Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brossart, P.
Right arrow Articles by Brugger, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brossart, P.
Right arrow Articles by Brugger, W.
Related Collections
Right arrow Immunobiology
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, Vol. 92 No. 11 (December 1), 1998: pp. 4238-4247

Generation of Functional Human Dendritic Cells From Adherent Peripheral Blood Monocytes by CD40 Ligation in the Absence of Granulocyte-Macrophage Colony-Stimulating Factor

By Peter Brossart, Frank Grünebach, Gernot Stuhler, Volker L. Reichardt, Robert Möhle, Lothar Kanz, and Wolfram Brugger

From the University of Tübingen, Department of Hematology, Oncology and Immunology, Tübingen, Germany.


    ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Recently it has been shown that dendritic cells (DC) can develop from peripheral blood monocytes when grown in the presence of granulocyte-macrophage colony-stimulating factor (GM-CSF) and interleukin-4 (IL-4). However, it is unclear whether DC can also develop from monocytes in absence of these cytokines. We therefore analyzed the effect of Flt-3 ligand (Flt3L) and of CD40 ligand on the development of human DC from blood monocytes in the absence of GM-CSF. Adherent peripheral blood mononuclear cells (PBMNC) were cultured in the presence of different cytokine combinations and analyzed for the expression of surface molecules and antigen presenting capacity. For functional analyses, cells were tested for their ability to stimulate allogeneic T lymphocytes in a mixed lymphocyte reaction (MLR), to present soluble antigens, and to induce primary HIV-peptide-specific cytotoxic T-cell (CTL) responses in vitro. Furthermore, expression of DC-CK1, a recently identified chemokine with specific expression in DC, and of IL-18 (IGIF), a growth and differentiation factor for Th 1 lymphocytes, was analyzed by reverse-transcription polymerase chain reaction (RT-PCR). In our study, Flt3L alone was not sufficient to generate DC and required addition of IL-4. DC generated with Flt3L and IL-4 underwent maturation after stimulation with tumor necrosis factor-alpha (TNF-alpha ) or CD40L, characterized by CD83 expression, upregulation of MHC, adhesion, and costimulatory molecules as well as increased allogeneic proliferative response. In contrast, CD40 ligation alone promoted differentiation of adherent blood monocytes into functional DC in the absence of GM-CSF and IL-4. These cells displayed all phenotypic and functional characteristics of mature DC and were potent stimulatory cells in priming of major histocompatibility complex (MHC) class I-restricted CTL responses against an HIV-peptide, whereas their ability to present soluble protein antigens was reduced. Using a semiquantitative RT-PCR, DC-CK1 and IL-18 transcripts were detected in all generated DC populations, independent of growth factors used. Our findings provide further evidence for the importance of CD40-CD40L interaction for initiation and maintenance of T-cell responses and confirm the emerging concept that blood monocytes provide an additional source of DC depending on external stimuli.
© 1998 by The American Society of Hematology.

    INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

DENDRITIC CELLS (DC) are key regulators in immune responses, capable of priming naive resting T cells and initiating primary T-cell responses when pulsed with antigenic peptides or proteins.1-12 In vitro, DC can be generated from human CD34+ bone marrow, cord blood, and peripheral blood progenitor cells after culture with different cytokine combinations including granulocyte-macrophage colony-stimulating factor (GM-CSF), stem cell factor (SCF), and either interleukin-4 (IL-4) or tumor necrosis factor-alpha (TNF-alpha ).4,13-18

Recently it was shown that DC can also develop from CD14+ blood monocytes when grown in the presence of GM-CSF and IL-4. These cells have the characteristics of immature DC and can be further induced to mature by inflammatory stimuli like TNF-alpha , IL-1, lipopolysaccharide (LPS), or by monocyte-conditioned medium.19-23

There is experimental evidence from murine studies showing that GM-CSF does not seem to be the major growth factor for DC development because GM-CSF transgenic mice and mice carrying a null allele of the GM-CSF gene do not have aberrant numbers of DC, and other stimuli are sufficient to generate DC from hematopoetic progenitor cells.24,25 However, the conditions for the development of DC are different depending on the species analyzed, and caution is warranted comparing mouse and human DC development.

As shown in a previous report, treatment of mice with Flt3 ligand (Flt3L) resulted in a dramatic numerical increase of functionally mature DC in vivo.26 In vitro, addition of Flt3L to culture medium can increase the yield of DC generated from bone marrow precursors and CD34+ peripheral blood progenitor cells.17,27,28 CD40 ligation of CD34+ hematopoetic cells induces their proliferation and differentiation into cells with dendritic phenotype and function.18

The induction of an efficient immune response requires a coordinated collective cell to cell interaction of a variety of cell types, and CD40-CD40L interaction seems to play a central role in antigen presentation, development of T-cell-dependent effector functions, and activation of macrophages and dendritic cells.29-32

We analyzed the effect of CD40L and Flt3L on the development of DC from human peripheral blood monocytes in the absence of GM-CSF. We show that Flt3L alone was not sufficient to induce differentiation of monocytes and required addition of IL-4. In contrast, CD40 ligation alone promoted differentiation of peripheral blood monocytes into functional DC in the absence of GM-CSF and IL-4, thus confirming the importance of CD40 ligation for the induction of primary immune reponses.

    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Cell isolation and cultures.   Peripheral blood mononuclear cells (PBMNC) were isolated by Ficoll/Paque (GIBCO-BRL, Grand Island, NY) density gradient centrifugation of heparinized blood obtained from buffy coat of healthy volunteers from the blood bank of the University of Tübingen. These PBMNC were plated (1 × 107 cells/3 mL per well) into 6-well plates (Costar, Cambridge, MA) in RP10 medium (RPMI 1640 supplemented with 10% heat-inactivated fetal calf serum [FCS], 2 mmol/L L-glutamine, 50 µmol/L 2-mercaptoethanol, and antibiotics). For some experiments we used serum-free X-VIVO 20 medium (Bio Whittaker, Walkersville, MD), as indicated in Results. After 2 hours of incubation at 37°C, nonadherent cells were removed and the adherent cells (yield, 19 ± 3% of incubated cells; n = 6) were cultured. The population of the adherent cells remaining in the wells comprised of 94 ± 3.6% CD14+ cells, 4 ± 2.6% CD3+ cells, and 1 ± 1.5% CD19+ cells. The percentage of CD1a+ or CD83+ cells was less than 1%. These cells were used as a starting population and cultured in RP10 medium supplemented with various combinations of cytokines or CD40 ligand transfectants for 7 days.

The following cytokines obtained from Genzyme (Cambridge, MA) were used: IL-4 (1,000 IU/mL), IL-6 (50 ng/mL), and TNF-alpha (10 ng/mL). Flt3 ligand (100 ng/mL) was purchased from PreproTech (Rocky Hill, NJ) and human recombinant GM-CSF (Leukomax, 100 ng/mL) from Novartis (Basel, Switzerland).

For stimulation of adherent cells with CD40L we used mouse fibroblastic Ltk cells (L cells) transfected with either CD40L (LCD40L) or with CD32 (LCD32) as a control (kindly provided by Schering-Plough, Dardilly, France18,32). Cultured fibroblastic cells were detached, washed, irradiated with 150 Gy, and added to the cultures (5 × 105 cells per well).

The DC cultures were fed with fresh medium and cytokines every other day, and cell differentiation was monitored by light microscopy. The antigen-presenting capacity and expression of cell surface molecules were analyzed after 7 days of culture.

DC, CD34+, and CD14+ cells were purified using MACS isolation kit (Miltenyi Biotec, Bergisch Gladbach, Germany). The purity of the cells used in the experiments was 96% to 99% as analyzed by flow cytometry.

To analyze that CD40 ligation results in DC maturation in the absence of GM-CSF, we performed experiments to neutralize any induced GM-CSF using a neutralizing polyclonal antibody obtained from Genzyme (50 µg/mL). The antibody was added every other day for 7 days.

