|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 92 No. 12 (December 15), 1998:
pp. 4632-4640
Human Granulocyte Colony-Stimulating Factor (G-CSF) Stimulates the In
Vitro and In Vivo Development But Not Commitment of Primitive
Multipotential Progenitors From Transgenic Mice Expressing the Human
G-CSF Receptor
By
Feng-Chun Yang,
Sumiko Watanabe,
Kohichiro Tsuji,
Ming-jiang Xu,
Azusa Kaneko,
Yasuhiro Ebihara, and
Tatsutoshi Nakahata
From the Department of Clinical Oncology, the Department of Molecular
and Developmental Biology, The Institute of Medical Science, The
University of Tokyo, Tokyo, Japan.
 |
ABSTRACT |
Granulocyte colony-stimulating factor (G-CSF) stimulates the
proliferation and restricted differentiation of hematopoietic progenitors into neutrophils. To clarify the effects of G-CSF on
hematopoietic progenitors, we generated transgenic (Tg) mice that had
ubiquitous expression of the human G-CSF receptor (hG-CSFR). In clonal
cultures of bone marrow and spleen cells obtained from these mice,
hG-CSF supported the growth of myelocytic as well as megakaryocytic,
mast cell, mixed, and blast cell colonies. Single-cell cultures of
lineage-negative
(Lin )c-Kit+Sca-1+ or
Sca-1 cells obtained from the Tg mice confirmed the
direct effects of hG-CSF on the proliferation and differentiation of
various progenitors. hG-CSF also had stimulatory effects on the
formation of blast cell colonies in cultures using
5-fluorouracil-resistant hematopoietic progenitors and clone-sorted
Linc-Kit+Sca-1+ primitive
hematopoietic cells. These colonies contained different progenitors in
proportions similar to those obtained when mouse interleukin-3 was used
in place of hG-CSF. Administration of hG-CSF to Tg mice led to
significant increases in spleen colony-forming and mixed/blast cell
colony-forming cells in bone marrow and spleen, but did not alter the
proportion of myeloid progenitors in total clonogenic cells. These
results show that, when functional G-CSFR is present on the cell
surface, hG-CSF stimulates the development of primitive multipotential
progenitors both in vitro and in vivo, but does not induce exclusive
commitment to the myeloid lineage.
© 1998 by The American Society of Hematology.
| |
INTRODUCTION |
MULTIPOTENTIAL hematopoietic stem cells
give rise to committed cells that undergo terminal differentiation in
various lineages. Although it is widely accepted that these multistage developmental processes are supported by cytokines,1 the
mechanism governing the commitment of multipotential progenitors
remains unclear. To date, several investigators have proposed two
opposing models for this process. In the deterministic model, the
commitment of multipotential progenitors is determined by exogenous
stimuli such as cytokine receptor signals.2 In the
stochastic model, spontaneous random events result in the commitment of
progenitors whose survival is supported by cytokines.1
Hematopoietic progenitors express various cytokine receptors. Cytokines
exert their biological effects by binding to specific, high-affinity
receptors. If the commitment of hematopoietic cells occurs according to
the deterministic model, signal transduction mediated by a
lineage-restricted cytokine receptor expressed by a hematopoietic
progenitor is a key inductive event. Forced expression of such a
receptor by primitive hematopoietic cells would promote differentiation
to a particular lineage. To test this model, we generated transgenic
(Tg) mice expressing the human granulocyte-macrophage colony-stimulating factor receptor (hGM-CSFR).3 In
hGM-CSFR-Tg mice, hGM-CSF stimulated myelopoiesis as well as the
development of cells of various other lineages. Similar results were
reported by Takagi et al4 in Tg mice expressing the mouse
interleukin-5 receptor  subunit (mIL-5R). To examine whether the
findings obtained in the hGM-CSFR and mIL-5R-Tg mice are universally
applicable to other cytokines, expression of more specific
signal-transducing receptors by mature progenitors is needed. Because
the effects of granulocyte colony-stimulating factor (G-CSF) and
expression of its receptor are normally limited to cells of myeloid
lineage, we selected the hG-CSFR for expression as a transgene in mice.
