|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 92 No. 11 (December 1), 1998:
pp. 4394-4403
Description and Targeted Deletion of 5 Hypersensitive Site 5 and 6 of the Mouse -Globin Locus Control Region
By
M.A. Bender,
Andreas Reik,
Jennie Close,
Agnes Telling,
Elliot Epner,
Steven Fiering,
Ross Hardison, and
Mark Groudine
From the Fred Hutchinson Cancer Research Center, Seattle, WA; the
Departments of Pediatrics and Radiation Oncology, University of
Washington School of Medicine, Seattle, WA; the Department of
Microbiology, Dartmouth Medical School, Hanover, NH; and the Department
of Biochemistry and Molecular Biology, Pennsylvania State University,
University Park, PA.
 |
ABSTRACT |
The most upstream hypersensitive site (HS) of the
-globin locus control region (LCR) in humans (5
HS 5) and chickens (5 HS 4) can act as an insulating element in
some gain of function assays and may demarcate a -globin domain. We
have mapped the most upstream HSs of the mouse -globin LCR and
sequenced this region. We find that mice have a region homologous to
human 5 HS 5 that is associated with a minor HS. In addition we
map a unique HS upstream of 5 HS 5 and refer to this novel site
as mouse 5 HS 6. We have also generated mice containing a
targeted deletion of the region containing 5 HS 5 and 6. We find
that after excision of the selectable marker in vivo, deletion of
5 HS 5 and 6 has a minimal effect on transcription and does not prevent formation of the remaining LCR HSs. Taken together these findings suggest that the most upstream HSs of the mouse -globin LCR
are not necessary for maintaining the -globin locus in an active
configuration or to protect it from a surrounding repressive chromatin
environment.
© 1998 by The American Society of Hematology.
 |
INTRODUCTION |
THE MULTIGENE -globin locus is subject
to tissue-specific and developmental regulation. Transcription of the
locus is restricted to erythroid cells, and each gene is expressed
during specific developmental stages.1 Initial
evidence that regions far upstream of the -like globin genes are
important for regulation of the locus was derived from the analysis of
naturally occurring deletions in the human locus that result in the
transcriptional silencing of the cis-linked genes.2-4 These
regions encompass 5 DNase I hypersensitive sites (5 HS 1-5)
located 6-22 kilobases (kb) 5 of the human -globin gene. When
analyzed in human tissues or after passage of human transgenes through
the mouse germline, the formation of 5 HS 1-5 is restricted to
erythroid cells; however, 5 HS 2 and 5 HS 5 have been
observed in nonerythroid cell lines.5-9
Linkage of large restriction fragments containing these 5 HSs to
a human -globin gene leads to high level, position-independent expression in transgenic mice.10,11 This observation is in contrast with earlier studies in which isolated globin transgenes showed extensive variation in expression with the site of integration. This ability to overcome integration site effects of linked genes defines the locus control region (LCR). Analysis of a naturally occurring deletion of 5 HS 2-5 and ~20 kb upstream of this
region (Hispanic thalassemia) suggests that the LCR has an important role in regulation of chromatin structure and replication, as well as
transcription.3,12,13 The Hispanic thalassemia deletion leads to an alteration of the generalized DNase I sensitivity of the
locus, alterations in the timing of replication and origin used, and
the transcriptional silencing of the locus.12,13
Extensive analysis has attempted to determine which sequences within
the LCR are necessary for activity and how these sequences may
interact. Each HS is associated with a several hundred base pair (bp)
core region of homology that is highly conserved in evolution,
suggesting that these HS cores may be important for LCR
function.14 Individual HSs and combinations of HSs have been assayed for the ability to direct high-level expression of linked
genes in erythroid cells in transient and stable expression assays in
tissue culture and in transgenic mice. The results can be summarized as
(1) individually, 5 HS 2 and 3 have enhancer activity in both
transient and stable assays, whereas sites 2, 3, and 4 lead to
high-level expression in transgenic mice. 5 HS 1 and 5 have no
demonstrable effects on expression in these assays; (2) combinations or
arrays of individual HSs or the whole LCR have more activity than
single HSs; and (3) activity of LCR fragments is restricted to
erythroid cells.14
Although these studies have yielded valuable information concerning LCR
structure and function, these results may be difficult to extrapolate
to the intact LCR at its endogenous location due to differences in (1)
the spatial organization of the LCR fragments and reporter gene(s)
used, (2) whether the construct is integrated or not, (3) integration
site position effects, (4) the copy number, (5) the species used, and
(6) whether the construct has been passed through the germline. Several
groups have attempted to overcome these potential limitations by
generating transgenic mice containing low copy number yeast or
P1-derived artificial chromosomes. However, it is now clear that this
approach is also vulnerable to integration site effects, as well as
potential cross species effects that complicate the analysis of
regulatory elements.15,16
To circumvent these potential problems, we have analyzed the endogenous
mouse -globin locus by generation of specific LCR mutations using
homologous recombination (HR) in ES cells followed by the generation of
mutant mice. Previously this approach has been used to generate mice
lacking 5 HS 2 and 5 HS 3, two sites shown to activate
transcription in a variety of systems.17,18 Developmental
analysis of these mice showed that the presence of a selectable marker
gene in the LCR (an unavoidable consequence of HR) leads to dramatic
effects on the transcriptional phenotype. Thus, our strategy includes
recombinase-mediated removal of the selectable marker after HR. When
mice and embryos lacking either 5 HS 2 or 3 and the selectable
marker were analyzed, minor decreases in expression were detected, but
no change in the timing or tissue specificity of expression were noted.
The role that 5 HS 5, the most 5 HS defined in the human
locus, plays in regulation of the -globin locus is still unknown. Gain of function assays have not revealed a role for 5 HS 5 in the direct activation of expression.19-22 Human 5 HS
5 and the corresponding region of galago have been sequenced and are
notable for two regions of homology.23 The first is an
~500-bp region to which human 5 HS 5 maps and that contains
several conserved phylogenetic blocks and two consensus CACC binding
protein (CACC BP) motifs. The second region is ~200 bp and contains
one of the two Drosophila topoisomerase II consensus binding sites that
map to the region. Both regions map to a 2.6-kb restriction fragment that has been shown to be a scaffold attachment region
(SAR).24 Because this region contains the most 5 HS
of the locus, is an SAR, is conserved in evolution, yet has no direct
effect on expression, it has been suggested that this region may be
important as a boundary or insulator element and might be important for
defining the 5 extent of a -globin locus
"domain."8,14,19,21,22,24,25
Two groups have shown that the most 5 HS of the chicken
-globin locus, chicken 5 HS 4, marks a transition in
chromatin structure of the region in erythroid cells.26,27
In contrast to the region upstream of chicken 5 HS 4, the chick
-globin domain downstream of 5 HS 4 is uniformly sensitive to
DNase I, and histone H4 in this region is highly acetylated. In
addition, chicken 5 HS 4 has been shown to have insulator
activity in several stable transformation systems and has more activity
when present in high copy number.19,28 In contrast to the
experimental evidence for chicken 5 HS 4, analysis of human
5 HS 5 has not revealed a consistent biologic role. For example,
it has been reported that human 5 HS 5 has a weak ability to
insulate a reporter gene from activation by mouse 5 HS 2 in a
stable transformant assay, and that single copies of human 5 HS
5 are capable of insulating a reporter gene from the activation effects
of human 5 HS 3 in an expression level assay.19,21
Similarly, two groups report that single copies of human 5 HS 5 flanking reporter genes lead to less variability of expression amongst
clones, suggesting that the reporter gene may be insulated from
integration site effects.20,22 In contrast, a single copy
of human 5 HS 5 did not insulate a human -globin gene from
activation by 5 HS 1-4 in single copy transgenic
lines.9 Thus, the function of human 5 HS 5 remains highly speculative.