Immunostaining.   Cell staining was performed using fluorescein isothiocyanate (FITC)- or phycoerythrin (PE)-conjugated mouse monoclonal antibodies (MoAbs) against CD86, CD40, CD44, CD33, CD154, and CLA (all purchased from Pharmingen, Hamburg, Germany); CD80, HLA-DR, CD54, CD14, CD3, CD19, CD56 (Becton Dickinson, Heidelberg, Germany); APO-1/FAS (APO 1-3; Alexis, San Diego, CA), HLA-A, -B, -C (W6/32; Dako, Glostrup, Denmark), CD83 (Coulter-Immunotech Diagnostics, Hamburg, Germany), CD1a (OKT6; Ortho Diagnostic Systems Neckargemund, Germany, and T6-RD1; Coulter Immunology, Hialeah, FL), and mouse IgG isotype controls (Becton Dickinson). Samples were analyzed on a FACScan Calibur (Becton Dickinson).

Mixed lymphocyte reaction (MLR) assay.   A total of 105 responding cells either from allogeneic PBMNC was cultured in 96 flat-bottom microplates (Nunc, Wiesbaden, Germany) with 103 irradiated stimulator cells (DC or PBMNC). To use the identical number of DC in the assays, the DC were quantitated based on fluorescence-activated cell sorter (FACS) data (cells expressing CD1a and/or CD83 on the cell surface) and confirmed by counting of the cells after staining with trypan blue under a light microscope. Thymidine incorporation was measured on day 5 by a 16-hour pulse with 3H-thymidine (1 µCi/well; Amersham Life Science, Buckingham, UK).

Soluble protein presentation.   To analyze the ability of generated DC to uptake and to present soluble antigens, 1.5 × 105 PBMNC were incubated with 104 irradiated DC or PBMNC with tetanus toxoid (Behringwerke, Marburg, Germany) in 96-well plates. Each well was obtained after 7 days following a 16-hour pulse with 1 µCi tritiated thymidine. Results are expressed as mean cpm of triplicate wells ± SD.

Induction of antigen-specific cytotoxic T-cell (CTL) response using HLA-A2 restricted synthetic peptides.   The influenza matrix peptide (IMP) 58-66: GILGFVFTL and pol HIV-1 reverse transcriptase peptide (HIV) 476-484, ILKEPVHGV, were synthesized using standard Fmoc chemistry on a peptide synthesizer (432A; Applied Biosystems, Weiterstadt, Germany) and analyzed by reverse-phase HPLC and mass spectrometry. For CTL induction 5 × 105 DC were pulsed with 25 µg/mL of the synthetic HIV peptide for 2 hours, washed, and incubated with 2.5 × 106 autologous PBMNC in RP10 medium. Cells were restimulated after 7 days of culture and 1 ng/mL human recombinant IL-2 (Genzyme) was added every other day. The cytolytic activity of induced CTL was analyzed on day 5 after the last restimulation in a standard 51Cr-release assay.

CTL assay.   The standard 51Cr-release assay was performed with some modifications as described.32 Target cells (T2 cells, 174 × CEM.T2 hybridoma, TAP1 and TAP2 deficient) were pulsed with 25 µg/mL peptide for 2 hours and labeled with [51Cr]-sodium chromate in RP10 for 1 hour at 37°C. 104 cells were transferred to a well of a round-bottomed 96-well plate. Varying numbers of CTL were added to give a final volume of 200 µL and incubated for 4 hours at 37°C. At the end of the assay supernatants (50 µL/well) were obtained and counted in a microbeta counter (Wallac, Turku, Finland). The percent specific lysis was calculated as: 100 × (Experimental Release - Spontaneous Release/Maximal Release - Spontaneous Release). Spontaneous and maximal release were determined in the presence of either medium or 1% Triton X-100, respectively.

Reverse-transcription polymerase chain reaction (RT-PCR).   Semiquantitative RT-PCR was performed with some modifications as recently described.33,34 Total RNA was isolated from cell lysates using Qiagen RNeasy anion-exchange spin columns (Qiagen GmbH, Hilden, Germany) according to the instructions of the manufacturer. Five hundred nanograms of total RNA was subjected to first-strand cDNA using an optimized protocol described by Life Technologies (SuperScript Preamplification System, GIBCO-BRL, Eggenstein, Germany), using Oligo(dT) as primer. Two microliters of cDNA obtained from the reverse transcriptase reaction was subjected to the DC-CK1 and IL-18 PCR amplification. To control the integrity of the isolated RNA, 1 µL of cDNA was amplified by an intron-spanning primer pair for the 2-microglobulin gene. There was no sample from which genomic 2-microglobulin DNA sequences were amplified. To further exclude genomic DNA contamination, we analyzed in parallel samples obtained from first-strand cDNA synthesis without addition of reverse-transcriptase enzyme. Primer sequences were deduced from published cDNA sequences: DC-CK ACAAAGAGCTCTGCTGCCTC (sense) and CCCACTTCTTATTGGGGTCA (anti-sense); IL-1837 GCTTGAATCTAAATTATCAGTC and GAAGATTCA-AATTGCATCTTAT; IL-12 GAGAAATGGTGGTCCTCACCTGTG and GAG-TGTAGCAGCTCCGCACGTC; beta 2-microglobulin GGGTTTCATCCATCCGA-CAT and GATGCTGCTTACATGTCTCGA. Each 50-µL PCR reaction contained 1.25 U AmpliTaq DNA polymerase (Perkin Elmer, Weiterstadt, Germany), 200 µmol/L of each dNTP, and 60 pmol of each oligonucleotide primer for the DC-CK1 and IL-18 transcripts and 25 pmol for the 2-microglobulin transcript in PCR buffer (10 mmol/L Tris-HCl, pH 8.3, 50 mmol/L KCl, 1.5 mmol/L MgCl2, 0.001% gelatin). Reactions were amplified in a DNA thermal cycler (GeneAmp PCR System 2400; Perkin Elmer) for 28 cycles. The temperature profiles were as follows: 5 minutes at 94°C pretreatment, 60°C for 30 seconds annealing for the DC-CK1, and IL-12 primers and 55°C for the IL-18 and beta 2-microglobulin primers, 72°C for 30 seconds synthesis, and 94°C for 30 seconds denaturation. Finally, a single posttreatment was performed at 72°C for 5 minutes. Ten microliters of the RT-PCR products was electrophoresed through a 3% agarose gel and stained with ethidium bromide for visualization under ultraviolet light. The specificity of the amplified PCR products was confirmed by restriction enzyme digest of the PCR products.

Statistical analysis.   Each experiment was performed at least three times. Representative experiments are shown. Unpaired t-tests were performed to evaluate the significance of the results.

    RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Phenotype of cells differentiating from adherent PBMNC using cytokine cominations including Flt3 ligand (Flt3L).   Flt3L alone or in combination with TNF-alpha was not sufficient to induce differentiation of monocytes (Fig 1). However, when IL-4 was added to the medium containing Flt3L, a marked increase of CD1a expression on cultured cells was detected (Fig 1). When adherent PBMNC were grown in FLT3L and IL-4 and further stimulated by TNF-alpha or CD40L, the cultured cells showed an increased expression of MHC, costimulatory, and adhesion molecules (Fig 2). The cells became CD83 positive and CD14 low or negative, corresponding to an activated phenotype of DC (Figs 1 and 2). All DC generated from adherent PBMNC expressed FAS/APO-1 (CD95) on cell surface independent of the stimuli used for induction (data not shown).


View larger version (28K):
[in this window]
[in a new window]
 
Fig 1. Two-color dot plot of cultured cells labeled with CD83-PE (y-axis) and CD1a-FITC (x-axis). Adherent PBMNC were cultured with the indicated combinations of cytokines or CD40L for 7 days, and cell surface phenotype was examined by flow cytometry. The numbers indicate the percentage of cells in each quadrant. Data are presented from one representative experiment out of three.


