|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 92 No. 11 (December 1), 1998:
pp. 4212-4219
Interleukin-6 (IL-6) Prevents Activation-Induced Cell Death:
IL-2-Independent Inhibition of Fas/fasL Expression and Cell Death
By
Emira Ayroldi,
Ornella Zollo,
Lorenza Cannarile,
Francesca D'
Adamio,
Ursula Grohmann,
Domenico V. Delfino, and
Carlo Riccardi
From the Pharmacology Section, the Department of Clinical and
Experimental Medicine and the Department of Experimental Medicine,
University of Perugia, Perugia, Italy.
 |
ABSTRACT |
Triggering of the TCR/CD3 complex with specific antigen or anti-CD3
monoclonal antibody initiates activation-induced cell death (AICD) in
mature T cells, an effect also mediated by the Fas/FasL system. We have
previously shown that CD2 stimulation rescues T cells from
TCR/CD3-induced apoptosis by decreasing the expression of Fas and FasL.
In the present study, we examined whether the endogenous production of
IL-2 plays a role in the effects mediated by CD2 triggering. The
results indicated that transcription of Fas/FasL is controlled by
interleukin-2 (IL-2) production and that CD2 triggering rescues a
T-cell hybridoma from AICD via decreased production of IL-2. To
ascertain whether modulation of IL-2 may be a general mechanism of AICD
control, we examined other stimuli, capable of modulating the
expression of the Fas/FasL system and the ensuing AICD, for ability to
affect production of IL-2. We found that IL-6 reduced the level of
TCR/CD3-induced apoptosis and the expression of Fas/FasL, yet failed to
inhibit IL-2 production. Because IL-2 is involved in both apoptosis and activation events, these results indicate that, in contrast to CD2,
which inhibits apoptosis and T cell activation, IL-6 inhibits apoptosis
but not IL-2-induced activation. These observations may provide the
basis for differential control of T-cell activation and apoptosis.
© 1998 by The American Society of Hematology.
| |
INTRODUCTION |
LIGATION OF THE TCR/CD3 complex of
primary T cells by antigen peptides or monoclonal antibody (MoAb) to
TCR/CD3 triggers a series of activation events, eventually leading to
cell proliferation and cytokine production.1 In contrast,
TCR/CD3 stimulation of previously activated T cells or T-cell
hybridomas will induce apoptosis. This event has been termed
activation-induced cell death (AICD).2 AICD is also
mediated by the Fas/FasL system.3-5 Fas/APO-1 (CD95) is a
type I membrane protein of the tumor necrosis factor (TNF)/nerve growth
factor (NGF) receptor family,6,7 and FasL is a type II
membrane protein belonging to the tumor necrosis factor (TNF)
family.8,9 Binding of FasL to its receptor or agonist
anti-Fas MoAb induces apoptosis.3-7 Anti-CD3
MoAb cross-linking induces the expression of FasL and
upregulates Fas. The engagement of Fas by FasL activates the cell death
program.3-5,10
Clonal activation and/or expansion are controlled by a balance
between apoptotic and activating signals. It has been proposed that
AICD serves a role in limiting the expansion of an immune response by
eliminating lymphocytes that are no longer needed.10 However, previously activated T cells are susceptible to Fas-mediated apoptosis, but in vitro stimulation induces AICD only in a portion of
these cells, resulting in clonal expansion.2-5,10 These
results suggest that the process must be controlled by additional
stimuli such as cytokines, adhesion molecules, or glucocorticoid
hormones (GCH).11-14 In particular, the role of
interleukin-2 (IL-2) is not completely understood. In fact, IL-2
rescues activated T cells from apoptosis by upregulating the expression
of apoptosis inhibitory proteins such as Bcl-2,15-19 but
recent studies have shown that IL-2 cannot prevent AICD; in fact, the
cytokine will prime T cells for TCR-activated
apoptosis.10,20-22 This pro-apoptosis mechanism, occurring
at high doses of antigen and IL-2, has been termed propriocidal regulation and may limit clonal expansion.21,23-25 This
notion is supported by the observation that IL-2-deficient animals
display overproduction of lymphocytes with uncontrolled T-cell
activation and autoimmunity.26-28
We previously showed that several stimuli, including adhesion molecules
such as CD2 and CD44, IL-4, or GCH, can modulate
AICD.11,12,14 We also established an in vitro model in
which a murine CD4+ hybridoma T-cell line, 3DO, undergoes
apoptosis after stimulation of TCR/CD3. In this model, the Fas-FasL
interaction plays a dominant role in mediating AICD.12,29
In the present study, we have tested the effects of IL-6 on apoptosis
and Fas/FasL expression. We also investigated whether changes in IL-2
production could account for the rescue of T cells from apoptosis
operated by CD2 triggering and IL-6. We found that IL-6, like CD2,
decreases anti-CD3-induced apoptosis by downregulating the expression
of Fas and FasL. However, while the effect of CD2 triggering appeared
to depend on inhibition of IL-2 production, IL-6 rescued T cells from
apoptosis via a mechanism apparently independent of the presence of
IL-2. These observations suggest that Fas/FasL expression and T-cell
apoptosis may not always depend on IL-2 production.
| |
MATERIALS AND METHODS |
Animals.
C3H/HeN mice purchased from Charles River (Chalco, Milan, Italy) were
used at the age of 8 weeks as donors of T cells.
Cell suspensions.
A CD3+, CD4+, CD2+,
CD44+ subline of the OVA-specific hybridoma T-cell line
3DO30 developed in our laboratory was used in this study.
Cells, maintained in suspension in RPMI 1640 medium supplemented with
10% fetal calf serum (FCS) and 10 µmol/L HEPES buffer, were centrifuged at preestablished times at 200g for 10 minutes,
washed, and adjusted to the desired concentration (see below).
Lymph nodes were ground between frosted glass slides to produce a cell
suspension and then passed twice through nylon columns, to obtain a
95% pure T-cell population, as assessed by CD4 and CD8 expression.
Antibody cross-linking and cell treatment.
