophoresis before transfer to
nitrocellulose membrane as described.26 The membranes were saturated for 2 hours with 5% (wt/vol) nonfat dry milk in 20 mmol/L Tris-HCl, 150 mmol/L NaCl, 0.05% (vol/vol) Tween 20, pH 7. After five
washes in washing buffer (0.5% nonfat dry milk, 20 mmol/L Tris-HCl,
150 mmol/L NaCl, 0.05% Tween 20, pH 7), membranes were incubated for 2 hours with the murine MoAb XIIF9, specific for 3, or SZ
22, specific for IIb. After five washes, membranes were
incubated for 1 hour with peroxydase-coupled goat antibody to murine
IgG (Jackson ImmunoResearch, West Grove, PA) and bound MoAb revealed
using a chemiluminescence procedure (Amersham-France, Courtaboeuf,
France). In each experiment, 1 µg of SDS-soluble proteins from
platelets of a normal donor were electrophoresed as a control.
Transfection of CHO Cells and Evaluation of PAC-1 Binding
Wild-type and mutated IIb cDNAs were subcloned into the
pCDN( ) expression vector (Invitrogen, San Diego, CA) between
EcoRI and HindIII restriction sites. A previously
characterized CHO cell line stably expressing the 3
subunit was transfected using pCDN wild-type or mutated
IIb cDNA using lipofectamine as previously described.27 Briefly, after neomycin selection, cell
membrane expression of IIb3 was assessed
using MoAbs P2 and EDU-3, both specific for the
IIb3 complex. A stable cell line
maximally expressing the mutated IIb3 was
subcloned. The affinity state of the complex was analyzed in these
cells using FITC-labeled PAC-1 (Becton-Dickinson), a murine IgM
specific for the activated complex.22 GP IIb-IIIa
expression was controlled using PerCP-conjugated anti-3
(Becton-Dickinson) detected with an FL3 threshold gate as recommended
by the manufacturer. In each experiment, 4 × 105
cells were incubated for 45 minutes in the presence of FITC-PAC-1 (15 µL of the solution provided by the manufacturer) with or without 2 µmol/L of the MoAb anti-LIBS6 (a generous gift of Dr Mark Ginsberg, Scripps Research Institute, La Jolla, CA) as described.28
Anti-LIBS6 is an activating MoAb that binds directly to the complex.
Binding of PAC-1 was then assessed by flow cytometry, and 5,000 cells were analyzed. Results for the subcloned cell line expressing the
mutated complex were compared with those obtained for CHO cells
transfected with wild-type IIb3. The
specificity of PAC-1 binding was also assessed in the presence of 1 mmol/L RGDS peptide (Sigma Chemical Co, St Louis, MO). On
occasion, results were expressed as the activation index (AI) defined
as 100 × (Fo Fr)/(Fo
LIBS6 Fr LIBS6), where Fo is the median
fluorescence intensity (MFI) of PAC-1 binding and Fr is the
MFI of PAC-1 binding in the presence of RGDS. Fo LIBS6 is
the MFI of PAC-1 binding in the presence of 2 µmol/L of this antibody
and Fr is the MFI of PAC-1 binding in the presence of
anti-LIBS6 and the competitive inhibitor.20
Reverse Transcriptase (RT)-PCR on Platelet mRNA
RT-PCR was performed on platelet lysates from the patient, his father,
and his mother prepared according to a procedure we recently
described.29 Genotyping of HPA-1 (PlA) and HPA-3 (Bak) systems was performed on PCR products amplified as already
described30,31 and using HpaII and FokI
restriction enzymes, respectively. A TaqI polymorphism was
determined using the TaqI restriction enzyme.32 Mutations located in exon 30 of the IIb gene were
determined both after direct sequencing of amplification products and
after cloning and sequencing amplification products from cDNAs. In this case, 12 independent clones were sequenced for each family member using
a T7 sequencing kit (Pharmacia-Biotech).
| |
RESULTS |
PCR-SSCP on Genomic DNA Together With Sequence Analysis
We designed 43 pairs of oligonucleotides allowing the specific
amplification of all exons including splice sites of both the IIb and 3 genes, and developed a
nonradioactive SSCP procedure to analyze each amplification product.