View larger version (29K):
[in this window]
[in a new window]
 
Fig 2. Phenotypic analysis of in vitro-generated DC. PBMNC were cultured in presence of Flt3L/IL-4 (bold solid line), Flt3L/IL-4/ TNF-alpha (thin solid line), or Flt3L/IL-4/CD40L (dotted line). Overlay diagrams show expression of indicated molecules after 7 days of culture. Solid histograms: labeling with isotype matched irrelevant MoAb.

CD40 ligation also resulted in a significant increase of absolute numbers of generated DC compared with cultures without CD40L, as shown in Table 1. The presence of CD32 transfectants used as a control in the experiments had no effect on number, phenotype, or function of generated cells (data not shown).

                              
View this table:
[in this window]
[in a new window]
 
Table 1. Numbers of DC Generated From Adherent PBMNC

CD40 ligation alone promotes differentiation of monocytes into DC.   Adherent PBMNC cultured with CD40L-transfected L cells alone revealed small clusters of cells that started to detach after 5 to 7 days. In a typical experiment, after 7 days of culture with CD40L-transfected L cells alone, 50% of the cultured cells appeared as clumps of cells with dendritic morphology and phenotype. Analysis of surface markers showed that CD40 ligation resulted in expression of high levels of MHC class II molecules, CD80, CD86, CD40, and CD54 (Fig 3B). Moreover, DC were positive for CLA, CD11b, CD33, CD44, and CD45RO expression (data not shown). However, about half of the cells still expressed high levels of CD14 representing the monocytes/macrophages in the cell cultures (Fig 3A and B). The percentage of DC in these cultures could be further increased to 60% to 90% by addition of IL-4 with or without GM-CSF, which was mainly due to a selective loss of the CD14bright monocyte/macrophage population (Fig 3, Fig 4, Table 1).


View larger version (27K):
[in this window]
[in a new window]
 


View larger version (31K):
[in this window]
[in a new window]
 
Fig 3. Phenotypic analysis of in vitro-generated DC. PBMNC were cultured in presence of CD40L, CD40L/IL-4, or GM-CSF/IL-4. Dot plots (A) show the forward- and side-scatter profiles of the cells. Histograms (B) show expression of indicated cell surface molecules after 7 days of culture. Solid histograms: labeling with isotype matched irrelevant MoAb.


View larger version (33K):
[in this window]
[in a new window]
 
Fig 4. Two-color cytograms of cultured cells labeled with CD83-PE (y-axais) and CD1a-FITC (x-axis). Adherent PBMNC were cultured with the indicated combinations of cytokines or CD40L for 7 days, and cell surface phenotype was examined by flow cytometry. The numbers indicate the percentage of cells in each quadrant.

To analyze the effects of serum to our findings, the same experiments were repeated under serum-free conditions using X-VIVO 20 medium. The expression of CD83, CD1a, and costimulatory molecules did not differ when monocyte-derived DC were generated in FCS or in X-VIVO medium, in contrast to results reported when DC were induced in medium complemented with human serum (data not shown).

To show that CD40 ligation results in DC maturation in the absence of GM-CSF, we used a neutralizing anti-GM-CSF antibody to block any induced endogenous GM-CSF. The addition of this antibody to the culture medium had no effect on the generation of DC by CD40 ligation, whereas the same antibody reduced the numbers of DC up to 70% in cultures grown in the presence of IL-4/GM-CSF (data not shown).

DC generated from CD14+ monocytes strongly stimulate allogeneic T cells.   Cultured DC or freshly isolated PBMNC were analyzed for their capacity to stimulate alloreactive T cells. A total of 103 DC or PBMNC from the same donor was cultured with 105 allogeneic T cells. As shown in Table 2, DC generated in presence of TNF-alpha or CD40L induced an increased thymidine incorporation of allogeneic T-cells compared with unstimulated DC (P < .05) or to PBMNC (P < .001).

                              
View this table:
[in this window]
[in a new window]
 
Table 2. Stimulatory Capacity of Mononuclear Cells Cultured With Various Cytokine Combinations

Stimulation of DC with TNF-alpha or by CD40 ligation results in a reduced capacity to present soluble antigens.   To analyze the ability of different antigen-presenting cell (APC) populations to uptake and present soluble antigens, DC cells generated from monocytes using different stimuli were incubated with or without tetanus toxoid (TT) and autologous PBMNC and harvested after 7 days. As shown in Fig 5, activation of DC with TNF-alpha or CD40L results in reduced stimulation of TT-specific T-lymphocyte proliferation as compared with DC grown in the presence of GM-CSF and IL-4 (P < .005). The same results were obtained when DC generated in presence of Flt3L and IL-4, and stimulated by TNF-alpha or CD40L, were used as APC in the assay (data not shown). Interestingly, we observed some increased background proliferation of autologous T lymphocytes, particularly in cultures stimulated with TNF-alpha or by CD40 ligation, which may be due to the activity against the FCS proteins.


View larger version (22K):
[in this window]
[in a new window]
 
Fig 5. Presentation of TT by DC generated using different culture conditions. 1.5 × 105 PBMNC were incubated with 104 irradiated APC with TT in 96-well plates. The absolute number of DC was determined by FACS staining for each culture condition. Each well was obtained after 7 days following a 12-hour pulse with tritiated thymidine. Results are expressed as mean cpm of triplicate wells ± SD. Thimidine incorporation of autologous T lymphocytes stimulated by DC and PBMNC not pulsed with TT: PBMNC, 724 ± 96 cpm; GM-CSF/IL-4, 1,244 ± 147 cpm; GM-CSF/IL-4/TNF-alpha , 1,920 ± 141 cpm; GM-CSF/IL-4/CD40L, 1,770 ± 240 cpm; CD40L, 1,870 ± 96 cpm; CD40L/IL-4, 1,917 ± 366 cpm. () GM-CSF/IL-4/TNF-alpha ; (diamond ) GM-CSF/IL-4/CD40L; (bullet ) GM-CSF/IL-4; (triangle ) CD40L; (black-lozenge ) CD40L/IL-4; (open circle ) PBMNC.

DC activated with CD40L or TNF-alpha are strong stimulators of primary MHC class I-restricted T-cell responses.   DC generated from adherent HLA-A2 positive PBMNC were pulsed with a synthetic peptide derived from pol HIV-1 reverse transcriptase 476-484, ILKEPVHGV, and used as APC to induce a primary CTL response in vitro. As shown in Fig 6, CTL lines obtained after 3 weekly restimulations showed high peptide-specific killing. It was observed that T cells exhibited a cytotoxic response only against targets coated with the cognate HIV-peptide, but they did not recognize targets coated with an irrelevant HLA-A2 binding peptide derived from IMP. CTL induced with DC generated in presence of TNF-alpha or CD40L elicited a higher cytotoxic activity when stimulated with the cognate peptide compared with CTL induced with DC grown in GM-CSF and IL-4 alone. Peptide-pulsed PBMNC did not elicit any measurable antigen specific cytotoxic activity.


View larger version (26K):
[in this window]
[in a new window]
 
Fig 6. Induction of CTL responses by peptide pulsed DC or freshly isolated PBMNC. PBMNC from a HLA A2 positive donor were cultured with the indicated combinations of cytokines for 7 days. 5 × 105 DC pulsed with the synthetic peptides derived from pol HIV-1 reverse transcriptase were used as APC to induce an MHC class I-restricted CTL response in vitro. Cytotoxic activity of induced CTL was determined in a standard 51Cr-release assay using T2 cells as targets pulsed for 2 hours with 25 µg of the cognate HIV (closed symbols) or irrelevant IMP peptide (open symbols). Data are from one representative experiment out of three.