Hamster anti-mouse CD3 (clone 145-2C11; Pharmingen, San Diego, CA)
MoAb at 1 µg/mL and/or rat anti-mouse CD2 (clone RM2-5; Pharmingen) MoAb, at a concentration of 5 µg/mL, were allowed to
adhere in flat-bottom, high-binding 96-well plates (Costar, Cambridge,
MA) at 4°C in 100 µL phosphate-buffered saline (PBS). After 20 hours, plates coated with MoAbs were washed, incubated at 37°C for
2 hours with PBS supplemented with 10% FCS, washed again, and the
hybridoma T cells were then plated at 1 × 105
cells/well with or without recombinant murine (rm) IL-6,
rm interferon- (IFN-; Genzyme, Cambridge, MA), rmIL-13 (R&D
System, Ltd, Abingdon, UK), and then incubated at 37°C for 18 hours. Isotype-matched rat anti-mouse IgG2b MoAb (clone R35-38;
Pharmingen) was used as a control. Lymph node T cells, at the
concentration of 2 × 105 cells/well, were cultured in
96-well plates coated with anti-CD3 MoAb (1 µg/mL) for 5 days in the
presence of different concentrations of rmIL-6.
To evaluate Fas-mediated killing, 3DO cells (1 × 106)
were incubated at room temperature for 30 minutes with 10 µg/mL of
the antibody to Fas (hamster anti-mouse, clone Jo2; Pharmingen), then washed and plated in wells coated with an antibody to hamster IgG (5 µg/mL; Pharmingen) for the cross-linking of the anti-Fas MoAb. Some
groups were treated with IL-6 (20 µg/mL).
To block anti-CD3-induced apoptosis, in selected experiments anti-Fas
MoAb (clone Jo2) or isotype-matched hamster anti-mouse IgG MoAb (clone
UC8-4B3; Pharmingen) were used in a soluble non-cross-linked form. For
this purpose, the MoAbs were added after incubation of anti-CD3
pretreated plates with 100 µL/well FCS.
To neutralize IL-2 endogenous activity, anti-IL-2 MoAb, at 10 µg/mL
(S4B6; Pharmingen), or isotype-matched control MoAb were added to cell
cultures.
To test the effects of exogenous IL-2, 3DO cells were incubated for 18 hours at 37°C in anti-CD3-coated plates, in the presence or
absence of human recombinant IL-2 (500 IU/mL; provided by Hoffmann La
Roche, Nutley, NJ). After extensive washing, an aliquot of anti-CD3-primed cells was recultured for an additional 18 hours, without antigen, in the presence or absence of IL-2 (500 IU/mL). Apoptosis and Fas/FasL expression were evaluated as described above.
IL-2 assays.
Supernatants from cells stimulated for 18 hours with anti-CD3
and/or anti-CD2, and/or IFN-, and/or IL-13,
and/or IL-6 were tested for their concentrations of IL-2 by
two-site enzyme-linked immunosorbent assay (ELISA) using MoAb JES6-1A12
as the primary reagent and biotinylated monoclonal S4B6 as the
secondary reagent. Both antibodies were purchased from Pharmingen. The
IL-2 titers (means ± SD of replicate samples) were expressed as
picograms per milliliter, calculated by reference to standard curves
constructed with known amounts of IL-2. The sensitivity limit of the
assay was approximately 20 pg/mL.
Flow cytometry analysis.
A single-cell suspension (1 × 106 cells/sample) was
incubated for 30 minutes on ice in 50 µL staining buffer (PBS plus
5% FCS) containing 10 µg/mL hamster anti-mouse Fas MoAb directly
conjugated to R-phycoerytrin (PE) or PE-hamster IgG (isotype control).
Both MoAbs were purchased from Pharmingen. Cells were also stained with
rabbit polyclonal antibody raised against a peptide, corresponding to
amino acids 260-279 mapping at the carboxy terminus of
human Fas-L (Santa Cruz Biotechnology, Inc, Santa Cruz, CA), which has been shown to cross-react with mouse FasL12 or with
isotype-matched antibody. Anti-rabbit IgG fluorescein isothiocyanate
(FITC) conjugate, F(ab )2 fragment (Sigma, St Louis,
MO), was used as the second-step reagent. An aliquot of cells was
stained with the secondary antibody alone (background). The blocking
peptide used for rabbit immunization (Santa Cruz Biotechnology) was
also used in competition studies, according to the manufacturer's
instructions. After 30 minutes the samples were washed and analyzed on
a FACScan flow cytometer (Becton Dickinson, Mountain View,
CA). In selected experiments, a portion of T cells was
stained with anti-IL-2 receptor MoAb conjugated to R-phycoerythrin
(IL-2R, P55; Pharmingen). The median or percentage values of Fas, FasL,
and IL-2R histograms were calculated using Lysis II research software
(Becton Dickinson).
Apoptosis evaluation by propidium iodide solution (PI).
Apoptosis was measured by flow cytometry as described
elsewhere.31 After culturing, cells were centrifuged and
the pellets gently resuspended in 1.5 mL hypotonic PI (50 µg/mL in
0.1% sodium citrate plus 0.1% Triton X-100; Sigma). The tubes were
kept overnight at 4°C in the dark. The PI-fluorescence of
individual nuclei was measured by flow cytometry using standard FACScan
equipment (Becton Dickinson). The nuclei traversed a 488-nm Argon laser
light beam. A 560-nm dichroid mirror (DM 570) and a 600-nm band pass
filter (band width 35 nm) were used to collect the red fluorescence
caused by PI DNA staining. The data were recorded in a logarithmic
scale in a Hewlett Packard (HP 9000, model 310; Palo Alto, CA)
computer. The percentage of apoptotic cell nuclei (sub-diploid DNA peak in the DNA fluorescence histogram) was calculated with specific FACScan
research software (Lysis II).
Cytotoxicity assay.
The lysis of P815 Fas+ tumor cell line within 16 hours was
used as an indicator of FasL expression. This tumor cell line was grown
in RPMI 1640 and 10% FCS and subcultured two to three times per week.
Different concentrations of 3DO cells were cultured for 18 hours on
plates coated with anti-CD3 (1 µg/mL), or control medium with or
without IL-6 (20 ng/mL). The 51Cr labeling and assay were
as previously described.3 Spontaneous release or release in
the presence of anti-CD3 and/or IL-6 with no effector cells was
 15% of the total release. The percentage of specific lysis at
various effector:target (E:T) ratios was calculated as
follows:
where Test cpm is the mean cpm released in the
presence of effector cells, Spontaneous Release is the mean of
cpm released from targets cultured in medium alone, and Total
Release is the mean cpm after lysing target cells with 0.5% Triton
X-100.