For the patient (A.P.), 4 out of 43 DNA amplification products showed a
SSCP profile different to that observed for the control. Three of the
observed differences in the SSCP patterns were caused by known
polymorphisms (Fig 1A). The first of these
involved exon 3 of the 3 gene and was due to the HPA-1
polymorphism.23 As summarized in
Table 1, the SSCP patterns for this exon
showed that the patient and his father were heterozygous HPA-1a/HPA-1b,
whereas his mother was homozygous HPA-1a/HPA-1a. ASRA performed using
HpaII confirmed these genotypes. In the same manner, the
differences observed for the SSCP patterns for amplification products
carrying exons 21 and 26 of the IIb gene (Fig 1A) were
caused by two polymorphisms that we have previously described as being
bilaterally linked: HPA-3 and a 9-bp deletion (Del) in intron
21.24 SSCP analysis showed that both A.P. and his mother
were heterozygous HPA-3a/HPA-3b and
Del /Del+,whereas his father was
homozygous for the HPA-3a and Del polymorphisms
(Table 1). Genotyping for HPA-3 was confirmed using the FokI
restriction enzyme.
View larger version (43K):
[in this window]
[in a new window]
| Fig 1.
PCR-SSCP analysis of the IIb
and 3 genes. PCR amplification products were
submitted to SSCP analysis by electrophoresis on the minigels of the
PhastSystem apparatus and the migrated products detected by silver
staining. (A) Only the amplification product for exon 3 of the
3 gene of patient A.P. exhibited a different migration
profile to the control (C); this corresponded to the HPA-1 genetic
determinant, the control being HPA-1a/HPA-1a and the patient being
HPA-1a/HPA-1b. For the IIb gene, three amplification
products had different patterns when compared with the control. For
amplification product 21, this corresponded to a previously described
polymorphism (Noted Del+ and Del) in
intron 21. Amplification product 26 corresponded to the HPA-3 system,
the control being HPA-3a/HPA-3a and the patient being HPA-3a/HPA-3b.
(B) SSCP analysis of amplification product 30 of the IIb
gene showed a previously undescribed pattern. Illustrated are the
patterns obtained for the patient (A.P.), a control, his father, and
his mother. Band a was present for the control and the two parents,
band b for A.P. and his mother, and band c for A.P. and his father.
|
|
In contrast to these results, the pattern observed for the
amplification product carrying exon 30 of the IIb gene
of the propositus was new to us (Fig 1B). Up to now, no polymorphism has been reported in this region of the IIb gene. As is
shown in Fig 1B, not only was the SSCP pattern for this amplification product different for the patient, but it was also different for both
parents. In summary, band a was present for the control and for both
parents but absent for the patient (A.P.), band b was present only for
the propositus and his mother, and band c was restricted to the
propositus and his father (F.P.). Direct DNA sequencing of PCR products
showed that the differences between A.P. and the control were in fact
due to two different base pair substitutions. The patient was
heterozygous for both substitutions, the first, a C to T change in
position 3064 of the cDNA, and the second, a G to A change in position
3078 of the cDNA (Fig 2). These mutations
were detected in a heterozygous state in his parent's DNA; the first
was possessed by his mother and the second by his father (data not
shown). Although the C to T transition did not induce an amino acid
change, the G to A transition inherited from his father led to an amino
acid substitution, R to Q in position 995 of the IIb
protein. Significantly, this amino acid substitution was located in the
GFFKR sequence conserved in all cytoplasmic tails of integrin subunits (see Discussion).
View larger version (57K):
[in this window]
[in a new window]
| Fig 2.
Direct DNA sequencing of amplification product 30 of the
IIb gene for the control and for the patient (A.P.). Two
detected heterozygous mutations are indicated in open squares and the
corresponding amino acid sequence and the substitution R995
to Q are noted with bold letters.
|
|
Expression of Recombinant DNA in Cos-7 Cells
The G to A change responsible for the R to Q substitution in position
995 was introduced into wild-type IIb cDNA by
site-directed mutagenesis. After DNA sequencing to ensure that only
this alteration was present, and subcloning into the eukaryotic
expression vector pSM, Cos-7 cells were cotransfected with wild-type
3 cDNA and wild-type or mutated IIb cDNA.