Expression of DC-CK1.   Recently, a dendritic cell-derived chemokine DC-CK1 was identified.35 This chemokine has a specific expression in DC with a preferential chemotactic activity for naive T cells. We analyzed the expression of DC-CK1 in generated DC populations using a semiquantitative RT-PCR and primers specific for DC-CK1. DC-CK1 expression was readily detected in all generated DC populations, independent of the cytokines used in the experiments (Fig 7). DC-CK1 transcripts were not detectable in samples obtained from purified CD14+ peripheral blood monocytes, isolated CD34+ peripheral blood progenitor cells, and human tumor cell lines OCI-Ly8 (B-cell lymphoma), SD-1 (acute lymphoblastic leukemia), K562 (erythroleukemia), Kasumi-1 (AML, M2), and BMEC 1 (human bone marrow-derived endothelial cell line) after 28 rounds of amplification. Interestingly, activation of DC grown in GM-CSF and IL-4 containing medium with TNF-alpha or CD40L resulted in reduced DC-CK1 mRNA expression.


View larger version (40K):
[in this window]
[in a new window]
 
Fig 7. Expression of DC-CK1, IL-12, and IL-18 by in vitro-generated DC. PBMNC were cultured with the indicated combinations of cytokines for 7 days. Total RNA was isolated from cultured DC, purified CD14+ and CD34+ cells, or human tumor cell lines. DC-CK1, IL-12, and IL-18 expression was examined by semiquantitative RT-PCR. Twenty-eight rounds of amplification using primers specific for DC-CK1 and IL-18, 32 cycles for IL-12 amplification, and 23 cycles for beta 2-microglobulin were performed. PCR products were run on a 3% agarose gel and visualized by ethidium bromide staining. Samples containing no cDNA were used as negative control.

Expression of IL-18 (interferon-gamma inducing factor [IGIF]) by in vitro-generated DC.   DC were shown to be potent inducers of Th 1-directed immune responses, probably as a result of IL-12 production.4 Like IL-12, IL-18 has been described as a growth and differentiation factor for Th 1 lymphocytes. To this end, only activated macrophages and keratinocytes were identified as a source of IL-18.36-40 In conrast to IL-12 expression, IL-18 transcripts were detected in all DC populations generated from peripheral blood monocytes (Fig 7). Interestingly, IL-18 mRNA was also found in CD34+ peripheral blood progenitor cells, CD14+ purified blood monocytes, and in all tested tumor cell lines with the exception of the OCI-Ly8 B lymphoma cell line.

    DISCUSSION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

DC are recognized as the most efficient professional APC for the induction of primary immune responses. Several previous studies showed that DC can develop from CD14+ blood monocytes cultured with GM-CSF and IL-4. Here we show that DC can develop from adherent CD14+ monocytes in the absence of GM-CSF by using Flt3L and IL-4, or by CD40-CD40 ligand interactions.

Flt3L shows structural homology with SCF and induces in vitro proliferation of purified immature and committed myeloid colony-forming cells41 and seems to play an important role in DC development.26-28 In our study, Flt3L alone was not sufficient to induce differentiation of adherent peripheral blood monocytes and required addition of IL-4. The absolute number of DC generated using this cytokine combination was lower as compared with cells grown in GM-CSF and IL-4. However, when these cells were grown in the presence of CD40L, a significant increase of DC numbers was observed, even when compared with DC generated with GM-CSF/IL-4.

The CD40 receptor ligand (CD40L) belongs to the emerging tumor necrosis factor receptor family.29-32 CD40L is mainly expressed on activated CD4+ T cells but can also be found on natural killer (NK) cells, monocytes, mast cells, basophils, and some CD8+ T cells. Recent work has shown that CD40-CD40L interactions play a central role in antigen presentation, autoimmunity, development of T-cell-dependent effector functions, and activation of macrophages and dendritic cells. The in vivo importance of CD40 and CD40L interactions in the development of humoral and T-cell-mediated immune responses has been clearly shown in patients suffering from hyper IgM syndrome, characterized by mutations in CD40L, and in studies using CD40L and CD40 knock out mice.29-32

Here we show for the first time that DC can develop from adherent blood monocytes solely upon CD40-CD40L interactions. These cells showed all the phenotypic and functional characteristics of mature DC and were potent inducers of antigen specific CTL responses (see Fig 3 through 6).

To make the statement that CD40 ligation results in DC maturation in absence of GM-CSF, we blocked any induced GM-CSF in these cultures using a neutralizing antibody. The presence of this antibody had no effect on phenotype and yield of generated DC in cultures stimulated with CD40L.

The finding that DC can be generated from blood monocytes upon CD40 ligation is in contrast to a previous report using the same CD40L transfectants, but elutriated monocytes. These cells did not display the typical DC morphology after 2 to 6 days. In our study, we used adherent instead of elutriated blood monocytes, and functional and phenotypical analyses of the cultured cells were performed after 7 days of culture. This was the time point when the adherent cells started to detach in sufficient numbers. It seems unlikely that prior adherence explains this difference, but we cannot completely exclude that the low number of contaminating B and T cells directly or indirectly might contribute to our observations.

To further confirm the presence of DC in these cultures, we examined the expression of DC-CK1,35 a recently identified chemokine, which was shown to be exclusively expressed in DC. In our study, DC-CK1 transcripts were detected by RT-PCR in all generated DC populations independent of growth factors used, whereas no expression was found in purified CD14+ monocytes, isolated CD34+ cells, and human tumor cell lines derived from B and T lymphocytes, myelomonocytes, and bone marrow endothelial cells. These data suggest that all cytokines used were able to induce DC development from adherent blood monocytes in vitro. Interestingly, stimulation of immature DC resulted in reduced expression of DC-CK1 mRNA.

DC were shown to be potent inducers of Th 1-directed immune responses, probably due to production of IL-12.4 IL-18 (IGIF), another potent growth and differentiation factor for Th 1 lymphocytes, is a recently described cytokine that shares functional properities of IL-12. Like IL-12, IGIF is a potent inducer of IFN-gamma from NK cells, T lymphocytes, and activated B cells. To this end, only activated macrophages, Kupffer cells, or keratinocytes were identified as a source of IL-18.37-40 Using RT-PCR, IL-18 transcripts were detected in all DC populations generated from peripheral blood monocytes, indicating that besides IL-12, DC may also produce IL-18. Interestingly, IL-18 mRNA was also found in CD34+ cells, CD14+ blood monocytes, and in all tested tumor cell lines with the exception of the OCI-Ly8 B lymphoma cell line, suggesting that this cytokine is broadly expressed (at least at the mRNA level). However, further studies analyzing protein production are needed to confirm this assumption.

Recently, several reports have shown that peptides generated from exogenous proteins can gain access to the cytosol and therefore be presented on class I MHC molecules.42,43 In vivo studies revealed that bone marrow-derived APC can present class I-restricted peptides after endocytosis of particulate or soluble exogenous protein antigens and induce antigen specific CTL responses.44 In vitro results suggest that macrophages and DC may be involved in the cross-priming phenomenon seen in vivo.43,45-48 For the induction of CD8+ cytotoxic T lymphocytes by cross-priming cognate CD4+ T cell help was shown to be required.49 Because of the observed cognitive nature of this process it was further suggested that CD4+ T cells actively modify the APC, converting it into an effective stimulator for successful priming of CTL precursor.

One possible sequence of events derived from our data and suggested by Grewal and Flavell30 would be that monocytes/macrophages activate T cells at the site of inflammation by presentation of captured and processed protein antigens and cytokine secretion, which results in upregulation of CD40L on T cells. The coupling and interaction of CD40L on T cells and CD40 on monocytes/macrophages induces a functional and phenotypic change of these cells. They upregulate their costimulatory capacity and differentiate into CD83+ mature DC capable of migrating to the peripheral lymph nodes and of efficiently initiating CD8+ and CD4+ T-cell responses.

In conclusion, our findings provide further evidence for the importance of CD40-CD40L interaction for initiation and maintenance of T-cell responses and confirm the emerging concept that monocytes provide an additional source of DC, depending on external stimuli.