To determine the function of the most 5 HS of the murine
-globin locus at its endogenous location, we have mapped and
sequenced the region upstream of mouse 5 HS 4 and find the
homologue to human 5 HS 5 as well as a unique HS further
upstream. We have generated mice lacking this region and show that
deletion of this region has no significant effect on erythroid or
nonerythroid expression of the locus.
 |
MATERIALS AND METHODS |
Cloning and sequencing of mouse 5 HS 5 and 6.
Clones containing mouse 5 HS 4, 5, and 6 were isolated from a
129-mouse library derived from AK-7 ES cells (gift of A. Imamoto and P. Soriano, Fred Hutchinson Cancer Research Center) using 5 HS 4 as a probe ( 21,221 to 20,509 relative to
the Ey cap). A clone with a 15-kb insert was isolated and subcloned
using standard methods. Sequencing was done using dye terminators and
universal or custom synthesized primers on an ABI 377XL automated
sequencer. At a minimum, both strands of all regions were sequenced but
for most regions the sequence was determined from at least three
overlapping sequence runs (GenBank Accession No. AF071080). Homologies were generated using the computer program L-FASTA (W.R.
Pearson, University of Virginia). Pairwise alignments and multiple
alignments were generated using the computer programs sim and yama2,
respectively.29-31 The generation of percent identity plots
(PIPs) was as described.32
DNase I hypersensitive site mapping.
Cells were isolated from the spleens of 129 mice 4 to 6 days after a
phenylhydrazine induced hemolytic anemia, at which time at least 50%
of the cells are erythroid.26 Hypersensitive site mapping
was confirmed using mouse erythroleukemia (MEL) cells. Isolation of
nuclei, digestion with DNase I, restriction enzyme digestion, and
blotting were done as previously described.13 Mapping was
done using probes hybridizing to both upstream and downstream extents
of the appropriate restriction fragments. Probes used were restriction
enzyme fragments or obtained by polymerase chain reaction (PCR). Probes
used map to the following nucleotides with respect to the Ey cap:
33,780 to 33,145 (KH end), 29,645 to 28,991
(LCR probe 1), 28,979 to 27,981 (KP middle),
27,974 to 27,558 (LCR probe 2), 22,193 to
21,416 (LCR probe 3), 14,684 to 14,118 (LCR probe
4), and 3,468 2,868 (Nhe Hpa).
Targeted deletion of mouse 5 HS 5 and 6.
The 3.5-kb region from a Hpa I site at 28,560 to a
EcoRV site at 25,062 relative to the Ey cap was replaced
with a PGK-hygro selectable marker flanked by loxP sites, destroying
both restriction enzyme sites in the process. The targeting construct
had 5.2 kb and 3.7 kb of flanking 5 and 3 homology,
respectively, as well as a MC HSV-TK gene to allow negative selection
for nonhomologous recombinants. Linearized targeting vector (30 to 60 µg) was electroporated into AK7 ES cells (gift of A. Imamoto and P. Soriano) and grown on mitomycin C treated feeders that are hygromycin
resistant and produce leukemia inhibitory factor (gift of B. Zambrowicz
[Fred Hutchinson Cancer Research Center] and P. Soriano). Cells were selected in 150 µg/mL hygromycin B (Calbiochem, San
Diego, CA) and 2 µg/mL gancyclovir. Gancyclovir gave a 2.5- to 5-fold
enrichment. Resistant colonies were expanded and screened by Southern
blotting, and clones with the correct structure were injected into C57
blastocysts using standard techniques. To faithfully excise the
selectable marker, mice carrying the 5,6 Hygro mutation were bred to
mice containing a cytomegalovirus (CMV)-Cre transgene
(TgN[CMV-Cre]1AN).33 All offspring that inherited Cre and
a 5,6 Hygro allele showed evidence of a site specific recombination
event by Southern blotting. To assure that the presence of the Cre
protein was not a factor, these mice were bred again and only animals
with a correct 5,6 Hygro structure and lacking the Cre transgene
were used for further study. Cre was detected by PCR using the
following primers: Cre F ACCTGATGGACATGTTCAGG, and Cre R
CTACACCTGCGGTGCTAAC.
Reverse-transcription polymerase chain reaction (RT-PCR) assays.
RNA isolation and RT-PCR was done as described previously except that
RT reactions were done at 37°C.17 Gels were quantitated with a PhosphoImager and ImageQuant software (Molecular Dynamics, Sunnyvale, CA). The value for each band was normalized to background and adjusted for the number of cytosine residues. In addition to
wild-type controls, all gels contained at least duplicate wild-type S/D
samples from the same RT sample. The D to S ratio from these controls
was averaged and adjusted to 1.0. All other D to S ratios from the gel
were adjusted by the same factor. Primers were as described.17
 |
RESULTS |
Mapping and sequencing of mouse 5 HS 5 and 6.
5 HS 5 is the most 5 HS described in the human -globin
locus and has been mapped and sequenced.5,8,22 Until now, the most 5 mapped HS in mouse was 5 HS 4, which is highly
conserved in evolution.34 To determine if the mouse locus
contains an additional 5 HS analogous to human, a nonrepetitive
probe immediately 3 of mouse 5 HS 4 was used to clone
11.5-kb 5 to 5 HS 4 from an ES cell library. Probes
downstream of 5 HS 4 and from the 5 end of this clone
were used to map DNase I HSs in MEL cells and erythroid cells isolated
from the spleens of anemic 129 strain mice. In addition to 5 HS
4, which maps at 22.5 kb relative to the cap site of the Ey
gene, four HSs of varying intensity map to approximately 23.3,
24.8, 26.1, and 28.4 kb
(Figs 1A and B, 2, and
3). No HSs were detectable from 28.5 to 34.3
kb (Fig 3 and data not shown).

View larger version (11K):
[in this window]
[in a new window]

View larger version (13K):
[in this window]
[in a new window]
| Fig 1.
Analysis of the upstream region of the mouse -globin
LCR. (A) Map of the 5 HS 4, 5 and 6 region. Upper solid black
line represents the 5 HS 4, 5, and 6 region and restriction
enzyme sites used for HS mapping. Alignment: boxes with diagonal cross
hatch represent regions that can be aligned with the human locus using
the program yama2. Homology: boxes with vertical hatch represent
regions with >40% identity with human and are a more stringent gauge
of homology. HSs: arrows show HSs and their relative intensity. Mouse
HSs are placed relative to the mouse map, whereas human HSs are placed
relative to the homologous regions of the mouse sequence. The numbers
above the arrows are the map positions relative to the Ey cap of the
mouse HSs. Bottom diagram represents the targeting construct that
deletes HS 5, HS 6 and the region of homology to human HS 5. Arrows and
black stripes represent loxP sites that flank the construct.
Restriction enzyme sites: S- SphI, H- HpaI, X- XbaI. (B) Sequence
features in the 5 HS 4, 5, and 6 region. Regions that each HS
maps to are represented by open rectangles. L1 and B2 repeat elements
are represented by a gray rectangle and triangle, respectively. The
black bar represents the region deleted by homologous recombination.