Northern blot analysis.
Specific amounts (indicated in individual figure legends) of total
cytoplasm RNA were separated in 1.2% agarose gel and transferred to
nitrocellulose filters (Scheicher and Schuell, Dassel, Germany). DNA
probes were 32P-labeled using the nick translation kit from
Boehringer Mannheim (Mannheim, Germany). Hybridization was performed
overnight. Filters were washed three times in 0.2× sodium citrate
sodium chloride (SSC) with 0.5% sodium dodecyl sulfate
(SDS) at 37°C followed by two washes at 65°C.
RNase protection analysis (RPA).
A probe for RPA was constructed by reverse transcriptase-polymerase
chain reaction (RT-PCR) using the forward primer CACATATGGAACCGCTCTGATC and the reverse primer CATTAGCACCAGATCCT0CAGGA (located on FasL cDNA
610-631 bp and 772-793, respectively). PCR products (184 bp) cloned
into pCRII vector using the TA cloning kit (Invitrogen BV, San Diego,
CA) were sequenced to exclude the occurrence of point mutations.
Plasmid DNA was linearized with BamHI (New England Biolabs,
Beverly, MA) and transcribed with T7 RNA polymerase (GIBCO-BRL Life
Technologies, Paisley, UK) in the presence of 50 µmol/L
[ -32 P] UTP. After gel purification, a 2 × 105 cpm probe was hybridized to total RNA (20 µg)
overnight at 60°C. The linearized  -actin probe was purchased
from Ambion (Ambion Inc, Austin, TX).
RNase digestion was performed by using a RNase A (40 µg/mL;
Boehringer Mannheim) and RNase T1 (1.5 U/µL; GIBCO-BRL)
solution at 37°C for 15 minutes. The undigested products were
treated with phenol-chloroform, precipitated with ethanol, and loaded
on a denaturing polyacrylamide sequencing gel. Autoradiographic
exposure was performed for 2 days.
Statistical analysis.
Each experiment was performed at least three times. Representative
experiments are shown, unless otherwise indicated, in figure legends.
The means ± SD of three different experiments are reported in the
text. Due to non-normal distribution of the data, nonparametric tests
(Kruskall-Wallis' analysis of variance) were adopted for statistical
evaluation.
| |
RESULTS |
AICD in 3DO cells: Role of IL-2.
It has previously been shown that treatment with anti-CD3 MoAb mimics
the effect of Ag-TCR/CD3 interaction.32 We have established an in vitro model of AICD consisting of the mouse T-cell hybridoma 3DO
that undergoes apoptosis after stimulation of the TCR/CD3 complex. In
this model, the Fas/FasL interaction plays a dominant role in mediating
AICD.12,29,33 We thus performed experiments to evaluate the
possible role of IL-2 in this experimental system. 3DO cells were
cultured for different times in 96-well plates coated with cross-linked
(activating) anti-CD3 MoAb. Apoptosis was assessed by measuring DNA
contents with the PI assay in a time-course experiment.
Table 1 shows the results of a
representative experiment. Before culturing and at 4 hours, less than
3% of the cells were dead. However, 8 and 18 hours later, 7.5% and
40% of the cells had died, respectively. Fas/FasL and IL-2R expression by fluorescence-activated cell sorting (FACS) analysis and IL-2 production by ELISA were determined in the same experiments. Results in
Table 1 indicate increased expression of Fas/FasL, which correlated with a parallel increase in IL-2 and IL2R. The levels of IL-2 and
Fas/FasL are consistent with apoptosis levels. To ascertain the
specificity of FasL antibody, experiments of binding competition for
FasL were performed by means of the peptide used for immunization. The
antigen peptide completely blocked FasL staining of
anti-CD3-stimulated 3DO cells, as stated in Table 1.
As an additional control, experiments were performed to block the
Fas/FasL system using the soluble non-cross-linked anti-Fas MoAb, as
previously described.12 Figure
1 shows that blocking the Fas receptor induced a substantial inhibition
of anti-CD3-induced apoptosis, whereas no effect was observed with the
control antibody.
View larger version (10K):
[in this window]
[in a new window]
| Fig 1.
Inhibition of apoptosis in anti-CD3-stimulated 3DO cells
by soluble anti-Fas MoAb. In one experiment representative of three,
anti-CD3-stimulated cells (10 µg/mL) were cultured in the presence
of soluble anti-Fas (1 µg/mL) or control MoAbs. Apoptosis was
evaluated by flow cytometric analysis of PI-stained nuclei after 18 hours of culture.
|
|
Role of IL-2 in the regulation of Fas/FasL expression.
IL-2 is involved in T-cell activation.34 It has also been
reported that IL-2 is important in the regulation of TCR-activated apoptosis.10,20,21,23,25 In fact, it has been shown that the blockade of IL-2 utilization inhibits both T-cell proliferation and
death.24 We performed experiments to study the role of IL-2 in the modulation of anti-CD3-induced apoptosis and, in particular, we
analyzed the role of IL-2 in regulating Fas and FasL expression. Cells
were cultured for 18 hours in 96-well plates, coated with activating
anti-CD3 MoAb in the presence or absence of neutralizing anti-IL-2
MoAb. Figure 2A shows the result of a
representative experiment in which apoptosis was evaluated by the PI
assay. Consistent with previous results,24 treatment with
anti-IL-2 antibodies inhibited anti-CD3-induced apoptosis (Fig 2A).
We also tested the effect of reduced IL-2 utilization on Fas/FasL
expression. Figure 2B and C show the results of flow cytometry
analysis, indicating that treatment with anti-IL-2 MoAb countered the
anti-CD3-induced upregulation of Fas and FasL. Similar results were
obtained when Northern blot and RNAse protection experiments were
performed. Antibodies against IL-2 downregulated the mRNA for Fas and
FasL, suggesting that IL-2 modulates the transcription of the Fas and FasL genes (Fig 3).