    ACKNOWLEDGMENT

We thank Dr Stefan Stevanovic for providing the synthetic HIV-peptides and Prof Dr H.-G. Rammensee for reading the manuscript and for helpful discussion. We are grateful to Prof Rammensee and Alexandra Muhm for the help provided in performing the Cr-release assays. We are thankful to Stefanie Kurtz for excellent technical assistance.

    FOOTNOTES

   Submitted November 12, 1997; accepted July 28, 1998.
   Supported by grants from Deutsche Forschungsgemeinschaft (SFB 510), Deutsche Krebshilfe, and fortune Program of the University of Tübingen.
   The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. section 1734 solely to indicate this fact.

Address reprint requests to Wolfram Brugger, MD, Department of Hematology, Oncology and Immunology, University of Tübingen, Otfried-Müller-Strasse-10, D-72076 Tübingen, Germany.

    REFERENCES
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

1. Steinman AM: The dendritic cell system and its role in immunogenicity. Annu Rev Immunol 9:271, 1991[Medline] [Order article via Infotrieve]

2. Steinman RM, Witmer-Pack M, Inaba K: Dendritic cells: Antigen presentation, accessory function and clinical relevance. Adv Exp Med Biol 329:1, 1993[Medline] [Order article via Infotrieve]

3. Austyn JM: New insight into the mobilisation and phagocytic activity of dendritic cells. J Exp Med 183:1287, 1996[Free Full Text]

4. Cella M, Sallusto F, Lanzavecchia A: Origin, maturation and antigen presenting function of dendritic cells. Curr Opin Immunol 9:10, 1997[Medline] [Order article via Infotrieve]

5. Inaba K, Metlay JP, Crowley MT, Steinman RM: Dendritic cells pulsed with protein antigens in vitro can prime antigen-specific, MHC-restricted T cells in situ. J Exp Med 172:631, 1990[Abstract/Free Full Text]

6. Nair S, Zhou F, Reddy R, Huang L, Rouse BT: Soluble proteins delivered to dendritic cells via pH-sensitive liposomes induce primary cytotoxic T lymphocyte responses in vitro. J Exp Med 175:609, 1992[Abstract/Free Full Text]

7. Porgador A, Gilboa E: Bone-marrow-generated dendritic cells pulsed with a class I-restricted peptide are potent inducers of cytotoxic T lymphocytes. J Exp Med 182:255, 1995[Abstract/Free Full Text]

8. Celluzzi CM, Mayordomo JI, Storkus WJ, Lotze MT, Falo LD: Peptide-pulsed dendritic cells induce antigen-specific, CTL-mediated protective tumor immunity. J Exp Med 183:283, 1996[Abstract/Free Full Text]

9. Zitvogel L, Mayordomo JI, Tjandrawan T, DeLeo AB, Clarke MR, Lotze MT, Storkus WJ: Therapy of murine tumors with tumor peptide-pulsed dendritic cells: Dependence on T cells, B7 costimulation, and T helper cell 1-associated cytokines. J Exp Med 183:87, 1996[Abstract/Free Full Text]

10. Porgador A, Snyder D, Gilboa E: Induction of antitumor immunity using bone marrow-generated dendritic cells. J Immunol 156:2918, 1996[Abstract]

11. Paglia P, Chiodoni C, Rodolfo M, Colombo MP: Murine dendritic cells loaded in vitro with soluble protein prime cytotoxic T lymphocytes against tumor antigen in vivo. J Exp Med 183:317, 1996[Abstract/Free Full Text]

12. Brossart P, Goldrath AW, Butz EA, Martin S, Bevan MJ: Adenovirus mediated delivery of antigenic epitopes into DC by a means of CTL induction. J Immunol 158:3270, 1997[Abstract]

13. Caux C, Dezutter-Dambuyant C, Schmitt D, Banchereau J: GM-CSF and TNF-alpha cooperate in the generation of dendritic Langerhans cells. Nature 360:258, 1992[Medline] [Order article via Infotrieve]

14. Bernhard H, Disis ML, Heimfeld S, Hand S, Gralow JR, Cheever MA: Generetion of immunostimulatorry dendritic cells from human CD34+ hematopoetic progenitor cells of th bone marrow and periphereal blood. Cancer Res 55:1099, 1995[Abstract/Free Full Text]

15. Young JW, Szabolcs P, Moore MA: Identification of dendritic cell colony-forming units among normal human CD34+ bone marrow progenitors that are expanded by c-kit-ligand and yield pure dendritic cell colonies in the presence of granulocyte/macrophage colony-stimulating factor and tumor necrosis factor alpha. J Exp Med 183:1283, 1996

16. Fisch P, Köhler G, Garbe A, Herbst B, Wider D, Kohler H, Schaefer HE, Mertelsmann R, Brugger W, Kanz L: Generation of antigen-presenting cells for soluble protein antigens ex vivo from peripheral blood CD34+hematopoetic progenitor cells in cancer patients. Eur J Immunol 26:595, 1996[Medline] [Order article via Infotrieve]

17. Scheding S, Wirths S, Bühring HJ, Ziegler B, Bock T, Kanz L, Brugger W: FLT-3 ligand, TGF-beta , and GM-CSF/Il-4 are critical growth factors for the induction of CD1a+/CD14-/CD80+ dendritic cells (DC) from CD34+ peripheral blood progenitor cells in serum-free medium. Blood 90:478a, 1997

18. Flores-Romo L, Björck P, Duvert V, van Kooten C, Sealand S, Banchereau J: CD40 ligation on human cord blood CD34+ hematopoetic progenitors induces their proliferation and differentiation into functional dendritic cells. J Exp Med 185:341, 1997[Abstract/Free Full Text]

19. Sallusto F, Lanzavecchia A: Efficient presentation of soluble antigen by cultured human dendritic cells is maintained by granulocyte/macrophage colony stimulating factor plus lnterieukin 4 and down regulated by tumour necrosis factor alpha. J Exp Med 179:1109, 1994[Abstract/Free Full Text]

20. Sallusto F, Cella M, Danieli C, Lanzavecchia A: Dendritic cells use macropinocytosis and the mannose receptor to concentrate macromolecules in the Major Histocompatibility Complex class II compartment: Down regulation by cytokines and bacterial products. J Exp Med 182:389, 1995[Abstract/Free Full Text]

21. Zhou L, Tedder TF: CD14 blood monocytes can differentiate into functionally mature CD83+ dendritic cells. Proc Natl Acad Sci USA 93:2588, 1996[Abstract/Free Full Text]

22. Chapuis F, Rosenzwajg M, Yagello M, Ekman M, Biberfeld P, Gluckman JC: Differentiation of human dendritic cells from monocytes in vitro. Eur J Immunol 27:431, 1997[Medline] [Order article via Infotrieve]

23. Romani N, Reider D, Heuer M, Ebner S, Kampgen E, Eibl B, Niederwieser D, Schuler G: Generation of mature dendritic cells from human blood. An improved method with special regard to clinical applicability. J Immunol Methods 196:137, 1996[Medline] [Order article via Infotrieve]

24. Metcalf D, Shortman K, Vremec D, Migsud S, Di-Rago L: Effects of excess GM-CSF levels on hematopoesis and leukemia development in GM-CSF/macs 41 double transgenic mice. Leukemia 10:713, 1996[Medline] [Order article via Infotrieve]

25. Dranoff G, Crawford AD, Sadelain M, Ream B, Bronson RT, Dickersin GR, Bachurski CJ, Mark EL, Whitsett JA, Mulligan RC: Involvement of granulocyte-macrophage colony-stimulating factor in pulmonary homeostasis. Science 264:713, 1994[Abstract/Free Full Text]

26. Maraskowsky E, Brasel K, Teepe M, Roux ER, Lyman SD, Shortman K, McKenna HJ: Dramatic increase in the numbers of functionally mature dendritic cells in Flt3 ligand-treated mice: Multiple dendritic cell subpopulations identified. J Exp Med 184:1953, 1996[Abstract/Free Full Text]