The striped line represents the thymidine-rich tract. Below the map is
a PIP of the mouse-human comparison of the region. The percent identity
in each gap-free aligning segment is plotted using coordinates of the
mouse sequence with the cap site of the Ey gene being +1. Cross
hatching indicates the region for which no human sequence is available
for comparison. The lines above the map show sequence features as noted
below. In each case short lines mark any occurrence of the specified
sequence and tall lines mark sites that are conserved between mouse,
human, and galago. Invariant: blocks of at least 7 bp that are
invariant in mouse, human, and galago. GATA-1: sites matching the
consensus WGATAR. MARE: sites matching the Maf-associated response
element consensus TGASTCA. Several basic leucine zipper proteins
contain this motif in their consensus binding sequence including NFE-2,
AP-1, and LCRF1/Nrf1. EKLF: sites matching the consensus CCNCNCCC. BKLF
also has been shown to bind this consensus. CACC BP: sites matching the
consensus CACC, a sequence motif common to Krüppel-like Zn finger
proteins such as Sp1 and EKLF. ATTTA/TATTT: sites matching the
specified sequences.
|
|

View larger version (46K):
[in this window]
[in a new window]
| Fig 2.
Mapping of mouse 5 HS 4 and 5. Wild-type 129 mice
were treated with phenylhydrazine as described, and nuclei were
isolated from spleen cells on day 4. A DNase I series was generated,
digested with Sph I (S) to completion, Southern blotted, and
hybridized with a 5 probe. The "0" lane shows the expected
parent band in untreated nuclei followed by samples having undergone
increasing DNase I digestion. Degradation bands map to 22.5 kb,
23.3 kb, 24.8 kb, and 26.1 kb relative to the Ey cap (in
parentheses), which we refer to as 5 HS 4, 4.1, 4.2 and 5, respectively (see text). An additional band mapping to 28.4 kb maps
to this region but is outside the range of resolution of this gel.
Molecular size standards are marked on the left. The size of the parent
band, placement of the probe used (KP middle), and the size of the
degradation bands are diagrammed below. Sph I cuts at 14,121
and 30,281 relative to the Ey cap. Mapping of the sites was
confirmed by hybridizing with a probe from the 3 end of the same
restriction fragment as well as mapping with additional restriction
enzymes (data not shown).
|
|

View larger version (45K):
[in this window]
[in a new window]
| Fig 3.
Mapping of mouse 5 HS 6. The same wild-type
129-mouse erythroid DNase I series displayed in Fig 2 was digested with
Xba I (X), Southern blotted, and hybridized with a probe on the
5 end. Molecular size standards are marked on the left. The
"0" lane shows the expected parent band in untreated nuclei
followed by samples having undergone increasing DNase I digestion. The
expected 6.9-kb parent band and a degradation band that maps to 28.4
kb (in parentheses), which we refer to as 5 HS 6 (see text), are
observed. The size of the parent band, placement of the probe used (KH
end), and the size of the degradation band are diagrammed below.
Xba I cuts at 27,346 and 34,263 relative to the Ey cap.
Mapping of the site was confirmed by hybridizing with a probe from the
3 end of the same restriction fragment as well as mapping with
additional restriction enzymes (data not shown).
|
|
To identify and compare the murine sequence with human and galago, a
segment of ~7 kb upstream of mouse 5 HS 4 was sequenced. Sequence was analyzed to identify (1) regions of homology (regions with
greater than 40% identity to the human sequence), (2) regions of
alignment (regions with lesser homology that nonetheless could be
aligned with human and galago sequences under less stringent conditions), (3) invariant blocks (blocks of at least 7 bp that are
invariant in mouse, human, and galago), (4) putative transcription factor binding sites present in other LCR HS regions, and (5) motifs
that are repeated elsewhere in the LCR (Fig 1A and B).
Four regions of the mouse sequence that align with human and galago can
be distinguished, and notably, HSs map to three of these. We have
compared sequence and HS patterns in the mouse with human and galago to
name these HSs. The longest region of alignment is 1.4 kb, is centered
at 26.0 kb, and contains six invariant blocks. The least intense
HS, present at the limit of detection, maps to the center of this
region. This region has ~60% identity to the region that human
5 HS 5 has been mapped to (Fig 1A and B). Despite this being a
minor HS in the mouse, its coincidence with the region of homology with
human 5 HS 5 identifies this site as mouse 5 HS 5. A
short 59-bp region at 23.3 kb maps near a relatively weak HS.
Within the precision of the HS mapping, this block of homology falls
within the mouse HS. No equivalent HS is seen in the human -globin
LCR. Because this is the first HS upstream of 5 HS 4, and
5 HS 5 has been defined, we call this site 5 HS 4.1. This
nomenclature is advantageous in that HSs that are conserved
evolutionarily maintain identical numbering regardless of whether
additional sites are present in some species. A short 78-bp region at
24.8 kb has a string of potential GATA-1 binding sites; this
string is shorter in mouse compared with human and galago. One GATA
site is conserved in all three species and is part of an invariant
10-bp block (Fig 1B). A moderately intense HS maps to this region. No
comparable HS has been mapped to the homologous region in humans.
Because this is the second HS upstream of 5 HS 4 that is present
in mouse but not human, we call this 5 HS 4.2. Finally, a long
709-bp region, centered at 24.1 kb, contains three invariant
blocks and a 130-bp subregion with 68% identity with human (Fig 1A and B). Of note, no HS maps within this region.
The region containing mouse 5 HS 5 differs from the homologous
region of human 5 HS 5 in several ways in addition to those noted above. The consensus sequences of binding sites for
Krüppel-like Zn finger proteins such as Sp1 and EKLF can contain
a CACC motif; thus, they have been designated CACC BPs (CACC binding
proteins). This motif is conserved in several LCR
HSs.14,25,35 Human 5 HS 5 is centered on a pair of
CACC motifs that are part of a 20-bp dyad that is conserved in
galago.14 These CACC BP sites are not present in mouse and
may explain the disparity in the intensity of the HSs amongst species.
In addition, several HSs from -globin LCRs contain consensus
sequences for Maf recognition elements (MAREs).14,36,37
Several basic leucine zipper-containing proteins, including NFE-2 and
LCRF1/Nfr1, recognize this core consensus (TGASTCA), and it has been
suggested that the homo- and heterodimeric proteins that recognize
MAREs play an important regulatory role in
differentiation.36 In addition to the invariant blocks
noted above, the region encompassing mouse 5 HS 5 maps contains
one of only two MAREs in this 7-kb region (Fig 1B). This motif is not
conserved in the primate sequences. Of note, the second MARE is at
26.9 kb, just 5 to the beginning of the available sequence from human and galago. This MARE is within a 157-bp region of
mouse sequence that also contains two CACC motifs and a GATA site.
Finally, a 2.6-kb HindIII fragment that contains human 5 HS 5 is notable for being an SAR, a region that has been associated with topoisomerase II binding sites.22,24 In addition
topoisomerase II cleavage sites in the chicken -globin locus map to
DNase I HSs.26 The human 5 HS 5 region contains two
blocks that contain single-base differences from the Drosophila
topoisomerase II consensus sequence,22 but these are not
conserved in the mouse.
The mouse -globin LCR contains an additional HS
upstream of 5 HS 5.
An additional major HS maps 2.3 kb 5 to mouse 5 HS 5 at
28.4 kb (Fig 3). No additional HSs are detectable in the 5.8 kb upstream of this site in erythroid tissues. The absence of available DNA sequence from homologous region of other species precludes an
assessment of sequence conservation. We refer to this HS as mouse
5 HS 6. The region encompassing 5 HS 6 contains a high density of potential binding sites for the erythroid transcription factor GATA-1, (Fig 1B), consistent with several other -globin LCR
HSs.