hG-CSF is a glycoprotein synthesized by a variety of cell
types.5-7 Several in vitro studies have shown that G-CSF is
capable of activating mature neutrophils and supporting the
proliferation and myeloid differentiation of hematopoietic progenitor
cells in both mice and humans, indicating that the potential of G-CSF is restricted to the myeloid lineage.5,7,8 The effects of
G-CSF are mediated by binding to its specific receptor (G-CSFR), which
belongs to a superfamily of cytokine/hematopoietic
receptors.9 The expression of the G-CSFR by murine
hematopoietic progenitors has not been extensively analyzed. However,
in binding studies using radiolabeled G-CSF, the G-CSFR was found on
murine granulocytic cells from myeloblasts to mature neutrophils, as
well as a subset of monocytes, but not on erythroid cells or
megakaryocytes.10
hG-CSFR-Tg mice were generated by standard oocyte
injection.11 hG-CSF supported the growth of multipotential
hematopoietic progenitors expressing the hG-CSFR obtained from these
mice both in vitro and in vivo, but did not alter their commitment
program. These results are consistent with the stochastic rather than
the deterministic model of hematopoietic differentiation.
| |
MATERIALS AND METHODS |
Hematopoietic growth factors and antibodies.
Recombinant hG-CSF, human erythropoietin (hEPO), recombinant mouse stem
cell factor (mSCF), and human thrombopoietin (hTPO) were kindly
provided by Kirin Brewery (Tokyo, Japan). Mouse IL-3 (mIL-3) was from
Amgen (Thousand Oaks, CA). Recombinant hIL-6 was kindly provided by
Tosoh Co (Kanagawa, Japan). All cytokines were pure recombinant
molecules and were used at concentrations that induced an optimal
response in methylcellulose culture of murine hematopoietic cells.
These concentrations are 20 ng/mL for hG-CSF, 10 ng/mL for mIL-3, 2 U/mL for hEPO, 20 ng/mL for hTPO, 100 ng/mL for hIL-6, and 100 ng/mL
for mSCF. Allophycocyanin (APC)-conjugated anti-c-Kit antibody (ACK-2)
was kindly provided by Dr Shin-Ichi Nishikawa (Kyoto University, Kyoto,
Japan). Biotin-conjugated monoclonal antibodies (MoAbs) specific for
CD45R (B220, RA3-6B2), Gr-1 (Ly-6G, RB6-8C5), CD4 (L3T4, RM4-5), CD8a
(Ly-2, 53-6.7), TR119 (erythroid cells, TER119), Mac-1 (CD11b, M1/70),
and LMM741 (a mouse anti-hG-CSFR MoAb) and phycoerythrin
(PE)-conjugated antimouse Sca-1 (Ly-6A/E, E13-161.7), APC-conjugated
rat IgG2b, and rat antimouse CD32/CD16 (Fc II/III receptor, 2.4G2)
were purchased from Pharmingen (San Diego, CA). PE-conjugated
streptavidin, rat IgG2a, Texas red (TR)-conjugated streptavidin, and
R-PE-cyanine 5-conjugated streptavidin (RPE-Cy5-SA) were purchased
from Becton Dickinson Immunocytometry Systems (San Jose, CA), Cedarlane
Laboratories, Ltd (Hornby, Canada), Life Technologies, Inc
(Gaithersburg, MD), and DAKO (Glostrup, Denmark), respectively.
Construction of hG-CSFR cDNA and generation of Tg mice.
The 3-kb fragment of hG-CSFR cDNA9 was inserted into the
EcoRI site of a pLG1 expression vector that has a 1.4-kb mouse major histocompatibility complex (MHC) L-locus gene (H2-Ld)
promoter (Fig 1). The 0.5-kb  -globin
polyadenylation sequence was placed downstream of these sites. The
resulting pLd-hG-CSFR plasmid was 8.5 kb.
pLd-hG-CSFR was digested with restriction enzymes
Sph I and Xho I, and the restriction fragment
containing the hG-CSFR insert was separated from the vector by
low-melting agarose gel (Sea Plaque; FMC Bio Products, Rockland, ME).