View larger version (25K):
[in this window]
[in a new window]
| Fig 2.
Effect of anti-IL-2 neutralizing MoAb on
anti-CD3-induced apoptosis and Fas/FasL expression. 3DO cells were
cultured in 96-well plates coated with anti-CD3 MoAb (1 µg/mL), in
the presence or absence of anti-IL-2 neutralizing MoAb (10 µg/mL).
Apoptosis (A), Fas (B), and FasL (C) expression were evaluated by flow
cytometric analysis after 18 hours of culture, as described in
Materials and Methods. The percentage of apoptotic nuclei, the Fas
histogram median, the percentage of FasL+ cells, of a
representative experiment, are indicated in each histogram.
|
|
View larger version (35K):
[in this window]
[in a new window]
| Fig 3.
Expression of Fas and FasL mRNA in anti-CD3-activated
3DO cells in the presence of anti-IL-2 neutralizing MoAb. (B) Northern
blot. Total RNA was extracted, separated on agarose gel (20 µg/line),
and transferred to nitrocellulose filter. The filter was hybridized
with a nick-translation-labeled Fas cDNA probe, washed, and exposed
for autoradiography. (A) RNase protection analysis of FasL mRNA
expression. The protected antisense mRNA FasL fragment is 184 bp. Each
line was loaded with 20 µg of total RNA. 1, Control; 2, anti-CD3-treated cells; 3, anti-CD3 + anti-IL-2 control
isotype-treated cells; 4, anti-CD3 + anti-IL-2 treated cells.
|
|
Moreover, IL-2R had the same expression pattern as IL-2 production
(Table 1), further suggesting that the IL-2/IL-2R system plays a role
in T-cell death. These data are in agreement with previous evidence
showing that IL-2 activity is dependent on antigen-induced increase in
IL-2R density.35,36 IL-2 alone, in fact, induces neither
apoptosis nor Fas/FasL regulation. Because of the striking correlation
between IL-2R expression, IL-2 production, and dose of
antigen,21,24,35,36 only a modest increase of Fas/FasL expression and apoptosis were observed when exogenous IL-2 was added to anti-CD3-stimulated 3DO cells (data not shown). This modest
increase could be explained by the fact that endogenous IL-2 has
already engaged IL-2R. To verify this hypothesis, a series of
experiments was performed in which the IL-2 containing conditioned medium was removed from anti-CD3-activated (18 hours) 3DO cell cultures, and cells were then recultured for 18 hours in the presence of exogenous IL-2. The results (Table 2)
showed that exogenous IL-2 determined a significant increase in
apoptosis and Fas/FasL expression.
CD2 triggering but not IL-6 modulates AICD via regulation of IL-2
levels.
We have previously shown that CD2 triggering rescues T cells from AICD
by downmodulating the Fas/FasL system.12 In the present study, we investigated whether this effect could be mediated through modulation of endogenous IL-2 production and whether this mechanism is
shared by other stimuli that modulate T-cell apoptosis. We tested the
effect of various cytokines on apoptosis. 3DO cells were cultured for
18 hours in 96-well plates coated with cross-linked anti-CD3 MoAb in
the presence or absence of cytokines, used at concentrations above
those known to be active in vitro.37-39 As shown in
Fig 4A, IL-13 had no effect, IFN-
induced a significant increase, and IL-6 inhibited anti-CD3-induced
apoptosis. The means ± SD of three experiments with 3DO are as
follows: untreated control, 5 ± 1; anti-CD3-treated (1 µg/mL),
48 ± 5; anti-CD3-treated plus IFN--treated (200 U/mL),
63 ± 3; anti-CD3-treated plus IL-13 (10 ng/mL), 47 ± 3; anti-CD3-treated plus IL-6 (20 ng/mL), 22 ± 2. The difference
between anti-CD3-treated plus IFN-, or anti-CD3-treated plus IL-6
versus anti-CD3-treated groups was statistically significant (P < .01).
View larger version (35K):
[in this window]
[in a new window]
| Fig 4.
Effect of IL-6 or IFN- on anti-CD3-treated cells.
Cells were cultured for 18 hours on anti-CD3 coated plates in the
presence or absence of IL-6 (20 ng/mL), IFN- (200 U/mL), or IL-13
(10 ng/mL). Apoptosis (A) of PI-stained nuclei, Fas (B), and FasL (C)
expression were evaluated by flow cytometric analysis after 18 hours of
culture. Numbers on histograms represent the percentage of apoptotic
nuclei, the value of Fas histogram median, and the percentage of
FasL+ cells of a representative experiment calculated by
Lysis II.
|
|
We next examined the expression of Fas/FasL in anti-CD3-treated 3DO
cells, in the presence or absence of cytokines. As shown in Fig 4B and
C, in which the expression of Fas and FasL was assessed by FACS
analysis, IL-13 had no effect, IFN- induced a significant increase,
and IL-6 significantly reduced the anti-CD3-induced expression of
Fas/FasL.
IL-6 titration was also performed to establish whether the
concentrations effective in inhibiting apoptosis would be comparable to
those able to downmodulate the Fas/FasL system. The results in
Table 3 show that IL-6 countered apoptosis
at the same concentrations as those capable of downmodulating the
expression of Fas/FasL. Similar results were obtained when the IL-6
effect on FasL expression was assessed by functional analysis using an
Fas+ P815 cell target in a cytotoxicity assay
(Fig 5).
View larger version (7K):
[in this window]
[in a new window]
| Fig 5.
FasL expression evaluated by the cytotoxicity assay (see
Materials and Methods) with 3DO cells untreated or treated with
anti-CD3 (1 µg/mL) and/or IL-6 (20 ng/mL) for 18 hours. The
results are the average of three experiments (each in triplicate
culture). The standard errors (<10%) are omitted for clarity. E:T
ratio, 25:1. *P < .01 comparing anti-CD3- + IL-6-treated
versus anti-CD3-treated group.
|
|
We also analyzed the effects of IL-6 on apoptosis induced by anti-CD3
MoAb on normal lymphocytes. As previously reported, chronic stimulation
is required for FasL expression and induction of apoptosis in primary
lymphocytes.9,40 Table 4 shows
that lymphocytes, cultured for 5 days in the presence of anti-CD3 MoAb, upregulated Fas/FasL and underwent apoptosis. The effects on apoptosis and FasL expression were partially reverted by IL-6. In contrast, IL-6
did not affect anti-CD3-induced Fas expression (Table 4), suggesting
that AICD is controlled by FasL expression.