The sequence upstream of 5 HS 4 was analyzed for the presence of
other potential transcription factor binding sites and sequence motifs
noted to occur in -globin LCRs of several
species.14,25,35 As above, in contrast to the rest of the
LCR, the region upstream of mouse 5 HS 4 shows little similarity
with the primate sequences. EKLF binding has been shown to be important
for the expression of adult -globin genes, and it has been suggested
that it may mediate LCR-promoter interactions.38,39 Three
potential EKLF sites are in this segment of the mouse sequence, one in
HS 4 and two in the region with no sequence from other species (Fig
1B). Several CACC motifs are in the mouse sequence, but none are
conserved in human and galago (Fig 1B). Previously it was noted that
the motifs ATTTA and TATTT are conserved in several regions of the LCR,14 as exemplified by the HS 4 region, but despite the
presence of many such sites in the mouse 5 HS 4 through 5
HS 5 region, none are conserved (Fig 1B). Finally, a thymidine-rich
track, with thymidine residues comprising 106 of 132 nucleotides, is immediately upstream of HS 4 but is not conserved in the primate sequences.
Targeted deletion of mouse 5 HS 5 and 6.
To delete the most 5 HSs, a targeting vector was designed that
would delete a 3.5-kb region containing mouse 5 HS 6, as well as
mouse 5 HS 5 and the region of homology with human 5 HS 5 (Fig 1A). Previously we determined that the presence of a selectable
marker within the LCR dramatically affects expression of the linked
globin genes.17,18,40,41 Thus, we used a selectable marker
(PGK-hygro) flanked by loxP sites, the recognition sequence for the Cre
recombinase. We have previously shown the utility of using
site-specific recombinases to excise selectable markers after HR events
in several systems.17,18,40,42 In addition, our targeting
construct contained a HSV-TK gene for negative selection. AK7 ES cells
were electroporated, and clones were grown in hygromycin and
gancyclovir for positive and negative selection respectively. Five
hundred and ninety-one colonies were screened by Southern blot
analysis. Six clones had the correct structure spanning both 5
and 3 junctions of the targeting construct and having a single copy of PGK-hygro present for a targeting frequency of 1%. Three clones were chosen for blastocyst injection, and all showed germline transmission (Fig 4, lanes 2 and 3).

View larger version (48K):
[in this window]
[in a new window]
| Fig 4.
Southern blot analysis of mice containing targeted
deletions of 5 HS 5 and 6. DNA was isolated from mouse tails and
digested with HpaI (H), blotted, and hybridized to an upstream probe
(KH end). Lane 1: wild-type (WT) mouse; lane 2: 5,6 H/WT mouse; lane
3: 5,6 H/ 5,6 H mouse; lane 4: 5,6 H/WT mouse; lane 5:
5,6 H/ 5,6 H mouse; M: molecular size standards. The
targeted mutation replaced a 3.5-kb Hpa I to EcoRV
fragment with a 2.0-kb PGK-hygro marker, destroying both restriction
enzyme sites and leading to a larger Hpa I restriction fragment
( 5,6 H; lanes 2 and 3). Excision of PGK-hygro decreases the
restriction fragment size by 2.0 kb ( 5,6 H; lanes 4 and 5).
Triangles represent lox P sites.
|
|
In vivo excision of the selectable marker.
To analyze mice with 5 HS 5 and 6 deleted and free of any
effects of the selectable marker, the mutant mice containing the marker
( 5,6H) were bred with mice containing a Cre recombinase transgene
driven by a CMV promoter (TgN[CMV-Cre]1AN).33 Southern blot analysis of tail DNA revealed that all seven mice that inherited the Cre transgene showed an accurate Cre-mediated excision of the
selectable marker ( 5,6 H; data not shown). Two of the seven mice
contained a population of cells in which the selectable marker had not
been excised; thus, although efficient, excision did not take place in
every cell in the first generation. The degree of chimerism in tail may
not reflect chimerism in the hematopoietic system, and Southern
blotting is not sufficiently sensitive to detect a small population of
marker containing cells that could complicate phenotypic analysis. To
generate mice homogeneous for the mutation, these first generation
5,6 H mice were bred and 5,6 H pups lacking the Cre transgene
were isolated (Fig 4, lanes 4 and 5). As the Cre recombinase is not
present, the excision event must have occurred in the parent; thus, the
gamete must have carried the 5,6 H mutation, and the resultant
mouse must be homogeneous. In addition, this strategy avoids the
theoretical concern of Cre protein binding to a loxP site and altering
the phenotype. Mice homozygous for the 5,6 H mutation were
generated and revealed no decreased viability.
Erythroid tissue from these homozygotes was used for DNase I mapping
and revealed that although 5 HS 5 and 6 do not form, all other
sites form normally (Fig 5 and data not
shown). Thus, we have deleted mouse 5 HS 5 and 6, no new HSs
form in their place, and this deletion does not result in a change in
the chromatin conformation of the locus that extinguishes the ability
of other HSs to form.

View larger version (34K):
[in this window]
[in a new window]
| Fig 5.
Mapping of HSs in homozygous 5,6 H/ 5,6 H
mice. A DNase I series of erythroid tissue from a homozygous mutant
mouse was digested with Hpa I (H) and hybridized with a
5 probe (the same enzyme and probe combination as used in Fig
4). Although 5 HS 4, 4.1, and 4.2 form, no HS forms at the site
of the deletion. Molecular size standards are marked on the left. The
size of the parent band, placement of the probe used, and the size of
the degradation bands are diagrammed below.
|
|
Deletion of 5 HS 5 and 6 does not have a major effect on the
level or pattern of expression.
To determine if the deletion of mouse 5 HS 5 and 6 has an effect
on the level, timing, or tissue specificity of -globin gene
expression, mice and embryos were analyzed by internally controlled
quantitative RT-PCR assays. These assays exploit RFLPs between the two
major -globin alleles in mice, HbbS and
HbbD. Previously we showed that primer pairs specific for
the Ey, h1, and the adult -globin genes coamplify mRNA from
HbbS and HbbD homologues equally and that
cleavage at polymorphic restriction enzyme sites result in the
quantitative determination of expression from one allele compared to
the other.17 Targeted mutations were made on a
HbbD allele in ES cells derived from 129 mice. Mutant mice
were bred to mice carrying a wild-type HbbS allele allowing
comparison of expression from the mutant HbbD allele to
that of the internal control HbbS allele in these
heterozygotic animals. These assays accurately quantitate ratios of
D-specific to S-specific transcription from 0.1 to 0.9.17
For developmental analysis all three sets of primers were used to
examine RNA from yolk sac from day postconception (dpc) 10.5 embryos,
liver from dpc 15.5 fetuses, and peripheral blood in adults.
Analysis of expression in heterozygotes carrying the 5,6H mutation
is summarized in Table 1. A moderate
decrease was observed in h1 expression, with a lesser effect on
adult -globin expression, but no effect on Ey or fetal expression of
-globin was detectable. Analysis of mice lacking 5 HS 5 and 6 without the selectable marker ( 5,6 H) is shown in
Fig 6 and is quantitated in Table 1. Minor
decreases in embryonic expression of h1 and fetal expression of
-globin expression were noted, whereas embryonic expression of Ey
and adult expression of -globin expression were unchanged. No
abnormalities in globin gene switching were detectable (Fig 6). In
addition, no globin gene expression was observed in day 3.5 blastocysts; in day 6.5 or 7.5 yolk sacs; or in adult thymus, brain,
muscle, gut, testes, or kidney (data not shown).

View larger version (74K):
[in this window]
[in a new window]
| Fig 6.
Expression of -like globin genes in 5,6 H/WT
heterozygous mice. The HbbD allele (D) carries the targeted
mutation, whereas the HbbS allele (S) is wild-type. RNA was
analyzed from dpc 10.5 yolk sac, dpc 15.5 fetal liver, and adult
peripheral blood using RT-PCR assays for Ey, bh1, and adult primers
(top, middle, and bottom panels). WT, wildtype D/S animals; 5,6,
mutant 5,6 H/S heterozygous mice. S and D mark the RT-PCR
products from the S and D alleles, respectively.
|
|
 |
DISCUSSION |
The mouse -globin LCR has a complex pattern of HSs
upstream of 5 HS 4.