Cell-surface expression of the complex was analyzed by flow cytometry
72 hours later. Using EDU3, an MoAb specific for the
IIb3 complex, the percentage of positive Cos-7 cells was 13% when cotransfected with the two wild-type cDNAs
and 5.6% for cells cotransfected with wild-type 3 cDNA and mutated IIb cDNA (Fig
3). In the illustrated experiment, the MFI for positive cells
expressing complexes composed of mutated IIb and
wild-type 3 was 192, a value that was considerably lower than the MFI of 422 observed for cells expressing the wild-type complex
(these results were typical of those obtained in three separate
experiments). Similar findings were also obtained using XIIF9, an MoAb
specific for the 3 subunit (data not shown).
Nevertheless, because the definition of the limit of positivity was
established as the maximum observed fluorescence when Cos-7 cells were
transfected by the expression vector alone, we cannot exclude that some
cells expressing a low surface IIb3
density in the transfection experiments remained in this zone. Results
were comparable when using preparations of DNA from three different
clones, one of them from an independent construction. To eliminate the
possibility of a different transfection efficiency, we used an internal
standard to control this parameter. Using pSV- coding for
-galactosidase and MoAb against this protein, flow cytometry showed
similar transfection efficiencies in permeabilized cells expressing
wild-type or mutated complexes. Therefore, surface IIb3 expression seems to be directly
influenced by the R995 to Q amino acid substitution in the
IIb subunit.
View larger version (15K):
[in this window]
[in a new window]
| Fig 3.
Detection of the IIb3
complex at the Cos-7 cell surface using flow cytometry. Surface
expression of the IIb3 complex was
analyzed using EDU-3, an MoAb specific for the complex, and an
anti-mouse IgG coupled to FITC as described in Materials and Methods.
Fluorescence intensity (log) is on the abscissa and forward scatter
constitutes the ordinate. The limit of positivity is represented by a
vertical bar and was defined as described in Materials and Methods. The
percentage of positive cells corresponded to the percentage of cells
where fluorescence was above this limit and was determined for 10,000 cells analyzed for each transfection.
|
|
Western blotting was performed on lysates from transfected Cos-7 cells
to further ensure that the lower expression of the mutated complex at
the cell surface was not caused by a lower synthesis of one of the two
proteins. As shown in Fig 4,
IIb and 3 subunits were present at
approximately the same level in Cos-7 cells after cotransfection of
wild-type 3 cDNA and wild-type or mutated
IIb cDNA. The low molecular weight product detected with
SZ22 for mutated IIb was not observed in all experiments and was not observed when Western blotting was performed on the patient's platelets.18
View larger version (31K):
[in this window]
[in a new window]
| Fig 4.
Analysis of IIb and 3
proteins in Cos-7 cells by immunoblotting. Fifty micrograms of proteins
from each cell lysate transiently cotransfected with wild-type
3 and wild-type or mutated IIb as
indicated were separated on 7% polyacrylamide gels without disulfide
reduction and transferred to nitrocellulose membrane. One microgram of
protein from normal platelets was used as a positive control; mock
refers to cells transfected with expression vector alone. An MoAb
specific for IIb (SZ22) and an MoAb specific for
3 (XIIF9) were used.
|
|
PAC-1 Binding to Transfected CHO Cells
A CHO cell line stably expressing the 3 subunit was
transfected using pCDN wild-type or mutated IIb cDNA.
After neomycin selection, evaluation of the surface expression of
IIb3 again showed a low surface
expression of the mutated complex (data not shown). Replating under
conditions of limiting dilution was followed by the selection of a
clone that expressed the mutated IIb3 complex in readily measurable levels. Binding of PAC-1 to these cells
and to a stable CHO cell line containing wild-type IIb and 3 is shown in Fig 5.