27. Maraskowsky E, Roux E, Teepe M, McKenna HJ, Brasel K, Lyman SD, Williams DE: The effect of Flt3 ligand and/or c-kit ligand on the generation of dendritic cells from human CD34+ bone marrow. Blood 86:420, 1995

28. Strobl H, Bello-Fernandez C, Riedl E, Pickl WF, Majdic O, Lyman SD, Knapp W: Flt3 ligand in cooperation with transforming growth factor-1 potentiates in vitro development of Langerhans-type dendritic cells and allows single-cell dendritic cell cluster formation under serum-free conditions. Blood 90:1425, 1997[Abstract/Free Full Text]

29. Foy TM, Aruffo A, Bajorath J, Buhlmann JE, Noelle J: Immune regulation by CD40 and its ligand gp39. Annu Rev Immunol 14:591, 1996[Medline] [Order article via Infotrieve]

30. Grewal IS, Flavell RA: The role of CD40 ligand in costimulation and T-cell activation. Immunol Rev 153:85, 1996[Medline] [Order article via Infotrieve]

31. Van Kooten C, Banchereau J: Functions of CD40 on B cells, dendritic cells and other cells. Curr Opin Immunol 9:330, 1997[Medline] [Order article via Infotrieve]

32. Caux C, Massacrier C, Vianbervliet B, Dubois B, Van Kooten C, Durand I, Banchereau J: Activation of human dendritic cells through CD40 cross-linking. J Exp Med 180:1263, 1994[Abstract/Free Full Text]

33. Brossart P, Bevan MJ: Selective activation of Fas/Fas ligand-mediated cytotoxicity by a self-peptide. J Exp Med 183:2449, 1996[Abstract/Free Full Text]

34. Brossart P, Schmier JW, Krüger S, Willhauck M, Scheibenbogen C, Möhler T, Keilholz U: A polymerase chain reaction-based semiquantitative assessment of malignant melanoma cells in peripheral blood. Cancer Res 55:4065, 1995[Abstract/Free Full Text]

35. Adema GJ, Hartges F, Verstraten R, de Vries E, Marland G, Menon S, Foster J, Xu Y, Nooyen P, McClanahan T, Bacon KB, Figdor CG: A dendritic-cell-derived C-C chemokine that preferentially attracts naive T cells. Nature 387:713, 1997[Medline] [Order article via Infotrieve]

36. Okamura H, Tsutsi H, Komatsu T, Yutsudo M, Hakura A, Tanimoto T, Torigoe K, Okura T, Nukada Y, Hattori K, Akita K, Namba M, Tanabe F, Konishi K, Fukuda F, Kurimoto M: Cloning of a new cytokine that induces IFN-gamma production by T cells. Nature 378:88, 1995[Medline] [Order article via Infotrieve]

37. Ushio S, Namba M, Okura T, Hattori K, Nukada Y, Akita K, Tanabe F, Konishi K, Micallef M, Fujii M, Torigoe K, Tanimoto T, Fukuda S, Ikeda M, Okamura H, Kurimoto M: Cloning of the cDNA for human IFN-gamma-inducing factor, expression in Escherichia coli, and studies on the biologic activities of the protein. J Immunol 156:4274, 1996[Abstract]

38. Kohno K, Kataoka J, Ohtsuki T, Suemoto Y, Okamoto I, Usui M, Ikeda M, Kurimoto M: IFN-gamma-inducing factor (IGIF) is a costimulatory factor on the activation of Th1 but not Th2 cells and exerts its effect independently of IL-12. J Immunol 158:1541, 1997[Abstract]

39. Yoshimoto T, Okamura H, Tagawa YI, Iwakura Y, Nakahashi K: Interleukin 18 together with interleukin 12 inhibits IgE production by induction of interferon-production from activated B cells. Proc Natl Acad Sci USA 94:3948, 1997[Abstract/Free Full Text]

40. Stoll S, Müller G, Kurimoto M, Saloga J, Tanimoto T, Yamauchi H, Okamura H, Knop J, Enk AH: Production of IL-18 (IFN-gamma -inducing factor) messenger RNA and functional protein by murine keratinocytes. J Immunol 159:298, 1997[Abstract]

41. Lyman SD, James L, Bos TV, de Vries P, Brasel K, Gliniak B, Hollingworth LT, Picha KS, McKenna HJ, Splett RR, Fletcher FA, Maraskovsky E, Farrah T, Foxworthe D, Williams DE, Beckmann MP: Molecular cloning of a ligand for the flt3/flk-2 tyrosinase kinase receptor: A proliferative factor for primitive hematopoetic cells. Cell 75:1157, 1993[Medline] [Order article via Infotrieve]

42. Bevan MJ: Cross-priming for a secondary cytotoxic response to minor H antigens with H-2 congenic cells which do not cross-react in the cytotoxic assay. J Exp Med 143:1283, 1976[Abstract/Free Full Text]

43. York IA, Rock KL: Antigen processing and presentation by the class I major histocompatibility complex. Annu Rev Immunol 14:369, 1996[Medline] [Order article via Infotrieve]

44. Huang AYC, Golumbeck P, Ahmadzadeh M, Jaffee E, Pardoll D, Levitsky H: Role of bone marrow derived cells in presenting MHC class I-restricted tumour antigens. Science 264:961, 1994[Abstract/Free Full Text]

45. Norbury CC, Hewlett LJ, Prescott AR, Shastri N, Watts C: Class I MHC presentation of exogenous soluble antigen via macropinocytosis in bone marrow macrophages. Immunity 3:783, 1995[Medline] [Order article via Infotrieve]

46. Norbury CC, Chambers BJ, Prescott AR, Ljunggren HG, Watts C: Constitutive macropinocytosis allows TAP-dependent major histocompatibility complex class I presentation of exogenous soluble antigen by bone marrow-derived dendritic cells. Eur J Immunol 27:280, 1997[Medline] [Order article via Infotrieve]

47. Shen Z, Reznikoff G, Dranoff G, Rock KL: Cloned dendritic cells can present exogenous antigens on both MHC class I and class II molecules. J Immunol 158:2723, 1997[Abstract]

48. Brossart P, Bevan MJ: Presentation of exogenous antigens on MHC class I molecules by dendritic cells: Pathway of presentation and regulation by cytokines. Blood 90:1594, 1997[Abstract/Free Full Text]

49. Bennett SRM, Carbone FR, Karamalis F, Miller JFAP, Heath W: Induction of a CD8+ cytotoxic T lymphocyte response by cross-priming requires cognate CD4+ T cell help. J Exp Med 186:65, 1997[Abstract/Free Full Text]


© 1998 by The American Society of Hematology.
 
0006-4971/98/9211-0002$3.00/0

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Virol.Home page
B. A. Colleton, X.-L. Huang, N. M. Melhem, Z. Fan, L. Borowski, G. Rappocciolo, and C. R. Rinaldo
Primary Human Immunodeficiency Virus Type 1-Specific CD8+ T-Cell Responses Induced by Myeloid Dendritic Cells
J. Virol., June 15, 2009; 83(12): 6288 - 6299.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
S. Mariotti, V. Sargentini, C. Marcantonio, E. Todero, R. Teloni, M. C. Gagliardi, A. R. Ciccaglione, and R. Nisini
T-cell-mediated and antigen-dependent differentiation of human monocyte into different dendritic cell subsets: a feedback control of Th1/Th2 responses
FASEB J, September 1, 2008; 22(9): 3370 - 3379.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
Y. Yokoyama, F. Grunebach, S. M. Schmidt, A. Heine, M. Hantschel, S. Stevanovic, H.-G. Rammensee, and P. Brossart
Matrilysin (MMP-7) Is a Novel Broadly Expressed Tumor Antigen Recognized by Antigen-Specific T Cells
Clin. Cancer Res., September 1, 2008; 14(17): 5503 - 5511.
[Abstract] [Full Text] [PDF]