The 12-kb region upstream of 5 HS 4 has four DNase HSs in mouse,
whereas only one, 5 HS 5, has been described in human to date.
In the region where sequences are available from human and galago,
several aligning segments are found. The largest segment has an average
of ~60% identity with the primate sequences and spans the area to
which human 5 HS 5 maps. In contrast to 5 HS 1,2,3, and
4, which are major HSs in both human and mouse, 5 HS 5 is a
major HS in human but is at the limit of detection in the mouse. The
human 5 HS 5 contains two CACC motifs in a region of substantial
dyad symmetry that is not conserved in the mouse. Assuming that these
sites are occupied in the human, their absence in the mouse could
explain the difference in HS intensity. If this is the case we would
expect that when mapped, galago 5 HS 5 would be a relatively
intense site as these CACC BP sequences are conserved in the
galago.14 Similarly, mouse 5 HS 4.2 maps to a region
with multiple consensus GATA-1 sites. It also contains a GGGCAG motif,
which is a single mismatch from the Sp1 consensus binding site and has
been suggested to bind porcine Sp1.43 This sequence is not
conserved in the human, which may explain why no HS is observed.
Mouse 5 HS 6 is currently the most 5 HS mapped to the
-globin LCR, with no further HSs present for at least 5.8 kb
upstream. Previous mapping in the human would have detected 5 HS
6 if the spatial organization of 5 HS 6 and 5 was conserved (2.3 kb apart in the mouse).5,8 Thus, either this HS is unique
to the mouse, or it is present in the human locus, but spacing is not
maintained. This region is striking in the density of potential GATA-1
binding sites, six in total with four within 120 bp. -Globin LCR
core regions from several species contain adjacent and opposing GATA-1 sites as well as NFE-2 and AP-1 sites that are bound in vitro and are
thought to play a role in the regions' enhancer activity and ability
to lead to position-independent expression.14,25,35 Although the opposing GATA-1 sites in 5 HS 6 are separated by ~30 bp and no AP-1/NFE-2 consensus site is present, it will be interesting to determine if 5 HS 6 contains erythroid-specific enhancer activity.
Previously a 2.6-kb region containing human 5 HS 5 was found to
act as an SAR and to have two potential Drosophila topoisomerase II
consensus binding sites, leading to suggestions that this region demarcated the extent of the -globin domain.22 Although
these topoisomerase II sites are not conserved in mouse 5 HS 5, two such sites map to mouse 5 HS 6; however, the significance of this observation is not known. In addition, a region upstream of mouse
5 HS 6 is AT rich and contains multiple potential topoisomerase II sites, raising the possibility that these regions may act as SARs in
the mouse (M. Bulger and M.A. Bender, unpublished observations, November 1997).
Deletion of the most upstream HSs does not lead to repression of the
locus and does not have major effects on transcription.
Deletion of the most distal HSs of the mouse -globin LCR has no
substantial effect on globin gene expression. Several studies previously suggested that human 5 HS 5 can act as an insulator in the appropriate context, while in other contexts no effect was
seen.9,19-22 The studies presented here address the effects of deleting the most distal HSs of the murine -globin LCR and the
homologous sequences to human 5 HS 5. If insulation of the locus
were the primary function of this element, deletion of 5 HS 5 in
human or 5 HS 5 and 6 in mouse would be expected to lead to an
alteration of the chromatin environment of the locus. Manifestations of
this could include repression of globin gene expression in erythroid
cells, premature activation of the globin locus in development, and/or ectopic expression in nonerythroid tissues. We have
obtained no evidence that deletion of 5 HS 5 and 6 leads to the
shutdown of the locus in erythroid cells. Expression is near normal and the remaining LCR HSs form normally. In addition, when mouse 5 HS 1-6 are deleted in ES cells, the chromatin of the -globin locus
remains resistant to digestion with DNase I; however, after transfer
into a human erythroid background the locus becomes sensitive, suggesting that 5 HS 1-6 are not required to insulate the locus from any repressive upstream influences in an erythroid
environment.44 Furthermore, we have obtained no evidence
that deletion of 5 HS 5 and 6 leads to the inappropriate
activation of the locus. No ectopic expression is detectable in the
nonerythroid hematopoietic tissues or nonhematopoietic tissues we
analyzed. Although this is consistent with a lack of activation of the
locus in nonerythroid cells, we cannot exclude the possibility that the
locus is in an active conformation, but the absence of an appropriate
erythroid cellular milieu prevents detectable transcription. Because
the regions flanking the -globin locus have not been characterized, we can not fully address whether deletion of 5 HS 5 and 6 leads to inappropriate repression or silencing of upstream regions in nonerythroid cells or activation in erythroid cells. We can state that
any such effects, if present, do not lead to any gross phenotype or
decrease in viability. Thus, deletion of the most distal HS in the
mouse, 5 HS 6 and 5 HS 5, has not provided any evidence that this region functions as a boundary element in vivo.
Recently, it has been shown that sequences from the human -globin
LCR (Garrick et al, submitted) and the HS-40 enhancer from the human -globin locus can decrease position effect variegation in
transgenic mice.45 In addition, inactivation of the
transgenes increases with age of the animal.46 If 5
HS 5-6 were to act as an insulator at its endogenous location, the
region upstream of the locus might exert its effect in a stochastic and
time-dependent manner, possibly revealing a transcriptional phenotype
with increasing age. In the experiments reported here, only young adult
mice were analyzed. Thus, it will be interesting to analyze -like
globin gene expression in these mice as they age.
The most upstream extent of the -globin LCR differs
between the mouse and human.
The region at the 5 end of the mouse -globin LCR has a
distinctive (complex) structure that contrasts with the human LCR. Sequence comparisons and DNase I HS mapping reveal that the mouse does
have a homologue of human 5 HS 5. Although in the human this
lone site upstream of 5 HS 4 is a major site, in the mouse it is
barely detectable and is overshadowed by three more intense sites (Fig
1B). In addition, in contrast to the high degree of conserved motifs
seen between mouse and human in the region of 5 HS 1 through 4, the region upstream of mouse 5 HS 4 lacks this degree of
conservation of motifs for MAREs, GATA-1, CACC BPs, TATTT, and ATTTA
and has a thymidine-rich tract, suggesting that its organization may be
different. This suggests that the role that the most 5 region of
the LCR plays in regulating the transcription, chromatin structure, and
replication of the -globin locus may vary amongst species.
The selectable marker has a minor effect on gene level of expression.
Previously we showed that the presence of a selectable marker within
the LCR had dramatic effects on transcription in vitro and in vivo,
regardless of whether it is associated with a deletion within the
locus17,18,40,41; thus, it is essential to remove markers
to assure accurate assessment of the transcriptional phenotype with
targeted deletions.42 Although several strategies have been
used to accomplish this, we have chosen to flank selectable markers
with a recognition sequence for the Cre site-specific recombinase.
While the marker can be excised by transient expression of the Cre
recombinase in vitro, this requires additional time in culture, thus
reducing the potential for germline transmission of the mutation. By
using mice expressing a CMV-Cre transgene, we and others find efficient
but not complete excision of markers in F1 Cre containing
pups,33 similar to Cre transgenes used previously.47,48 This lack of complete excision shows the
necessity of analyzing F2 animals and embryos that lack the
Cre transgene to assure complete excision while also avoiding the
potential for the Cre enzyme to bind a residual loxP site and affect
expression in vivo.