DNA fragments, purified using a QIAGEN tip 5 column (QIAGEN GmbH,
Hilden, Germany), were dissolved in 10 mmol Tris-HCl (pH 7.5) and 0.2 mmol EDTA. Tg mice were produced by standard oocyte
injection11 using the C3H/HeN strain. The mice were
maintained in an environmentally controlled clean room with 12-hour
light-dark cycles under specific pathogen-free conditions in
micro-isolator cages. Tg mice were screened for successful integration
of hG-CSFR by polymerase chain reaction (PCR) and Southern blot
analysis of tail DNA, using a hG-CSFR cDNA fragment as a probe. Mouse
tail-tip DNA was prepared by the removal of 1 cm of tail, which was
incubated in 0.7 mL of tail-tip buffer (50 mmol Tris-HCl [pH 8.0],
0.1 mmol EDTA, 0.5% sodium dodecyl sulfate, and 0.02 mg/mL proteinase
K) at 55°C for 15 hours. The lysate was extracted with an equal
volume of phenol and chloroform. PCR was performed using 1 µg of
total genomic DNA, 20 pmol of primers, and 2.5 U of Taq polymerase
(Perkin Elmer Cetus, Foster City, CA) for 30 cycles (94°C for 30 seconds, 62°C for 45 seconds, and 72°C for 2 minutes), followed
by 7 minutes at 72°C using a DNA thermocycler (GeneAmp, PCR System
2400; Perkin Elmer). The 5 primer (P1:
5GTGCTGGTTATTGTGCTGTC3) was in the H2-Ld
promoter gene, and the 3 primer (P2:
5CGGAGTACTTGGAGTGTTGG3) was in the hG-CSFR gene (Fig 1).
Twenty-five microliters of the amplified solution was run in a 1.2%
agarose gel electrophoresis in TBE buffer and stained with 0.5 µg/mL
ethidium bromide. Ten micrograms of mouse genomic DNA was digested with
BamHI, separated by agarose gel electrophoresis, and then
transferred to positively charged Nylon Membranes (Boehringer Mannheim,
Mannheim, Germany) by a capillary system in alkali. The membranes were
hybridized with a partial length (900 bp) probe of hG-CSFR cDNA, as
described by Sambrook et al.12
View larger version (17K):
[in this window]
[in a new window]
| Fig 1.
Structure of hG-CSFR transgene. Restriction endonuclease
cleavage maps of hG-CSFR and pLG1 constructs were used to generate
hG-CSFR-Tg mice. Fragments derived from the H2-Ld promoter,
the hG-CSFR cDNA, and the poly A addition site of SV40 early gene are
shown.
|
|
Reverse transcription-PCR.
The expression of transgene RNA transcripts in different tissues was
determined by RT-PCR, using oligonucleotides of hG-CSFR (sense,
nucleotide positions 1790 to 1810; antisense, 2159 to 2179) and
-actin (as a positive control; upstream,
5GTGGGCCGCTCTAGGCACCAA3; downstream,
5CTCTTTGATGTCACGCACGATTTC3) as primers. Total RNA was
isolated from bone marrow (BM), peripheral blood (PB), spleen, thymus,
liver, heart, intestine, brain, and kidneys of adult (8-week-old) Tg
mice by the acid-guanidinium-phenol-chloroform protocol, as described.13 One microgram of total RNA was reverse
transcribed for 1 hour at 37°C using T-Primed First-Strand Kit
(Pharmacia Biotech, Uppsala, Sweden), according to the manufacturer's
instructions. PCR was performed under the conditions of 35 cycles (94°C for 1 minute, 55°C for 30 seconds, and 72°C
for 30 seconds), followed by 7 minutes at 72°C using a DNA
thermocycler (GeneAmp, PCR System 2400; Perkin Elmer).
Cell preparation.
BM cells from 8-week-old Tg mice and their normal littermates were
flushed from femurs and tibiae into minimum essential medium (-MEM;
Flow Laboratories, Rockville, MD) with 2% fetal bovine serum (FBS;
Hyclone, Logan, UT) using a 26-gauge needle. Spleen cells were obtained
by rubbing between two pieces of glasses and repeated pipetting. Cells
were then passed through a 70-µm nylon cell strainer (#2350; Becton
Dickinson Labware, Franklin Lakes, NJ). PB was collected from an
ether-anesthetized mouse by cardiac puncture using a 1-mL syringe and a
21-gauge needle. After collection, PB was quickly mixed with 2 mg EDTA
to avoid aggregation. BM mononuclear cells (MNC) were prepared using a
density gradient centrifugation method. Cells were diluted with
phosphate-buffered saline (PBS), layered over Lympholyte-M (Cosmo Bio,
Tokyo, Japan), and centrifuged for 30 minutes at 1,500 rpm at room
temperature. Interface cells were washed twice with PBS. For
experiments involving 5-fluorouracil (5-FU) treatment, 150 mg/kg of
5-FU (5FU; Sigma Chemical, St Louis, MO) was administered by tail vein,
and BM cells were harvested 48 hours later. In other experiments, 0.2 mL of PBS, with or without 1,000 µg/kg/d of hG-CSF, was injected
intraperitoneally for 7 consecutive days at 9:00 AM and 9:00
PM. BM and spleen cells were harvested 12 hours after the last
injection.