Home page
Rheumatology (Oxford)Home page
H. P. Carroll, V. Paunovic, and M. Gadina
Signalling, inflammation and arthritis: Crossed signals: the role of interleukin-15 and -18 in autoimmunity
Rheumatology, September 1, 2008; 47(9): 1269 - 1277.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. M. Hipp, N. Hilf, S. Walter, D. Werth, K. M. Brauer, M. P. Radsak, T. Weinschenk, H. Singh-Jasuja, and P. Brossart
Sorafenib, but not sunitinib, affects function of dendritic cells and induction of primary immune responses
Blood, June 15, 2008; 111(12): 5610 - 5620.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. M. Weck, S. Appel, D. Werth, C. Sinzger, A. Bringmann, F. Grunebach, and P. Brossart
hDectin-1 is involved in uptake and cross-presentation of cellular antigens
Blood, April 15, 2008; 111(8): 4264 - 4272.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
A. Landi, L. A. Babiuk, and S. van Drunen Littel-van den Hurk
High transfection efficiency, gene expression, and viability of monocyte-derived human dendritic cells after nonviral gene transfer
J. Leukoc. Biol., October 1, 2007; 82(4): 849 - 860.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
C. N. Boss, F. Grunebach, K. Brauer, M. Hantschel, V. Mirakaj, T. Weinschenk, S. Stevanovic, H.-G. Rammensee, and P. Brossart
Identification and Characterization of T-Cell Epitopes Deduced from RGS5, a Novel Broadly Expressed Tumor Antigen
Clin. Cancer Res., June 1, 2007; 13(11): 3347 - 3355.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. M. Weck, F. Grunebach, D. Werth, C. Sinzger, A. Bringmann, and P. Brossart
TLR ligands differentially affect uptake and presentation of cellular antigens
Blood, May 1, 2007; 109(9): 3890 - 3894.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. Moris, A. Pajot, F. Blanchet, F. Guivel-Benhassine, M. Salcedo, and O. Schwartz
Dendritic cells and HIV-specific CD4+ T cells: HIV antigen presentation, T-cell activation, and viral transfer
Blood, September 1, 2006; 108(5): 1643 - 1651.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
F. Grunebach, V. Mirakaj, V. Mirakaj, M. R. Muller, T. Brummendorf, and P. Brossart
BCR-ABL Is Not an Immunodominant Antigen in Chronic Myelogenous Leukemia
Cancer Res., June 1, 2006; 66(11): 5892 - 5900.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. Wierecky, M. R. Muller, S. Wirths, E. Halder-Oehler, D. Dorfel, S. M. Schmidt, M. Hantschel, W. Brugger, S. Schroder, M. S. Horger, et al.
Immunologic and Clinical Responses after Vaccinations with Peptide-Pulsed Dendritic Cells in Metastatic Renal Cancer Patients
Cancer Res., June 1, 2006; 66(11): 5910 - 5918.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P. d. Nadai, A.-S. Charbonnier, C. Chenivesse, S. Senechal, C. Fournier, J. Gilet, H. Vorng, Y. Chang, P. Gosset, B. Wallaert, et al.
Involvement of CCL18 in Allergic Asthma
J. Immunol., May 15, 2006; 176(10): 6286 - 6293.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
F. Nimura, L. F. Zhang, K. Okuma, R. Tanaka, H. Sunakawa, N. Yamamoto, and Y. Tanaka
Cross-linking cell surface chemokine receptors leads to isolation, activation, and differentiation of monocytes into potent dendritic cells.
Experimental Biology and Medicine, April 1, 2006; 231(4): 431 - 443.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Armeanu, M. Bitzer, I. Smirnow, S. Bossow, S. Appel, G. Ungerechts, C. Bernloehr, W. J. Neubert, U. M. Lauer, and P. Brossart
Severe Impairment of Dendritic Cell Allostimulatory Activity by Sendai Virus Vectors Is Overcome by Matrix Protein Gene Deletion
J. Immunol., October 15, 2005; 175(8): 4971 - 4980.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
E. Schutyser, A. Richmond, and J. Van Damme
Involvement of CC chemokine ligand 18 (CCL18) in normal and pathological processes
J. Leukoc. Biol., July 1, 2005; 78(1): 14 - 26.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
S. Appel, A. Rupf, M. M. Weck, O. Schoor, T. H. Brummendorf, T. Weinschenk, F. Grunebach, and P. Brossart
Effects of Imatinib on Monocyte-Derived Dendritic Cells Are Mediated by Inhibition of Nuclear Factor-{kappa}B and Akt Signaling Pathways
Clin. Cancer Res., March 1, 2005; 11(5): 1928 - 1940.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
A. Moldenhauer, R. C. Frank, J. Pinilla-Ibarz, G. Holland, P. Boccuni, D. A. Scheinberg, A. Salama, K. Seeger, M. A. S. Moore, and S. D. Nimer
Histone deacetylase inhibition improves dendritic cell differentiation of leukemic blasts with AML1-containing fusion proteins
J. Leukoc. Biol., September 1, 2004; 76(3): 623 - 633.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
L. A.B. Joosten, R. L. Smeets, M. I. Koenders, L. A.M. van den Bersselaar, M. M.A. Helsen, B. Oppers-Walgreen, E. Lubberts, Y. Iwakura, F. A.J. van de Loo, and W. B. van den Berg
Interleukin-18 Promotes Joint Inflammation and Induces Interleukin-1-Driven Cartilage Destruction
Am. J. Pathol., September 1, 2004; 165(3): 959 - 967.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
K. C. Roy, G. Bandyopadhyay, S. Rakshit, M. Ray, and S. Bandyopadhyay
IL-4 alone without the involvement of GM-CSF transforms human peripheral blood monocytes to a CD1adim, CD83+ myeloid dendritic cell subset
J. Cell Sci., July 15, 2004; 117(16): 3435 - 3445.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
S. Kubo, H. K. Takahashi, M. Takei, H. Iwagaki, T. Yoshino, N. Tanaka, S. Mori, and M. Nishibori
E-Prostanoid (EP)2/EP4 Receptor-Dependent Maturation of Human Monocyte-Derived Dendritic Cells and Induction of Helper T2 Polarization
J. Pharmacol. Exp. Ther., June 1, 2004; 309(3): 1213 - 1220.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. R. Muller, G. Tsakou, F. Grunebach, S. M. Schmidt, and P. Brossart
Induction of chronic lymphocytic leukemia (CLL)-specific CD4- and CD8-mediated T-cell responses using RNA-transfected dendritic cells
Blood, March 1, 2004; 103(5): 1763 - 1769.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. M. Schmidt, K. Schag, M. R. Muller, T. Weinschenk, S. Appel, O. Schoor, M. M. Weck, F. Grunebach, L. Kanz, S. Stevanovic, et al.
Induction of Adipophilin-Specific Cytotoxic T Lymphocytes Using a Novel HLA-A2-Binding Peptide That Mediates Tumor Cell Lysis
Cancer Res., February 1, 2004; 64(3): 1164 - 1170.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Appel, A. M. Boehmler, F. Grunebach, M. R. Muller, A. Rupf, M. M. Weck, U. Hartmann, V. L. Reichardt, L. Kanz, T. H. Brummendorf, et al.
Imatinib mesylate affects the development and function of dendritic cells generated from CD34+ peripheral blood progenitor cells
Blood, January 15, 2004; 103(2): 538 - 544.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. M. Schmidt, K. Schag, M. R. Muller, M. M. Weck, S. Appel, L. Kanz, F. Grunebach, and P. Brossart
Survivin is a shared tumor-associated antigen expressed in a broad variety of malignancies and recognized by specific cytotoxic T cells
Blood, July 15, 2003; 102(2): 571 - 576.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. R. Muller, F. Grunebach, A. Nencioni, and P. Brossart
Transfection of Dendritic Cells with RNA Induces CD4- and CD8-Mediated T Cell Immunity Against Breast Carcinomas and Reveals the Immunodominance of Presented T Cell Epitopes
J. Immunol., June 15, 2003; 170(12): 5892 - 5896.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
H. K. Takahashi, T. Morichika, H. Iwagaki, T. Yoshino, R. Tamura, S. Saito, S. Mori, T. Akagi, N. Tanaka, and M. Nishibori
Effect of {beta}2-Adrenergic Receptor Stimulation on Interleukin-18-Induced Intercellular Adhesion Molecule-1 Expression and Cytokine Production
J. Pharmacol. Exp. Ther., February 1, 2003; 304(2): 634 - 642.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
C. Milazzo, V. L. Reichardt, M. R. Muller, F. Grunebach, and P. Brossart
Induction of myeloma-specific cytotoxic T cells using dendritic cells transfected with tumor-derived RNA
Blood, February 1, 2003; 101(3): 977 - 982.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
M. Rosenzwajg, F. Jourquin, L. Tailleux, and J. C. Gluckman
CD40 ligation and phagocytosis differently affect the differentiation of monocytes into dendritic cells
J. Leukoc. Biol., December 1, 2002; 72(6): 1180 - 1189.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Wysocka, M. H. Zaki, L. E. French, J. Chehimi, M. Shapiro, S. E. Everetts, K. S. McGinnis, L. Montaner, and A. H. Rook
Sezary syndrome patients demonstrate a defect in dendritic cell populations: effects of CD40 ligand and treatment with GM-CSF on dendritic cell numbers and the production of cytokines
Blood, October 16, 2002; 100(9): 3287 - 3294.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Wirths, J. Reichert, F. Grunebach, and P. Brossart
Activated CD8+ T Lymphocytes Induce Differentiation of Monocytes to Dendritic Cells and Restore the Stimulatory Capacity of Interleukin 10-treated Antigen-presenting Cells
Cancer Res., September 1, 2002; 62(17): 5065 - 5068.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Nencioni, F. Grunebach, A. Zobywlaski, C. Denzlinger, W. Brugger, and P. Brossart
Dendritic Cell Immunogenicity Is Regulated by Peroxisome Proliferator-Activated Receptor {gamma}
J. Immunol., August 1, 2002; 169(3): 1228 - 1235.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
Y.-D. Wang, Z.-J. Gu, J.-A. Huang, Y.-B. Zhu, Z.-H. Zhou, W. Xie, Y. Xu, Y.-H. Qiu, and X.-G. Zhang
gp130-linked signal transduction promotes the differentiation and maturation of dendritic cells
Int. Immunol., June 1, 2002; 14(6): 599 - 603.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. K. Basak, A. Harui, M. Stolina, S. Sharma, K. Mitani, S. M. Dubinett, and M. D. Roth
Increased dendritic cell number and function following continuous in vivo infusion of granulocyte macrophage-colony-stimulating factor and interleukin-4
Blood, April 15, 2002; 99(8): 2869 - 2879.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
G. Zheng, A. Chen, R. E. Sterner, P. J. Zhang, T. Pan, N. Kiyatkin, and M. L. Tykocinski
Induction of Antitumor Immunity via Intratumoral Tetra-Costimulator Protein Transfer
Cancer Res., November 1, 2001; 61(22): 8127 - 8134.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
P. Brossart, A. Schneider, P. Dill, T. Schammann, F. Grunebach, S. Wirths, L. Kanz, H.-J. Buhring, and W. Brugger
The Epithelial Tumor Antigen MUC1 Is Expressed in Hematological Malignancies and Is Recognized by MUC1-specific Cytotoxic T-Lymphocytes
Cancer Res., September 1, 2001; 61(18): 6846 - 6850.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. Novak, T. Bieber, and N. Katoh
Engagement of Fc{{epsilon}}RI on Human Monocytes Induces the Production of IL-10 and Prevents Their Differentiation in Dendritic Cells
J. Immunol., July 15, 2001; 167(2): 797 - 804.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. Vankayalapati, B. Wizel, D. L. Lakey, Y. Zhang, K. A. Coffee, D. E. Griffith, and P. F. Barnes
T Cells Enhance Production of IL-18 by Monocytes in Response to an Intracellular Pathogen
J. Immunol., June 1, 2001; 166(11): 6749 - 6753.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. Caron, Y. Delneste, E. Roelandts, C. Duez, N. Herbault, G. Magistrelli, J.-Y. Bonnefoy, J. Pestel, and P. Jeannin
Histamine Induces CD86 Expression and Chemokine Production by Human Immature Dendritic Cells
J. Immunol., May 15, 2001; 166(10): 6000 - 6006.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Seiffert, P. Brossart, C. Cant, M. Cella, M. Colonna, W. Brugger, L. Kanz, A. Ullrich, and H.-J. Buhring
Signal-regulatory protein {alpha} (SIRP{alpha}) but not SIRP{beta} is involved in T-cell activation, binds to CD47 with high affinity, and is expressed on immature CD34+CD38{-} hematopoietic cells
Blood, May 1, 2001; 97(9): 2741 - 2749.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Yu, M. Hagihara, K. Ando, B. Gansuvd, H. Matsuzawa, T. Tsuchiya, Y. Ueda, H. Inoue, T. Hotta, and S. Kato
Enhancement of Human Cord Blood CD34+ Cell-Derived NK Cell Cytotoxicity by Dendritic Cells
J. Immunol., February 1, 2001; 166(3): 1590 - 1600.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
P. Brossart, S. Wirths, G. Stuhler, V. L. Reichardt, L. Kanz, and W. Brugger
Induction of cytotoxic T-lymphocyte responses in vivo after vaccinations with peptide-pulsed dendritic cells
Blood, November 1, 2000; 96(9): 3102 - 3108.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
R. S. Kornbluth
The emerging role of CD40 ligand in HIV infection
J. Leukoc. Biol., September 1, 2000; 68(3): 373 - 382.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
C. Klein, H. Bueler, and R. C. Mulligan
Comparative Analysis of Genetically Modified Dendritic Cells and Tumor Cells as Therapeutic Cancer Vaccines
J. Exp. Med., May 15, 2000; 191(10): 1699 - 1708.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. D. Roth, B. J. Gitlitz, S. M. Kiertscher, A. N. Park, M. Mendenhall, N. Moldawer, and R. A. Figlin
Granulocyte Macrophage Colony-stimulating Factor and Interleukin 4 Enhance the Number and Antigen-presenting Activity of Circulating CD14+ and CD83+ Cells in Cancer Patients
Cancer Res., April 1, 2000; 60(7): 1934 - 1941.
[Abstract] [Full Text]