To determine whether IL-6 would inhibit the apoptosis induced by direct
triggering of Fas, 3DO cells were treated with agonist anti-Fas MoAb
and then plated on wells coated with an antibody to IgG in the presence
or absence of IL-6. According to previous data, cross-linked anti-Fas
MoAb induces apoptosis in 3DO cells.12 IL-6 failed to
inhibit this Fas-induced death (Fig 6),
suggesting that IL-6 regulates TCR-mediated expression of Fas/FasL, but
does not interfere directly with Fas-activated cell death.
View larger version (13K):
[in this window]
[in a new window]
| Fig 6.
Fas-induced apoptosis of 3DO cells. Ninety-six-well
plates were coated with an antibody to hamster IgG (5 µg/mL) with or
without IL-6 (20 ng/mL). Cells were incubated for 30 minutes with
medium alone or medium containing anti-Fas MoAb (10 µg/mL). Apoptosis
was evaluated by flow cytometric analysis of PI-stained nuclei after 18 hours of culture. The percentage of apoptotic nuclei is indicated in
each histogram. PI fluorescence versus number of nuclei is shown.
|
|
We also explored the possibility that IFN-, IL-6, or CD2 triggering
could indirectly affect the expression of Fas/FasL, via the modulation
of IL-2 levels. We measured the levels of IL-2 in supernatants from
cells activated with anti-CD3 MoAb in the presence or absence of
various stimuli. As shown in Table 5, significant inhibition of IL-2 production was induced by costimulation with cross-linked anti-CD2 antibody, whereas an increase was induced by
IFN-. In contrast to CD2, IL-6 did not affect IL-2 production induced by stimulation with anti-CD3. Again, IL-2R expression displayed
a pattern similar to that of IL-2 production (Table 5).
These data indicate that some signals, such as those activated by CD2
or IFN-, regulate the expression of Fas/FasL and the ensuing cell
death by controlling the level of IL-2, whereas other signals, such as
IL-6, fail to do so, suggesting the occurrence of different mechanisms
responsible for the modulation of Fas/FasL expression and AICD.
| |
DISCUSSION |
This study shows that IL-6 rescues T cells from anti-CD3-induced
apoptosis. This protective effect correlates with downmodulation of
Fas/FasL expression in 3DO cells (Figs 4, 5, and Table 3) and FasL in
primary lymphocytes (Table 4). Furthermore, IL-6 does not inhibit IL-2
production (Table 5), suggesting that IL-6-induced modulation of
Fas/FasL expression and cell death may not be regulated by IL-2
production. On the contrary, CD2, which also inhibits Fas/FasL
expression and T-cell apoptosis,12 and IFN-, which increases Fas/FasL expression (Fig 4) and activates
apoptosis,37 will decrease and increase IL-2 levels,
respectively (Table 5). Taken together, these results indicate that
Fas/FasL expression may or may not be regulated by IL-2 and suggest
that different mechanisms control AICD.
It is generally believed that IL-2 has potent activating effects on
human lymphocytes and monocytes.34 However, recent data in
IL-2-deficient mice indicate that IL-2 also exerts negative modulatory
effects on the immune system.26-28 It has been shown that
IL-2 prevents apoptosis of activated T cells by upregulating the
expression of apoptosis inhibitory proteins such as
Bcl-2.17,19 Moreover, removal of IL-2 from activated T
cells in vitro leads to reduced Bcl-2 expression and cell
death.15 On the other hand, it has been shown that IL-2 is
involved in the propriocidal regulation of AICD.21,23-25
This study shows that IL-2 neutralization by anti-IL-2 MoAb inhibits
the anti-CD3-induced increases of Fas/FasL expression and T-cell
apoptosis (Figs 2 and 3), suggesting that modulation of Fas/FasL
expression may contribute to the propriocidal activity of IL-2.
Because it has been proposed that AICD plays an important role in the
regulation of peripheral tolerance, it would be interesting to
ascertain whether other factors could directly modulate AICD. Very few
studies have been designed to address this question. We demonstrated
previously that CD2 engagement decreases TCR/CD3-induced apoptosis, by
decreasing Fas/FasL expression and level of activation.12 This study investigated whether signals able to affect Fas/Fas-L may
act via modulation of IL-2.
The results showed that CD2 triggering decreases the production of IL-2
and diminishes the expression of Fas/FasL12 (Table 5).
Because anti-IL-2 MoAb reduced the expression of Fas/FasL when added
to anti-CD3-stimulated 3DO cells (Figs 2 and 3), it is reasonable to
suggest that CD2 could act via modulation of IL-2 production.
Furthermore, IFN- increased IL-2 production, Fas/FasL expression,
and apoptosis (Table 5, Fig 4). These results suggest that modulation
of AICD, Fas, and FasL expression is a consequence of modulation of
IL-2 production.
To further analyze whether the modulation of IL-2 production is a
general mechanism involved in the control of apoptosis, the protective
effect of IL-6 was also studied. IL-6 rescued T cells from
TCR/CD3-induced apoptosis by downmodulating Fas/FasL expression (Figs
4, 5, and Table 3). However, IL-6 did not affect the levels of IL-2,
suggesting that an IL-2-independent mechanism may also modulate the
expression of the Fas/FasL system (Table 5). IL-6 did not rescue 3DO
cells from Fas-induced cell death (Fig 6), suggesting that IL-6 can
interfere with TCR/CD3-, but not Fas-activated signals. This result, in
apparent contrast with the data showing that IL-6 inhibits
anti-Fas-induced apoptosis in multiple myeloma cells,41
indicates that IL-6 may deliver different signals and/or induce
different biological effects depending on the cell type and/or
activation states of the cell. On the other hand, IL-6 can rescue
resting T cells from apoptosis by inducing Bcl-2
expression42 or protect murine myeloma cells against
dexamethasone-induced apoptosis, an Fas/FasL independent death
mechanism.43
It has been reported that IL-6 has different effects, either pro-or
anti-inflammatory, depending on the experimental
system.44-50 However, there is increasing evidence to
suggest a predominant anti-inflammatory and immunosuppressive role for
IL-6.46-50 It has been shown that IL-6 is a potent inducer
of IL-1r, and also of soluble TNFR
p55.51
The observation that IL-6 can downmodulate the Fas/FasL system and
lymphocyte cell death without affecting IL-2 and T-cell activation
suggests that it might be possible to control lymphocyte apoptosis
without interfering with the process of T-cell activation. This
approach would be of therapeutic interest in those syndromes in which
disregulation of Fas/FasL plays an important role and a differential
control of activation and apoptosis would be desirable.
| |
FOOTNOTES |
Submitted April 6, 1998;
accepted July 19, 1998.