Little or no binding was observed to either cell line, indicating that
the mutated complex was not in a high-affinity state. At the same time,
greater than 95% of the cells bound PerCP-conjugated
anti-3 or either of the MoAbs P2 or EDU-3 (anti-GP
IIb-IIIa complex, data not shown). In contrast, incubation of cells
expressing both the wild-type and the mutated complex with the
activating MoAb, anti-LIBS6, induced the binding of PAC-1 (Fig 5). In
other words, the mutated complex was only able to bind PAC-1 after
activation. This result is in agreement with the previously reported
observation that platelets of patient A.P. did not spontaneously bind
fibrinogen but bound this adhesive protein after
activation.18 The anti-LIBS6-induced binding of PAC-1 was
not observed in the additional presence of 1 mmol/L RGDS, a competitive
inhibitor of PAC-1 for IIb3 (not
illustrated). Hughes et al20 have expressed the activation
state of IIb3 as the AI (see Materials
and Methods). Typical results for the CHO line expressing
IIb3 with IIb (R995Q)
showed the AI to be 23, whereas that obtained for the wild-type
IIb3 was 8. The ratio for AI 995Q/AI
wild-type was therefore of the order of 3, whereas the corresponding
ratio given by Hughes et al20 for 995A/wild-type was of the
order of 10 (see Discussion).
View larger version (20K):
[in this window]
[in a new window]
| Fig 5.
Determination of the activation state of the mutated
IIb3 complex in a stable CHO cell line
using flow cytometry. Cells stably transfected with wild-type
3 and wild-type IIb or wild-type
3 and mutated IIb were incubated with
FITC-PAC-1 in the presence or absence of 2 µmol/L anti-LIBS6 as
detailed in Materials and Methods. Log of the fluorescence is on the
abscissa and the number of cells examined is on the ordinate. A total
of 5,000 cells were analyzed. PAC-1 binding was assessed in the
presence ( ) or absence ( ) of 1 mmol/L RGDS peptide as shown. Note
that PAC-1 binding requires the presence of the activating MoAb and was
inhibited by RGDS.
|
|
RT-PCR on Platelet RNA
The mutation leading to the R to Q amino acid substitution was present
in a heterozygous state in the patient's genome and was unlikely on
its own to account for a surface expression of 15% of the complex on
his platelets.18 Because we failed to find any other
abnormality using SSCP, we next analyzed platelet mRNA. Our strategy
was to look for the genetic markers of
IIb3 (as revealed using genomic DNA) in
mRNA isolated from platelets of the patient and his parents. By using
RT-PCR and ASRA, we were able to determine if both alleles of each gene
were effectively expressed or at least present at a detectable level.
Using random oligonucleotides, we reverse transcribed platelet RNA and
with specific oligonucleotides for IIb and for
3 we amplified the appropriate regions of both cDNAs.
Figure 6 shows that mRNA carrying the
genetic determinant for HPA-1b and encoded by the 3
allele inherited from his father was undetectable in platelets from
A.P. although present in his father's platelets. Analysis of the
TaqI polymorphism carried on the 3 gene
confirmed this result (Table 1). On its own, this would explain the
lower total content of IIb3 complexes in
the patient's platelets as compared with those of his
father.18 However, mRNA carrying the HPA-3b determinant and
coded by the IIb allele inherited from his mother's
genome was also not detected in RNA isolated from platelets of the
patient. In this case, the corresponding mRNA was absent from his
mother's platelets. Study of a second polymorphism carried by the same allele, a silent C to T mutation in exon 30, confirmed these findings (Table 1). Sequencing also showed that mRNA coded by the mutated IIb allele from his father was exclusively present in
the platelets of A.P. Thus, the data which are summarized in Table 1
suggest that A.P. may have inherited from his mother an unexpressed
allele for IIb, the other IIb allele
coming from his father being mutated and giving rise to a R to Q
substitution in the highly conserved cytoplasmic GFFKR domain. The low
total IIb3 complex content in A.P.'s
platelets are therefore due to a combination of factors, one or more of
which remain to be elucidated.
View larger version (40K):
[in this window]
[in a new window]
| Fig 6.