Clonal cell culture.
Clonal cell culture was performed in triplicate as
described.14 Briefly, 1 mL of culture mixture containing
cells (either 2.5 × 104 BM cells or 2.5 × 105 spleen cells from untreated mice, or 1 × 105 BM cells from 5-FU-treated mice), -MEM,
1.2% methylcellulose (Shinetsu Chemical, Tokyo, Japan), 30% FBS, 1%
deionized fraction V bovine serum albumin (BSA; Sigma Chemical),
104 mol mercaptoethanol (Eastman Organic Chemicals,
Rochester, NY), and various combinations of hematopoietic growth
factors were plated in each of 35-mm suspension culture dishes
(#171099; Nunc, Inc, Naperville, IL) and incubated at 37°C in a
humidified atmosphere flushed with 5% CO2 in air. Except
for megakaryocyte colonies, cell aggregates consisting of more than 50 cells were scored as colonies. Colony types were determined on days 7 through 14 of incubation by in situ observation using an inverted
microscope, according to the criteria of Nakahata and
Ogawa.14,15 Megakaryocyte colonies were scored as such when
they had four or more megakaryocytes.16 Abbreviations for
the colony types are as follows: GM, granulocyte-macrophage colonies;
Mk, megakaryocyte colonies; Mast, mast cell colonies; B, erythroid
bursts; Mix, mixed hematopoietic colonies, including GMM
(granulocyte-macrophage-megakaryocyte colonies), GEM
(granulocyte-erythrocyte-macrophage colonies), and GEMM
(granulocyte-erythrocyte-macrophage-megakaryocyte colonies); and Blast,
blast cell colonies. To assess the accuracy of in situ identification
of colonies, individual colonies were taken with an Eppendorf
micropipette under direct microscopic visualization and spread on glass
slides using a cytocentrifuge (Cytospin 2; Shandon Inc, Pittsburgh,
PA). Slides were then stained with May-Grünwald-Giemsa,
acetylcholine esterase for megakaryocytes,17 and alcian
blue-safranin for mast cells.18
Flow cytometric analysis.
Flow cytometry was performed using a modification of the previously
described method.19 Briefly, after depletion of
erythrocytes with Lysing Solution (Nichirei Co, Tokyo, Japan), 5 × 105 BM, spleen, and PB cells were suspended with
100 µL of staining buffer (PBS containing 2% FBS and 0.1% sodium
azide). Cells were incubated with biotin-conjugated LMM741 for 30 minutes on ice, followed by an incubation with RPE-Cy5-conjugated
streptavidin for 30 minutes on ice. Antibodies were incubated with
cells for 30 minutes on ice for all cases. Flow cytometric analysis was performed using a FACScan (Becton Dickinson, Mountain View, CA).
Clone-sorting and single-cell culture.