Supported by the Italian Association for Cancer Research (AIRC), by
Progetto Strategico "Ciclo Cellulare e Apoptosi" CNR Italy, and
by Progetto finalizzato "Biotecnologie."
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Emira Ayroldi, MD, Department
of Clinical and Experimental Medicine, Pharmacology Section, University
of Perugia, Via del Giochetto, 0600 Perugia, Italy.
| |
REFERENCES |
1.
Crabtree GR:
Contingent genetic regulatory events in T lymphocyte activation.
Science
243:355, 1989[Abstract/Free Full Text]
2.
Kabelitz D, Pohl T, Pechhold K:
Activation-induced cell death (apoptosis) of mature peripheral T lymphocytes.
Immunol Today
14:338, 1993[Medline]
[Order article via Infotrieve]
3.
Ju-ST, Panka DJ, Cui H, Ettinger R, el-Khatib M, Sherr DH, Stanger BZ, Marshak-Rothstein A:
Fas(CD95)/FasL interactions required for programmed cell death after T-cell activation.
Nature
373:444, 1995[Medline]
[Order article via Infotrieve]
4.
Alderson MR, Tough TW, Davis-Smith T, Braddy S, Falk B, Schooley KA, Goodwin RG, Smith CA, Ramsdell F, Lynch DH:
Fas ligand mediates activation-induced cell death in human T lymphocytes.
J Exp Med
181:71, 1995[Abstract/Free Full Text]
5.
Dhein J, Walczak H, Bäumler C, Debatin KM, Krammer PH:
Autocrine T-cell suicide mediated by APO-1/(Fas/CD95).
Nature
373:438, 1995[Medline]
[Order article via Infotrieve]
6.
Yonehara S, Ishii A, Yonehara M:
A cell-killing monoclonal antibody (anti-Fas) to a cell surface antigen co-downregulated with the receptor of tumor necrosis factor.
J Exp Med
169:1747, 1989[Abstract/Free Full Text]
7.
Itoh N, Yonehara S, Ishii A, Yonehara M, Mizushima S, Sameshima M, Hase A, Seto Y, Nagata S:
The polypeptide encoded by the cDNA for human cell surface antigen Fas can mediate apoptosis.
Cell
66:233, 1991[Medline]
[Order article via Infotrieve]
8.
Suda T, Takahashi T, Golstein P, Nagata S:
Molecular cloning and expression of the Fas ligand, a novel member of the tumor necrosis factor family.
Cell
75:1169, 1993[Medline]
[Order article via Infotrieve]
9.
Suda T, Okazaki T, Naito Y, Yokota T, Arai N, Ozaki S, Nakao K, Nagata S:
Expression of the Fas ligand in cells of T cell lineage.
J Immunol
154:3806, 1995[Abstract]
10.
Lynch DH, Ramsdell F, Alderson MR:
Fas and FasL in the homeostatic regulation of immune responses.
Immunol Today
16:569, 1995[Medline]
[Order article via Infotrieve]
11.
Ayroldi E, Cannarile L, Migliorati G, Bartoli A, Nicoletti I, Riccardi C:
CD44 (Pgp-1) inhibits CD3 and dexamethasone-induced apoptosis.
Blood
86:2672, 1995[Abstract/Free Full Text]
12.
Ayroldi E, Migliorati G, Cannarile L, Moraca R, Delfino DV, Riccardi C:
CD2 rescues T cell from T-cell Receptor/CD3 apoptosis: a role for the Fas/Fas-L system.
Blood
89:3717, 1997[Abstract/Free Full Text]
13.
Nieto MA, Gonzalez A, Lopez-Rivas A, Diaz-Espada F, Gambon F:
IL-2 protects against anti-CD3-induced cell death in human medullary thymocytes.
J Immunol
145:1364, 1990[Abstract]
14.
Migliorati G, Nicoletti I, Pagliacci MC, D'Adamio L, Riccardi C:
Interleukin-4 protects double-negative and CD4 single-positive thymocytes from dexamethasone-induced apoptosis.
Blood
81:1352, 1993[Abstract/Free Full Text]
15.
Akbar AN, Salmon M, Savill J, Janossy G:
A possible role for bcl-2 in regulating T-cell memory: a "balancing act" between cell death and survival.
Immunol Today
14:526, 1993[Medline]
[Order article via Infotrieve]
16.
Akbar AN, Borthwick N, Salmon M, Gombert W, Bofill M, Shamsadeen N, Pilling D, Pett S, Grundy JE, Janossy G:
The significance of low bcl-2 expression by CD45RO T cells in normal individuals and patients with acute viral infections. The role of apoptosis in T cell memory.
J Exp Med
178:427, 1993[Abstract/Free Full Text]
17.
Akbar AN, Borthwick NJ, Wickremasinghe RG, Panayoitidis P, Pilling D, Bofill M, Krajewski S, Reed JC, Salmon M:
Interleukin-2 receptor common gamma-chain signaling cytokines regulate activated T cell apoptosis in response to growth factor withdrawal: Selective induction of anti-apoptotic (bcl-2, bcl-xL) but not pro-apoptotic (bax, bcl-xS) gene expression.
Eur J Immunol
26:294, 1996[Medline]
[Order article via Infotrieve]
18.
Strasser A, Harris AW, Cory S:
Bcl-2 transgene inhibits T cell death and perturbs thymic self-censorship.
Cell
67:889, 1991[Medline]
[Order article via Infotrieve]
19.