Home page
J. Gen. Virol.Home page
S. Riegler, H. Hebart, H. Einsele, P. Brossart, G. Jahn, and C. Sinzger
Monocyte-derived dendritic cells are permissive to the complete replicative cycle of human cytomegalovirus
J. Gen. Virol., February 1, 2000; 81(2): 393 - 399.
[Abstract] [Full Text]


Home page
J. Immunol.Home page
K. Crawford, D. Gabuzda, V. Pantazopoulos, J. Xu, C. Clement, E. Reinherz, and C. A. Alper
Circulating CD2+ Monocytes Are Dendritic Cells
J. Immunol., December 1, 1999; 163(11): 5920 - 5928.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Seiffert, C. Cant, Z. Chen, I. Rappold, W. Brugger, L. Kanz, E. J. Brown, A. Ullrich, and H.-J. Buhring
Human Signal-Regulatory Protein Is Expressed on Normal, But Not on Subsets of Leukemic Myeloid Cells and Mediates Cellular Adhesion Involving Its Counterreceptor CD47
Blood, December 1, 1999; 94(11): 3633 - 3643.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brossart, P.
Right arrow Articles by Brugger, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brossart, P.
Right arrow Articles by Brugger, W.
Related Collections
Right arrow Immunobiology
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 1998 by American Society of Hematology         Online ISSN: 1528-0020