HPA-1 and HPA-3 typing on DNA and on mRNA from platelets
from patient A.P., his mother (M.P.), and his father (F.P.). (A) SSCP
analysis was performed on genomic DNA fragments. (B) Amplified cDNA was
subjected to restriction enzyme digestion, HpaII for HPA-1 and
FokI for HPA-3. The predicted size of the products is
indicated. Analysis was performed on 10% polyacrylamide gels stained
using EtBr (see arrows). M, size markers; UD, undigested fragment.
|
|
| |
DISCUSSION |
We have described the molecular analysis of IIb and
3 from a patient with an atypical form of Glanzmann's
thrombasthenia. In their initial report on this patient, Hardisty et
al18 showed that the density of
IIb3 complexes on his platelets was
strongly decreased (approximately 15% of the normal level). However,
thrombin stimulation was followed by the appearance on the surface of a substantial internal pool of IIb3.
Although a residual aggregation response was observed with
physiological agonists, the kinetics were slower and the size of the
aggregates much smaller than usual. Fibrinogen-binding experiments
confirmed that the residual complexes were functional. This point is
perhaps reinforced by the presence of fibrinogen in the -granules of
the patient's platelets, a presence presumed to be caused by the
IIb3-dependent internalization of plasma
fibrinogen.33 To define the genetic defect responsible for
the disease, we performed an extensive analysis of the exons of the
IIb and 3 genes using nonradioactive
PCR-SSCP methodology developed in our laboratory. We found that a
heterozygous G to A mutation at nucleotide 3078 of IIb
cDNA, leading to an R995 to Q amino acid substitution in
IIb, was sufficient to decrease surface
IIb3 expression by approximately 50%
when mutated IIb was coexpressed with wild-type
3 in Cos-7 cells. Because this mutation was heterozygous
in the patient, intriguing questions were raised relating to the extent
of the observed decrease of IIb3 on the
surface of his platelets (approximately 15% of normal levels) and the
altered repartition of the integrin within the surface and internal
membrane systems.
In view of this unusual phenotype, we performed RT-PCR on platelet
extracts for the patient and both parents to determine if both alleles
of the two genes were correctly expressed. First, we found that mRNA
corresponding to the IIb allele carrying the HPA-3b
determinant and coded for by DNA from his mother and the propositus was
not detected in the platelets of either subject. Secondly, we failed to
find mRNA for the HPA-1b-containing 3 allele in the
platelets of the patient despite the fact that SSCP and genomic
analysis indicated that mRNA for this allele was present in platelets
from his father. It would be of interest to serologically type the
patient's platelets for the expression of the HPA-1a and HPA-1b
alloantigens using specific alloantibodies, but the very low level of
IIb3 at the cell surface makes this
difficult. At the present time, we tentatively conclude that additional
and so far unidentified DNA abnormalities contribute to the low or absent expression of two of the alleles. Such abnormalities could affect noncoding regions of the IIb or 3
genes (promotor sequences, for example). Alternatively, they may have
been missed by the SSCP procedure which is known to have less than a
100% detection rate, particularly when the size of the amplified
products reaches 300 bp or more.34 We also cannot exclude
the possibility of exon skipping within one or more alleles, an example
of which has been recently described.35 Whatever the cause,
it should be emphasized that only the mRNA coding for the mutated
IIb was detected in A.P. platelets, suggesting that
Q995 predominated in the IIb3
complexes that were present.