Comparison of several strains of mutant mice with selectable markers
inserted into the -globin LCR reveals dramatic differences in the
transcriptional phenotypes. Targeted replacement of 5 HS 2 with
a PGK-neo gene in the same transcriptional orientation as the globin
genes leads to homozygous lethality, whereas replacement of 5 HS
3 in the opposite orientation reduces viability by
50%.17,18 In contrast, replacement of 5 HS 5 and 6 with a PGK-hygro gene in the same transcriptional orientation as the
globin genes did not affect viability and had relatively minor effects
on transcription, even when normalizing for the effect of the deletion
without the marker present. There are several factors that may
contribute to the decreased effect of the marker gene seen here
including (1) the marker is further from the endogenous genes, (2) the
marker does not lie between the HSs that affect transcription most
significantly (5 HS 2, 3, and 4) and the endogenous genes, (3)
the marker does not disrupt the organization of 5 HS 2, 3, and
4, (4) the transcriptional orientation of the marker gene, and (5) the
specific selectable marker promoter and gene used. These factors could
affect LCR activation of globin gene expression regardless of whether
tracking, looping, "holocomplex," or other models are
correct.49 Analysis of mice with PGK-neo replacing 5
HS 1 and 4 and mice with the identical marker in both orientations at
the same insertion site will be useful in evaluating the contribution
of these factors and in understanding how the LCR influences gene
expression.
 |
ACKNOWLEDGMENT |
We are grateful to Webb Miller for generating sequence analysis
graphics; A. Imamoto, B. Zambrowicz, and P. Soriano for sharing cell
lines and ES cell advice; A. Nagy for sharing TgN(CMV-Cre)1AN mice; and
the FHCRC Biotechnology Center for oligonucleotide synthesis and
automated sequencing. We thank M. Bulger, D. Cimbora, and H. Blanton
for critical reading of the manuscript.
 |
FOOTNOTES |
Submitted June 26, 1998;
accepted July 2, 1998.
Supported by the National Institutes of Health (NIH), Grant No. P30
HD28834, through the University of Washington Child Health Research
Center (M.A.B.), NIH Grant Nos. DK52854 and DK44746 (M.G.), National
Library of Medicine grants RO1LM05110 and RO1LM05773 (R.H.), a
Burroughs-Wellcome Fund Career Development Award (S.F.), and a core
grant to the FHCRC Biotechnology Center. M.A.B. is a Howard Hughes
Medical Institute Physician Postdoctoral Fellow.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Mark Groudine, MD, PhD, Division of Basic
Sciences, Fred Hutchinson Cancer Research Center, 1100 Fairview Ave
North-Mailstop A3-025, Seattle, WA 98109-1024.
 |
REFERENCES |
1.
Stamatoyannopoulos G, Nienhaus AW:
Hemoglobin switching, in
Stamatoyannopoulos G,
Nienhaus AW,
Majerus PW,
Varmus H
(eds):
The Molecular Basis of Blood Diseases. Philadelphia, PA, Saunders, 1994, p 107.
2.
Taramelli R, Kioussis D, Vanin E, Bartram K, Groffen J, Hurst J, Grosveld FG:
  -thalassaemias 1 and 2 are the result of a 100 kbp deletion in the human beta-globin cluster.
Nucleic Acids Res
14:7017, 1986[Abstract/Free Full Text]
3.
Driscoll MC, Dobkin CS, Alter BP:
Gamma delta beta-thalassemia due to a de novo mutation deleting the 5 -globin gene activation-region hypersensitive sites.
Proc Natl Acad Sci USA
86:7470, 1989[Abstract/Free Full Text]
4.
Curtin P, Pirastu M, Kan YW, Gobert-Jones JA, Stephens AD, Lehmann H:
A distant gene deletion affects -globin gene function in an atypical   -thalassemia.
J Clin Invest
76:1554, 1985
5.
Dhar V, Nandi A, Schildkraut CL, Skoultchi AI:
Erythroid-specific nuclease-hypersensitive sites flanking the human -globin domain.
Mol Cell Biol
10:4324, 1990[Abstract/Free Full Text]
6.
Forrester WC, Thompson C, Elder JT, Groudine M:
A developmentally stable chromatin structure in the human -globin gene cluster.
Proc Natl Acad Sci USA
83:1359, 1986[Abstract/Free Full Text]
7.
Jimenez G, Griffiths SD, Ford AM, Greaves MF, Enver T:
Activation of the -globin locus control region precedes commitment to the erythroid lineage.
Proc Natl Acad Sci USA
89:10618, 1992[Abstract/Free Full Text]
8.
Tuan D, Solomon W, Li Q, London IM:
The " -like-globin" gene domain in human erythroid cells.
Proc Natl Acad Sci USA
82:6384, 1985[Abstract/Free Full Text]
9.
Zafarana G, Raguz S, Pruzina S, Grosveld F, Meijer D:
The regulation of human -globin gene expression: The analysis of hypersensitive site 5 (HS5) in the LCR, in
Stamatoyannapoulas G
(ed):
Molecular Biology of Hemoglobin Switching. Andover, Hants, UK, Intercept, 1995, p 39.
10.
Townes TM, Behringer RR:
Human globin locus activation region (LAR): Role in temporal control.
Trends Genet
6:219, 1990[Medline]
[Order article via Infotrieve]
11.
Grosveld F, Antoniou M, Berry M, De Boer E, Dillon N, Ellis J, Fraser P, Hanscombe O, Hurst J, Imam A, Lindenbaum M, Philipsen S, Pruzina S, Strouboulis J, Raguz-Bolognesi S, Talbot D:
The regulation of human globin gene switching.
Philos Trans R Soc Lond-Series B Biol Sci
339:183, 1993[Medline]
[Order article via Infotrieve]
12.
Aladjem MI, Groudine M, Brody LL, Dieken ES, Fournier RE, Wahl GM, Epner EM:
Participation of the human -globin locus control region in initiation of DNA replication.
Science
270:815, 1995[Abstract/Free Full Text]
13.
Forrester WC, Epner E, Driscoll MC, Enver T, Brice M, Papayannopoulou T, Groudine M:
A deletion of the human -globin locus activation region causes a major alteration in chromatin structure and replication across the entire -globin locus.
Genes Dev
4:1637, 1990[Abstract/Free Full Text]
14.
Hardison R, Slightom JL, Gumucio DL, Goodman M, Stojanovic N, Miller W:
Locus control regions of mammalian -globin gene clusters: Combining phylogenetic analyses and experimental results to gain functional insights.
Gene
205:73, 1997[Medline]
[Order article via Infotrieve]
15.
Kieffer LJ, Yan L, Hanke JH, Kavathas PB:
Appropriate developmental expression of human CD8 beta in transgenic mice.
J Immunol
159:4907, 1997[Abstract]
16.
Porcu S, Kitamura M, Witkowska E, Zhang Z, Mutero A, Lin C, Chang J, Gaensler KM:
The human globin locus introduced by YAC transfer exhibits a specific and reproducible pattern of developmental regulation in transgenic mice.
Blood
90:4602, 1997[Abstract/Free Full Text]
17.
Fiering S, Epner E, Robinson K, Zhuang Y, Telling A, Hu M, Martin DI, Enver T, Ley TJ, Groudine M:
Targeted deletion of 5 HS2 of the murine -globin LCR reveals that it is not essential for proper regulation of the -globin locus.
Genes Dev
9:2203, 1995[Abstract/Free Full Text]
18.
Hug BA, Wesselschmidt RL, Fiering S, Bender MA, Epner E, Groudine M, Ley TJ:
Analysis of mice containing a targeted deletion of -globin locus control region 5 hypersensitive site 3.
Mol Cell Biol
16:2906, 1996[Abstract]
19.
Chung JH, Whiteley M, Felsenfeld G:
A 5 element of the chicken -globin domain serves as an insulator in human erythroid cells and protects against position effect in Drosophila.
Cell
74:505, 1993[Medline]
[Order article via Infotrieve]
20.