Clone-sorting of lineage-negative
(Lin)c-Kit+Sca-1+ and
Linc-Kit+Sca-1 cells
from BM cells of (C57BL/6 × C3H/HeN) F1 Tg mice and
their littermates was performed using a modification of a reported
technique.20 Briefly, BMMNC were enriched by negative
selection with streptavidin-conjugated beads (PerSeptive Biosystems,
Framingham, MA) using a cocktail of biotin-conjugated MoAbs specific
for CD45R/B220, Gr-1, CD4, CD8, TR119, and Mac-1. After incubation with
rat antimouse CD32/CD16 to avoid nonspecific antibody binding, the
lineage marker-negative cells were stained with PE-conjugated Sca-1 and
APC-conjugated anti-c-Kit antibody (ACK-2). The cells were then washed
twice and incubated with TR-conjugated streptavidin. The negative
controls were cells stained with PE-conjugated rat IgG2a,
APC-conjugated rat IgG2b, or only TR-conjugated streptavidin. Based on
these controls, individual
Linc-Kit+Sca-1+ and
Linc-Kit+Sca-1 cells
were sorted into each well of 96-well flat-bottomed plates (#163320;
Nunc) with a FACSVantage equipped with an automatic cell deposition
unit (ACDU; Becton Dickinson). The clone-sorted cells were cultured in
each well containing 200 µL culture medium containing 30% FBS, 1%
deionized fraction V BSA, 104 mol mercaptoethanol,
and 20 ng/mL hG-CSF or 10 ng/mL mIL-3 in -MEM. The cultures were
incubated for 8 days at 37°C in a humidified atmosphere of 5%
CO2. On days 5 and 8 of culture, colony formation was
observed and classified using an inverted microscope. To confirm colony
types, each colony was lifted from the medium on day 8, spread on glass
slides using a cytocentrifuge (Cytospin 2; Shandon Inc), and stained
with May-Grünwald-Giemsa.
Replating experiment.
Blast colonies derived from BM cells of 5-FU-treated mice in clonal
culture and sorted hematopoietic progenitors in suspension culture were
recultured to analyze the hematopoietic capability of the constituent
cells.21 On day 7 of culture, blast colonies in clonal
culture were individually taken from methylcellulose medium with a
3-µL Eppendorf micropipette under an inverted microscope and
suspended in 200 µL of -MEM. After gentle pipetting, the samples
were equally divided into two aliquots: 100 µL was replated in
secondary methylcellulose culture supplemented with mIL-3, mSCF, hIL-6,
hTPO, and hEPO for hematopoietic progenitor assay, and the remaining
100 µL was used for cytospin preparations stained with
May-Grünwald-Giemsa to confirm their blastic character. Blast
colonies generated in suspension culture of clone-sorted cells were
processed similarly. The secondary cultures were incubated under the
conditions described above for an additional 8 days, and colonies
produced were scored in the same manner as the primary culture.
Assay for spleen colony-forming units.
The assay for spleen colony-forming unit (CFU-S) was performed using a
modification of the method of Till et al.22 Cell suspensions derived from hG-CSF- or PBS-treated Tg mice and
littermates were injected into C3H/HeN mice exposed to 9.2 Gy of total
irradiation from 60Co source at a dose rate of 1.0 Gy/min
via tail vein. Eight and 12 days after the injection, the recipients
were killed, their spleens were fixed in Bouin's solution, and
macroscopic colonies were counted under a microdissection microscope
(day-8 and day-12 CFU-S). Experimental groups were compared with
corresponding control groups (irradiation without cell injection). No
more than one colony was found in any irradiated control group of mice.
| |
RESULTS |
Establishment of hG-CSFR Tg mice.
To express hG-CSFR cDNA in Tg mice, we used the H2-Ld-pLG1
vector consisting of 1.4 kb of the 5-flanking sequence from the MHC class I H2-Ld gene and 0.5 kb of polyadenylation site
from the rabbit -globin gene. The H2-Ld promoter was
chosen to obtain ubiquitous expression of the transgene.23 hG-CSFR cDNA was inserted into the EcoRI site of the pLG1
expression vector to generate the pLd-hG-CSFR construct
(Fig 1). Expression of the construct was verified by flow cytometry
using hG-CSFR-transfected COS7 monkey kidney cells. The results of
flow cytometry indicated that expression of protein products was from
the pLd-hG-CSFR construct (data not shown). To generate Tg mice, the
4.9-kb Sph I-Xho I DNA fragment containing the hG-CSFR
and the H2-Ld promoter was injected into fertilized
(C3H/HeN) eggs, which were then transferred into the oviducts of
pseudopregnant females. To screen the Tg mice, tail DNA was analyzed by
PCR with oligonucleotide primers, P1 and P2 (Fig1). Size and copy
numbers of the transgene were then confirmed by Southern blot analysis
using the entire hG-CSFR cDNA as a probe (data not shown). Five of 17 founder offspring were found to carry the hG-CSFR transgene.
Expression of hG-CSFR in Tg mice.