In our original report, we showed that platelets from the
patient's father (F.P.) expressed approximately 28,000 IIb3 molecules as measured using
radiolabeled AP-2 (anti-IIb3) and Tab
(anti-IIb) in direct binding studies.18 This
compared with a mean value of 37,000 molecules when
IIb3 expression was assessed on platelets from a series of 27 normal subjects using AP-2. Such a value for the
father is compatible with the presence of a wild-type
IIb allele which leads to a normal cell-surface
expression and a Q995 IIb mutated allele
leading to a reduced expression. The platelets of the mother expressed
approximately 20,000 molecules of
IIb3,18 a value compatible
with the presence of two alleles coding for 3 and one
allele coding for IIb. Nevertheless, comparing the surface IIb3 expression of individuals
within a large population of normal donors is made difficult by the
fact that numbers differ widely and that overlap can occur with
obligate heterozygotes for type I Glanzmann's disease.36
Because the only expressed allele for IIb in the
platelets of the propositus was mutated, the abnormal surface
expression compared with the internal compartment would suggest a role
for the GFFKR domain in protein trafficking. Significantly, on the
basis of our results, a subject with a homozygous expression of the
Q995 IIb mutated allele and two normally
expressed 3 alleles would possess platelets with
sufficient surface-expressed IIb3 to support platelet aggregation and for a bleeding diathesis not to be
observed (as is the situation for heterozygotes in classic Glanzmann's
thrombasthenia). Thus, the bleeding syndrome in A.P. may be related to
the special combination of defects in his case.
Much of the interest in the described amino acid substitution resides
in its location in the highly conserved GFFKR sequence found in the
cytoplasmic tail of all subunits of human integrins and in all
steroid hormone receptors (consensus sequence K×FF[K/R]R). Burns et al37 showed that overexpression of calreticulin, a calcium-binding protein present in the endoplasmic reticulum and also
in the nucleus, inhibited glucocorticoid response-mediated transcriptional activation of a glucocorticoid-sensitive reporter gene
and concluded that the binding of this protein to the GFFKR sequence
maintained the receptor in a low-affinity state. These observations are relevant, because O'Toole et al38 showed
that a deletion mutant in which IIb3
lacked the bulk of the cytoplasmic tail of the IIb
subunit (they retained two amino acids adjacent to the transmembrane
domain) was in a high activation state able to bind ligand (fibrinogen)
directly when expressed in a CHO cell line. O'Toole et
al39 then showed that replacement of the IIb
cytoplasmic tail by the 5 cytoplasmic tail gave rise to
a IIb3 chimeric receptor in a high
activation state. This suggested that factors other than the GFFKR
sequence per se influenced the shift from a low to a high activation
state. Nonetheless, it was suggested that the GFFKR sequence could
influence the interaction between the - and -subunit
transmembrane peptides, and ultimately, the conformation of the
extracellular domains. Kassner et al40 showed that
replacement of the cytoplasmic tail of the 4 integrin by
a cytoplasmic tail from other subunits did not alter the affinity
state and that the effects of any change were influenced by the cell
type. In contrast, Utsumi et al41 showed that truncation of
the 4 integrin subunit before the GFFKR sequence
abolished 41 cell-surface expression.
Kassner et al42 then showed that a deletion just after this
sequence did not prevent expression but induced a much less active
receptor. It was suggested that the affinity state may be regulated by
the five to seven amino acids after the GFFKR sequence.
In terms of these data, patient A.P., who represents the first example
of a mutation in the GFFKR region being detected in an inherited
disease, represents a natural model for studying the role of this
sequence in controlling the activation state of
IIb3. Initial experiments with Cos-7
cells transfected with IIb3 containing
IIb (R995Q) confirmed that the mutation results in a
lower cell-surface expression of the complex. Then, experiments with a
stable CHO cell line transfected with
IIb3 containing IIb
(R995Q) showed that the mutated complex was not in a high activation
state but remained functional in that activation could be induced by
the anti-LIBS6 antibody. Recently, two opposing studies were published
on this subject. Low et al21 showed that transfection of
Epstein-Barr virus-transformed B lymphocytes with wild-type
3 and IIb truncated proximal to the GFFKR
region led to a reduced expression of the mutated
IIb3 complex. These authors further
showed (1) that the IIb tail was not required for
IIb3 function and (2) that substitution
of the GFFKR sequence by AAAAA resulted in an almost total loss of
IIb3 cell-surface expression because of
an impairment in the ability of IIb to associate with 3. Nevertheless, replacement of GFFKR by AAAAA gave rise
to a complex which enabled the transfected lymphocytes to more easily adhere to fibrinogen when expressed at the lymphocyte cell surface. In
contrast, Hughes et al20 reported that substitution of F, F, or R in the GFFKR sequence of the |
Top
Abstract
Introduction