Jackson JD, Petrykowska H, Philipsen S, Miller W, Hardison R:
Role of DNA sequences outside the cores of DNase hypersensitive sites (HSs) in functions of the -globin locus control region. Domain opening and synergism between HS2 and HS3.
J Biol Chem
271:11871, 1996[Abstract/Free Full Text]
21.
Li Q, Stamatoyannopoulos G:
Hypersensitive site 5 of the human locus control region functions as a chromatin insulator.
Blood
84:1399, 1994[Abstract/Free Full Text]
22.
Yu J, Bock JH, Slightom JL, Villeponteau B:
A 5 -globin matrix-attachment region and the polyoma enhancer together confer position-independent transcription.
Gene
139:139, 1994[Medline]
[Order article via Infotrieve]
23.
Slightom JL, Bock JH, Tagle DA, Gumucio DL, Goodman M, Stojanovic N, Jackson J, Miller W, Hardison R:
The complete sequences of the galago and rabbit -globin locus control regions: Extended sequence and functional conservation outside the cores of DNase hypersensitive sites.
Genomics
39:90, 1997[Medline]
[Order article via Infotrieve]
24.
Jarman AP, Higgs DR:
Nuclear scaffold attachment sites in the human globin gene complexes.
EMBO J
7:3337, 1988[Medline]
[Order article via Infotrieve]
25.
Orkin SH:
Regulation of globin gene expression in erythroid cells.
Eur J Biochem
231:271, 1995[Medline]
[Order article via Infotrieve]
26.
Reitman M, Felsenfeld G:
Developmental regulation of topoisomerase II sites and DNase I-hypersensitive sites in the chicken -globin locus.
Mol Cell Biol
10:2774, 1990[Abstract/Free Full Text]
27.
Hebbes TR, Clayton AL, Thorne AW, Crane-Robinson C:
Core histone hyperacetylation co-maps with generalized DNase I sensitivity in the chicken -globin chromosomal domain.
EMBO J
13:1823, 1994[Medline]
[Order article via Infotrieve]
28.
Chung JH, Bell AC, Felsenfeld G:
Characterization of the chicken -globin insulator.
Proc Natl Acad Sci USA
94:575, 1997[Abstract/Free Full Text]
29.
Huang XQ, Hardison RC, Miller W:
A space-efficient algorithm for local similarities.
Comput Appl Biosci
6:373, 1990[Abstract/Free Full Text]
30.
Hardison R, Chao KM, Adamkiewicz M, Price D, Jackson J, Zeigler T, Stojanovic N, Miller W:
Positive and negative regulatory elements of the rabbit embryonic -globin gene revealed by an improved multiple alignment program and functional analysis.
DNA Sequence
4:163, 1993[Medline]
[Order article via Infotrieve]
31.
Chao KM, Hardison RC, Miller W:
Recent developments in linear-space alignment methods: A survey.
J Computl Biol
1:271, 1994[Medline]
[Order article via Infotrieve]
32.
Hardison RC, Oeltjen J, Miller W:
Long human-mouse sequence alignments reveal novel regulatory elements: A reason to sequence the mouse genome.
Genome Res
7:959, 1997[Free Full Text]
33.
Nagy A, Moens C, Ivanyi E, Pawling J, Gertsenstein M, Hadjantonakis A-K, Pirity M, Rossant J:
Dissecting the role of N-myc in development using a single targeting vector to generate a series of alleles.
Curr Biol
8:661, 1998[Medline]
[Order article via Infotrieve]
34.
Jimenez G, Gale KB, Enver T:
The mouse -globin locus control region: Hypersensitive sites 3 and 4.
Nucleic Acids Res
20:5797, 1992[Abstract/Free Full Text]
35.
Baron MH:
Transcriptional control of globin gene switching during vertebrate development.
Biochim Biophys Acta
1351:51, 1997[Medline]
[Order article via Infotrieve]
36.
Motohashi H, Shavit JA, Igarashi K, Yamamoto M, Engel JD:
The world according to Maf.
Nucleic Acids Res
25:2953, 1997[Abstract/Free Full Text]
37.
Kataoka K, Noda M, Nishizawa M:
Maf nuclear oncoprotein recognizes sequences related to an AP-1 site and forms heterodimers with both Fos and Jun.
Mol Cell Biol
14:700, 1994[Abstract/Free Full Text]
38.
Perkins AC, Sharpe AH, Orkin SH:
Lethal -thalassaemia in mice lacking the erythroid CACCC-transcription factor EKLF.
Nature
375:318, 1995[Medline]
[Order article via Infotrieve]
39.
Nuez B, Michalovich D, Bygrave A, Ploemacher R, Grosveld F:
Defective haematopoiesis in fetal liver resulting from inactivation of the EKLF gene.
Nature
375:316, 1995[Medline]
[Order article via Infotrieve]
40.
Fiering S, Kim CG, Epner EM, Groudine M:
An "in-out" strategy using gene targeting and FLP recombinase for the functional dissection of complex DNA regulatory elements: Analysis of the -globin locus control region.
Proc Natl Acad Sci USA
90:8469, 1993[Abstract/Free Full Text]
41.
Kim CG, Epner EM, Forrester WC, Groudine M:
Inactivation of the human -globin gene by targeted insertion into the -globin locus control region.
Genes Dev
6:928, 1992[Abstract/Free Full Text]
42. Fiering SN, Bender MA, Groudine M: Analysis of mammalian
cis-regulatory DNA elements by homologous recombination. Methods
Enzymol 1999 (in press)
43.
von der Ahe D, Pearson D, Nakagawa J, Rajput B, Nagamine Y:
Multiple nuclear factors interact with promoter sequences of the urokinase-type plasminogen activator gene.
Nucleic Acids Res
16:7527, 1988[Abstract/Free Full Text]
44. Epner E, Reik A, Cimbora D, Telling A, Bender MA, Fiering S,
Kennedy M, Keller G, Groudine M: The -globin LCR is not required for
an open chromatin structure or low level transcription of the mouse
-globin locus. Mol Cell 1998 (in press)
45.
Sutherland HG, Martin DI, Whitelaw E:
A globin enhancer acts by increasing the proportion of erythrocytes expressing a linked transgene.
Mol Cell Biol
17:1607, 1997[Abstract]
46.
Robertson G, Garrick D, Wilson M, Martin DI, Whitelaw E:
Age-dependent silencing of globin transgenes in the mouse.
Nucleic Acids Res
24:1465, 1996[Abstract/Free Full Text]
47.
Lakso M, Pichel JG, Gorman JR, Sauer B, Okamoto Y, Lee E, Alt FW, Westphal H:
Efficient in vivo manipulation of mouse genomic sequences at the zygote stage.
Proc Natl Acad Sciences USA
93:5860, 1996[Abstract/Free Full Text]
48.
Schwenk F, Baron U, Rajewsky K:
A cre-transgenic mouse strain for the ubiquitous deletion of loxP-flanked gene segments including deletion in germ cells.
Nucleic Acids Res
23:5080, 1995[Free Full Text]
49.
Martin DI, Fiering S, Groudine M:
Regulation of -globin gene expression: Straightening out the locus.