Surface expression of the hG-CSFR transgene product in hematopoietic
cells was analyzed by flow cytometry using LMM741. Two of five lines
carrying hG-CSFR cDNA, designated lines #70 and #85, expressed hG-CSFR
on the surface of BM, spleen, and PB cells. Figure 2 shows the expression of hG-CSFR on
BM cells from a Tg mouse of line #70, which was used for subsequent
experiments. Normal littermates served as negative controls in all
experiments. The H2-Ld-hG-CSFR construct was designed to
produce ubiquitous expression of transgene RNA products in the Tg mice.
RT-PCR was performed to examine expression of the transgene RNA
transcripts in various tissues of Tg mice from line #70. RT-PCR
products of 393 bp were obtained from BM, PB, spleen,
thymus, liver, heart, intestine, brain, and kidney
(Fig 3). Transgene expression was
practically at the same level in male and female Tg mice from line #70
(data not shown). No remarkable differences in the number of white
blood cells, red blood cells, reticulocytes, platelets, and the levels of hemoglobin were found between Tg mice and littermates from line #70
(data not shown).
View larger version (20K):
[in this window]
[in a new window]
| Fig 2.
Cell surface expression of hG-CSFR on total BM cells
analyzed by flow cytometry. BM cells of a hG-CSFR-Tg mouse in line #70
and a littermate used as negative control were stained with
biotin-conjugated LMM741 followed by RPE-Cy5-conjugated streptavidin.
Fluorescence intensity of staining is plotted against relative cell
number.
|
|
View larger version (16K):
[in this window]
[in a new window]
| Fig 3.
RT-PCR analysis of transgene expression. RNA was prepared
from various tissues of hG-CSFR-Tg mice in line #70. cDNA derived from
1 µg total RNA was used for PCR. The lane marked ( ) is the PCR
product of a mock cDNA (no reverse transcriptase included in the cDNA
synthesis reaction). Normal mouse indicates the PCR product of the bone
marrow. PCR was performed for 30 cycles. Expression of the hG-CSFR
transgene was observed in BM, PB, spleen, thymus, liver, heart,
intestine, brain, and kidney.
|
|
Colony formation from BM cells of hG-CSFR Tg mice.
To examine the effect in vitro of hG-CSF on murine hematopoietic
progenitors expressing the hG-CSFR, we performed methylcellulose clonal
cultures using BM cells obtained from Tg mice and littermates (Table 1). In normal littermates, hG-CSF
supported formation of GM but not other types of colonies from BM cells
and showed no burst-promoting activity in the presence of EPO. The
formation of GM colonies in response to hG-CSF suggests that hG-CSF has cross-species activity with murine BM cells, in accordance with previous studies.24,25 In Tg mice, hG-CSF supported the
formation of greater numbers of GM colonies than in normal littermates. hG-CSF also supported the formation of Mk and mast cell colonies and
promoted erythroid burst formation. In addition, hG-CSF alone supported
the formation of a substantial number of Mix and blast colonies from BM
cells. These observations indicate that, when the hG-CSFR is expressed
by hematopoietic progenitors, hG-CSF can stimulate the proliferation
not only of myelocytic, but also erythroid, megakaryocytic, mast cell,
and multipotential hematopoietic progenitors. To confirm the effects of
hG-CSF on colony formation from hematopoietic progenitors expressing
the hG-CSFR, BM cells from Tg mice and littermates were cultured in the
presence of varying concentrations of hG-CSF. In littermates, hG-CSF
supported the dose-dependent formation of GM colonies
(Fig 4A and B) with a maximal effect at 20 ng/mL. No Mix or blast colony formation was observed at concentrations
of up to 500 ng/mL of hG-CSF (Fig 4C and data not shown). In Tg mice,
hG-CSF stimulated total colony formation in a dose-dependent manner
(Fig 4A). The response to hG-CSF in GM colony formation showed a
pattern similar to that seen in littermates. However, the total number
of GM colonies was higher for any given concentration of hG-CSF (Fig
4B). Mix and blast colonies were also formed in a dose-dependent
manner, reaching a plateau at 20 ng/mL of hG-CSF (Fig 4C).
View larger version (15K):
[in this window]
[in a new window]
| Fig 4.
A dose-response study for the effect of hG-CSF on the
formation of total (A), GM (B), and mix/blast colonies (C) by 1 × 105 BM cells of hG-CSFR-Tg mouse ( ) and littermate
( ). Representative data from the two separate experiments are
shown.
|
|
Colony formation from BM cells of 5-FU-treated mice.