Broome HE, Dargan CM, Krajewski S, Reed JC:
Expression of Bcl-2, Bcl-x, and Bax after T cell activation and IL-2 withdrawal.
J Immunol
155:2311, 1995[Abstract]
20.
Lenardo MJ:
Interleukin-2 programs mouse alpha beta T lymphocytes for apoptosis.
Nature
353:858, 1991[Medline]
[Order article via Infotrieve]
21.
Boehme SA, Lenardo MJ:
Propriocidal apoptosis of mature T lymphocytes occurs at S phase of the cell cycle.
Eur J Immunol
23:1552, 1993[Medline]
[Order article via Infotrieve]
22.
Van-Parijs L, Ibraghimov A, Abbas AK:
The role of costimulation and Fas in T cell apoptosis and peripheral tolerance.
Immunity
4:321, 1996[Medline]
[Order article via Infotrieve]
23.
Lenardo MJ, Boehme S, Chen L, Combadiere B, Fisher G, Freedman M, McFarland H, Pelfrey C, Zheng L:
Autocrine feedback death and the regulation of mature T lymphocyte antigen responses.
Int Rev Immunol
13:115, 1995[Medline]
[Order article via Infotrieve]
24.
Critchfield JM, Zuniga-Pflucker JC, Lenardo MJ:
Parameters controlling the programmed death of mature mouse T lymphocytes in high-dose suppression.
Cell Immunol
160:71, 1995[Medline]
[Order article via Infotrieve]
25.
Critchfield JM, Lenardo MJ:
Antigen-induced programmed T cell death as a new approach to immune therapy.
Clin Immunol Immunopathol
75:13, 1995[Medline]
[Order article via Infotrieve]
26.
Schorle H, Holtschke T, Hunig T, Schimpl A, Horak I:
Development and function of T cells in mice rendered interleukin-2 deficient by gene targeting.
Nature
352:621, 1991[Medline]
[Order article via Infotrieve]
27.
Sadlack B, Merz H, Schorle H, Schimpl A, Feller A, Horak I:
Ulcerative colitis-like disease in mice with a disrupted interleukin-2 gene.
Cell
75:253, 1993[Medline]
[Order article via Infotrieve]
28.
Horak I, Lohler J, Ma A, Smitt KA:
Interleukin-2 deficient mice: A new model to study autoimmunity and self-tolerance.
Immunol Rev
148:35, 1995[Medline]
[Order article via Infotrieve]
29.
D'Adamio F, Zollo O, Moraca R, Ayroldi E, Bruscoli S, Bartoli A, Cannarile L, Migliorari G, Riccardi C:
A new dexamethasone-induced gene of the leucin zipper family protects T lymphocytes from TCR/CD3-activated cell death.
Immunity
7:803, 1997[Medline]
[Order article via Infotrieve]
30.
Shimonkevitz R, Kappler J, Marrack P, Grey H:
Antigen recognition by H-2-resctricted T cells. I. Cell-free antigen processing.
J Exp Med
158:303, 1983[Abstract/Free Full Text]
31.
Nicoletti I, Migliorati G, Pagliacci C, Grignani F, Riccardi C:
A rapid and simple method for measuring thymocyte apoptosis by propidium iodide staining and flow cytometry.
J Immunol Methods
139:271, 1991[Medline]
[Order article via Infotrieve]
32.
Parren PW, Geerts ME, Boeije LC, Aarden LA:
Induction of T-cell proliferation by recombinant mouse and chimeric mouse/human anti-CD3 monoclonal antibodies.
Res Immunol
142:749, 1991[Medline]
[Order article via Infotrieve]
33.
Nocentini G, Giunchi L, Ronchetti S, Krausz T, Bartoli A, Moraca R, Migliorati G, Riccardi C:
A new member of the tumor necrosis factor/nerve growth factor receptor family inhibits T cell receptor-induced apoptosis.
Proc Natl Acad Sci USA
94:6216, 1997[Abstract/Free Full Text]
34.
Theze J, Alzari PM, Bertoglio J:
Interleukin 2 and its receptors: Recent advances and new immunological functions.
Immunol Today
17:481, 1996[Medline]
[Order article via Infotrieve]
35.
Meuer SC, Hussey R, Cantrell D, Hodgdon JC, Schlossman SF, Smith K, Reinherz E:
Triggering of the T3-Ti antigen-receptor complex results in clonal T-cell proliferation trough an interleukin dependent autocrine pathway.
Proc Natl Acad Sci USA
81:1509, 1984[Abstract/Free Full Text]
36.
Cantrell DA, Smith KA:
The interleukin-2 T-cell system: A new cell growth model.
Science
224:1312, 1984[Abstract/Free Full Text]
37.
Novelli F, Bernabei P, Ozmen L, Rigamonti L, Allione A, Pestka S, Garotta G, Forni G:
Switching on of the proliferation or apoptosis of activated human T lymphocytes by IFN-gamma is correlated with the differential expression of the alpha- and beta-chains of its receptor.
J Immunol
157:1935, 1996[Abstract]
38.
Minty A, Chalon P, Derocq JM, Dumont X, Guillemot JC, Kaghad M, Labit C, Leplatois P, Liauzun P, Miloux B, Minty C, Casellas P, Loison G, Lupker J, Shire D, Ferrara P, Caput D:
Interleukin-13 is a new human lymphokine regulating inflammatory and immune responses.
Nature
362:248, 1993[Medline]
[Order article via Infotrieve]
39.
Schwarze MM, Hawley RG:
Prevention of myeloma cell apoptosis by ectopic bcl-2 expression or interleukin 6-mediated up-regulation of bcl-xL.
Cancer Res
55:2262, 1995[Abstract/Free Full Text]
40.
Owen-Schaub LB, Yonehara S, Crump WL III, Grimm EA:
DNA fragmentation and cell death is selectively triggered in activated human lymphocytes by Fas antigen engagement.
Cell Immunol
140:197, 1992[Medline]
[Order article via Infotrieve]
41.
Chauhan D, Kharbanda S, Ogata A, Urashima M, Teoh G, Robertson M, Kufe DW, Anderson KC:
Interleukin-6 inhibits Fas-induced apoptosis and stress-activated protein kinase in multiple myeloma cells.