Curr Opin Genet Dev
6:488, 1996[Medline]
[Order article via Infotrieve]

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
G. Fromm, C. de Vries, R. Byron, J. Fields, S. Fiering, M. Groudine, M. A. Bender, J. Palis, and M. Bulger
Histone hyperacetylation within the {beta}-globin locus is context-dependent and precedes high-level gene expression
Blood,
October 15, 2009;
114(16):
3479 - 3488.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Bhatia, J. L. Hallock, A. Dutta, S. Karkashon, L. S. Sterner, T. Miyazaki, A. Dean, and J. A. Little
Short-chain fatty acid-mediated effects on erythropoiesis in primary definitive erythroid cells
Blood,
June 18, 2009;
113(25):
6440 - 6448.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Hou, H. Zhao, K. Tanimoto, and A. Dean
CTCF-dependent enhancer-blocking by alternative chromatin loop formation
PNAS,
December 23, 2008;
105(51):
20398 - 20403.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. Bender, R. Byron, T. Ragoczy, A. Telling, M. Bulger, and M. Groudine
Flanking HS-62.5 and 3' HS1, and regions upstream of the LCR, are not required for beta-globin transcription
Blood,
August 15, 2006;
108(4):
1395 - 1401.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. J. Bultman, T. C. Gebuhr, and T. Magnuson
A Brg1 mutation that uncouples ATPase activity from chromatin remodeling reveals an essential role for SWI/SNF-related complexes in {beta}-globin expression and erythroid development
Genes & Dev.,
December 1, 2005;
19(23):
2849 - 2861.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Fang, J. Sun, P. Xiang, M. Yu, P. A. Navas, K. R. Peterson, G. Stamatoyannopoulos, and Q. Li
Synergistic and Additive Properties of the Beta-Globin Locus Control Region (LCR) Revealed by 5'HS3 Deletion Mutations: Implication for LCR Chromatin Architecture
Mol. Cell. Biol.,
August 15, 2005;
25(16):
7033 - 7041.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. C. King, J. Taylor, L. Elnitski, F. Chiaromonte, W. Miller, and R. C. Hardison
Evaluation of regulatory potential and conservation scores for detecting cis-regulatory modules in aligned mammalian genome sequences
Genome Res.,
August 1, 2005;
15(8):
1051 - 1060.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Wang, H. Liu, C. M. Lin, M. I. Aladjem, and E. M. Epner
Targeted Deletion of the Chicken {beta}-Globin Regulatory Elements Reveals a Cooperative Gene Silencing Activity
J. Biol. Chem.,
June 17, 2005;
280(24):
23340 - 23348.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. J. Donaldson, M. Chapman, S. Kinston, J. R. Landry, K. Knezevic, S. Piltz, N. Buckley, A. R. Green, and B. Gottgens
Genome-wide identification of cis-regulatory sequences controlling blood and endothelial development
Hum. Mol. Genet.,
March 1, 2005;
14(5):
595 - 601.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Tanimoto, A. Sugiura, A. Omori, G. Felsenfeld, J. D. Engel, and A. Fukamizu
Human {beta}-Globin Locus Control Region HS5 Contains CTCF- and Developmental Stage-Dependent Enhancer-Blocking Activity in Erythroid Cells
Mol. Cell. Biol.,
December 15, 2003;
23(24):
8946 - 8952.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. R. Loyd, Y. Okamoto, M. S. Randall, and P. A. Ney
Role of AP1/NFE2 binding sites in endogenous {alpha}-globin gene transcription
Blood,
December 1, 2003;
102(12):
4223 - 4228.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Bulger, D. Schubeler, M. A. Bender, J. Hamilton, C. M. Farrell, R. C. Hardison, and M. Groudine
A Complex Chromatin Landscape Revealed by Patterns of Nuclease Sensitivity and Histone Modification within the Mouse {beta}-Globin Locus
Mol. Cell. Biol.,
August 1, 2003;
23(15):
5234 - 5244.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. C. Ostermeier, Z. Liu, R. P. Martins, R. R. Bharadwaj, J. Ellis, S. Draghici, and S. A. Krawetz
Nuclear matrix association of the human {beta}-globin locus utilizing a novel approach to quantitative real-time PCR
Nucleic Acids Res.,
June 15, 2003;
31(12):
3257 - 3266.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. D. Marsden and R. E. K. Fournier
Chromosomal Elements Regulate Gene Activity and Chromatin Structure of the Human Serpin Gene Cluster at 14q32.1
Mol. Cell. Biol.,
May 15, 2003;
23(10):
3516 - 3526.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Harju, K. J. McQueen, and K. R. Peterson
Chromatin Structure and Control of {beta}-Like Globin Gene Switching
Experimental Biology and Medicine,
October 1, 2002;
227(9):
683 - 700.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. M. Farrell, A. G. West, and G. Felsenfeld
Conserved CTCF Insulator Elements Flank the Mouse and Human {beta}-Globin Loci
Mol. Cell. Biol.,
June 1, 2002;
22(11):
3820 - 3831.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Q. Li, M. Zhang, H. Han, A. Rohde, and G. Stamatoyannopoulos
Evidence that DNase I hypersensitive site 5 of the human {beta}-globin locus control region functions as a chromosomal insulator in transgenic mice
Nucleic Acids Res.,
June 1, 2002;
30(11):
2484 - 2491.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. Bender, J. N. Roach, J. Halow, J. Close, R. Alami, E. E. Bouhassira, M. Groudine, and S. N. Fiering
Targeted deletion of 5'HS1 and 5'HS4 of the {beta}-globin locus control region reveals additive activity of the DNaseI hypersensitive sites
Blood,
October 1, 2001;
98(7):
2022 - 2027.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Schubeler, M. Groudine, and M. A. Bender
The murine beta -globin locus control region regulates the rate of transcription but not the hyperacetylation of histones at the active genes
PNAS,
September 5, 2001;
(2001)
201394698.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Molete, H. Petrykowska, E. E. Bouhassira, Y.-Q. Feng, W. Miller, and R. C. Hardison
Sequences Flanking Hypersensitive Sites of the {beta}-Globin Locus Control Region Are Required for Synergistic Enhancement
Mol. Cell. Biol.,
May 1, 2001;
21(9):
2969 - 2980.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
R. C. Hardison
New views of evolution and regulation of vertebrate beta -like globin gene clusters from an orphaned gene in marsupials
PNAS,
February 13, 2001;
98(4):
1327 - 1329.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. M. Farrell, A. Grinberg, S. P. Huang, D. Chen, J. G. Pichel, H. Westphal, and G. Felsenfeld
A large upstream region is not necessary for gene expression or hypersensitive site formation at the mouse beta -globin locus
PNAS,
December 19, 2000;
97(26):
14554 - 14559.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. Bender, M. G. Mehaffey, A. Telling, B. Hug, T. J. Ley, M. Groudine, and S. Fiering
Independent formation of DnaseI hypersensitive sites in the murine beta -globin locus control region
Blood,
June 1, 2000;
95(11):
3600 - 3604.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. M. Kaufman, C. T.N. Pham, and T. J. Ley
Transgenic Analysis of a 100-kb Human beta -Globin Cluster-Containing DNA Fragment Propagated as a Bacterial Artificial Chromosome
Blood,
November 1, 1999;
94(9):
3178 - 3184.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. C. Walters, S. Fiering, E. E. Bouhassira, D. Scalzo, S. Goeke, W. Magis, D. Garrick, E. Whitelaw, and D. I. K. Martin
The Chicken beta -Globin 5'HS4 Boundary Element Blocks Enhancer-Mediated Suppression of Silencing
Mol. Cell. Biol.,
May 1, 1999;
19(5):
3714 - 3726.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Bulger, J. H. von Doorninck, N. Saitoh, A. Telling, C. Farrell, M. A. Bender, G. Felsenfeld, R. Axel, and M. Groudine
Conservation of sequence and structure flanking the mouse and human beta -globin loci: The beta -globin genes are embedded within an array of odorant receptor genes
PNAS,
April 27, 1999;
96(9):
5129 - 5134.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Schubeler, M. Groudine, and M. A. Bender
The murine beta -globin locus control region regulates the rate of transcription but not the hyperacetylation of histones at the active genes
PNAS,
September 25, 2001;
98(20):
11432 - 11437.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|