Blood
89:227, 1997[Abstract/Free Full Text]
42.
Teague TK, Marrack P, Kappler JW, Vella AT:
IL-6 rescues resting mouse T cells from apoptosis.
J Immunol
158:5791, 1997[Abstract]
43.
Hardin J, MacLeod S, Grigorieva I, Chang R, Barlogie B, Xiao H, Epstein J:
Interleukin-6 prevents dexamethasone-induced myeloma cell death.
Blood
84:3063, 1994[Abstract/Free Full Text]
44.
Tilg H, Dinarello CA, Mier JW:
IL6 and APPs: Anti-inflammatory and immunosuppressive mediators.
Immunol Today
18:428, 1997[Medline]
[Order article via Infotrieve]
45.
Baumann H, Gauldie J:
The acute phase response (see comments).
Immunol Today
15:74, 1994[Medline]
[Order article via Infotrieve]
46.
Heuertz RM, Piquette CA, Webster RO:
Rabbits with elevated serum C-reactive protein exhibit diminished neutrophil infiltration and vascular permeability in C5a-induced alveolitis.
Am J Pathol
142:319, 1993[Abstract]
47.
Abernathy VJ, Webster RO, Dahms TE:
C-reactive protein inhibits increased pulmonary vascular permeability induced by FMLP in isolated rabbit lungs.
Am J Physiol
271:507, 1996
48.
Heuertz RM, Xia D, Samols D, Webster RO:
Inhibition of C5a des Arg-induced neutrophil alveolitis in transgenic mice expressing C-reactive protein.
Am J Physiol
266:649, 1994
49.
Ahmed N, Thorley R, Xia D, Samols D, Webster RO:
Transgenic mice expressing rabbit C-reactive protein exhibit diminished chemotactic factor-induced alveolitis.
Am J Respir Crit Care Med
153:1141, 1996[Abstract]
50.
Heuertz RM, Ahmed N, Webster RO:
Peptides derived from C-reactive protein inhibit neutrophil alveolitis.
J Immunol
156:3412, 1996[Abstract]
51.
Tilg H, Trehu E, Atkins MB, Dinarello CA, Mier JW:
Interleukin-6 (IL-6) as an anti-inflammatory cytokine: induction of circulating IL-1 receptor antagonist and soluble tumor necrosis factor receptor p55.
Blood
83:113, 1994[Abstract/Free Full Text]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
J. Gagnon, S. Ramanathan, C. Leblanc, A. Cloutier, P. P. McDonald, and S. Ilangumaran
IL-6, in Synergy with IL-7 or IL-15, Stimulates TCR-Independent Proliferation and Functional Differentiation of CD8+ T Lymphocytes
J. Immunol.,
June 15, 2008;
180(12):
7958 - 7968.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H.-H. Oberg, D. Wesch, S. Grussel, S. Rose-John, and D. Kabelitz
Differential expression of CD126 and CD130 mediates different STAT-3 phosphorylation in CD4+CD25- and CD25high regulatory T cells
Int. Immunol.,
April 1, 2006;
18(4):
555 - 563.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
I. Rochman, W. E. Paul, and S. Z. Ben-Sasson
IL-6 Increases Primed Cell Expansion and Survival
J. Immunol.,
April 15, 2005;
174(8):
4761 - 4767.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. Ayroldi, O. Zollo, A. Macchiarulo, B. Di Marco, C. Marchetti, and C. Riccardi
Glucocorticoid-Induced Leucine Zipper Inhibits the Raf-Extracellular Signal-Regulated Kinase Pathway by Binding to Raf-1
Mol. Cell. Biol.,
November 15, 2002;
22(22):
7929 - 7941.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Atsumi, K. Ishihara, D. Kamimura, H. Ikushima, T. Ohtani, S. Hirota, H. Kobayashi, S.-J. Park, Y. Saeki, Y. Kitamura, et al.
A Point Mutation of Tyr-759 in Interleukin 6 Family Cytokine Receptor Subunit gp130 Causes Autoimmune Arthritis
J. Exp. Med.,
September 26, 2002;
(2002)
20020619.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Kurita-Ochiai, K. Ochiai, N. Suzuki, K. Otsuka, and K. Fukushima
Human Gingival Fibroblasts Rescue Butyric Acid-Induced T-Cell Apoptosis
Infect. Immun.,
May 1, 2002;
70(5):
2361 - 2367.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. R. Maxwell, C. Ruby, N. I. Kerkvliet, and A. T. Vella
Contrasting the Roles of Costimulation and the Natural Adjuvant Lipopolysaccharide During the Induction of T Cell Immunity
J. Immunol.,
May 1, 2002;
168(9):
4372 - 4381.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. M. Fonseca, G. Porto, K. Uchida, and F. A. Arosa
Red blood cells inhibit activation-induced cell death and oxidative stress in human peripheral blood T lymphocytes
Blood,
May 15, 2001;
97(10):
3152 - 3160.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. L. Arrington, D. N. McMurray, K. C. Switzer, Y.-Y. Fan, and R. S. Chapkin
Docosahexaenoic Acid Suppresses Function of the CD28 Costimulatory Membrane Receptor in Primary Murine and Jurkat T Cells
J. Nutr.,
April 1, 2001;
131(4):
1147 - 1153.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
N. Alemañ, M. I. Quiroga, M. López-Peña, S. Vázquez, F. H. Guerrero, and J. M. Nieto
Induction and Inhibition of Apoptosis by Pseudorabies Virus in the Trigeminal Ganglion during Acute Infection of Swine
J. Virol.,
January 1, 2001;
75(1):
469 - 479.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
W. Tu, P.-T. Cheung, and Y.-L. Lau
Insulin-Like Growth Factor 1 Promotes Cord Blood T Cell Maturation and Inhibits Its Spontaneous and Phytohemagglutinin-Induced Apoptosis Through Different Mechanisms
J. Immunol.,
August 1, 2000;
165(3):
1331 - 1336.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. S. Liwski and T. D. G. Lee
Nematode Infection Enhances Survival of Activated T Cells by Modulating Accessory Cell Function
J. Immunol.,
November 1, 1999;
163(9):
5005 - 5012.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Top
Abstract
Introduction