To investigate in detail the effects of hG-CSF on multipotential
hematopoietic progenitors expressing the hG-CSFR, we cultured BM cells
from 5-FU-treated Tg mice and littermates in the presence of hG-CSF or
mIL-3 (Table 2). In littermates, hG-CSF did
not induce the formation of any colonies. In contrast, mIL-3 supported the formation of GM, Mix, and blast colonies. In Tg mice, both hG-CSF
and mIL-3 induced the formation of GM, Mk, and Mix colonies. Identical
numbers of blast colonies were induced by hG-CSF relative to mIL-3.
We next replated blast colonies induced by hG-CSF or mIL-3 and analyzed
their hematopoietic capability. Table 3
shows representative results of the replating. When recloned in the
secondary culture containing SCF, IL-3, IL-6, EPO, and TPO, blast
colonies induced by hG-CSF from BM cells of Tg mice gave rise to
erythroid bursts, GM, Mk, mast, Mix, and blast colonies. Expression of
hG-CSFR transgene RNA transcripts by these colonies was confirmed by
RT-PCR (data not shown). Whereas each blast colony gives rise to a
heterogeneous mix of secondary colony types, the distribution of
various progenitors in hG-CSF-induced blast cell colonies was
practically identical to that induced by mIL-3 in BM cells from
5-FU-treated Tg mice or littermates. Thus, hG-CSF appears to stimulate
the proliferation and differentiation of primitive multipotential
progenitors expressing the hG-CSFR, but does not affect their
commitment to each hematopoietic lineage.
Colony formation from clone-sorted
Linc-Kit+Sca-1+/
cells.
In Tg mice, accessory cells expressing the hG-CSFR may respond to
hG-CSF by producing various cytokines that induce proliferation or
differentiation of primitive hematopoietic progenitors. To explore this
possibility, we clone-sorted BM from Tg mice and littermates to obtain
Linc-Kit+Sca-1+ and
Linc-Kit+Sca-1 cells,
which have been shown to reflect primitive murine hematopoietic progenitors and more mature populations, respectively.26
Single-cell cultures were prepared (Table
4). Because it has been reported that only a portion of primitive
hematopoietic cells express Sca-1 antigen in C3H/HeN,27 we
generated hG-CSFR Tg mice and their littermates whose background was
(C57BL/6 × C3H/HeN) F1 and used their BM as a source
of sorted cells. mIL-3 supported the formation of various types of
colonies, including GM, Mk, mast, and Mix colonies from
Linc-Kit+Sca-1+ and
Linc-Kit+Sca-1 cells.
Blast colonies were generated from
Linc-Kit+Sca-1+ but not
Linc-Kit+Sca-1 cells
in both Tg mice and littermates. In contrast, hG-CSF supported only GM
colony formation from
Linc-Kit+Sca-1 cells.
A few GM colonies were derived from the
Linc-Kit+Sca-1+ primitive
cell population in littermates. In Tg mice, both hG-CSF and mIL-3
supported the formation of GM, Mk, mast, and Mix colonies, with a high
cloning efficiency from both fractions. Interestingly, in the presence
of hG-CSF, a significant number of blast colonies were generated from
Linc-Kit+Sca-1+ cells
obtained from Tg mice. When replated in secondary culture, these blast
colonies produced various types of colonies, including erythroid
bursts, and GM, Mk, mast, Mix, and blast colonies. Similar types of
colonies were induced by mIL-3 from BM cells of Tg mice and littermates
(Table 5). These results indicate that
hG-CSF acts directly on hematopoietic progenitors expressing the
hG-CSFR and that the effects of hG-CSF were not mediated by accessory cells. This finding further supports the concept that hG-CSF stimulates the development of primitive hematopoietic progenitors, but does not
induce exclusive commitment to the myeloid lineage.
Effect of hG-CSF administration to Tg mice.
To examine the effect in vivo of hG-CSF on hematopoietic progenitors
expressing the hG-CSFR, 1,000 µg/kg of hG-CSF was administered to Tg
mice and littermates for 7 days and then CFU-S and clonogenic cells in
BM and spleen were evaluated. As shown in
Table 6 (experiment no. 1), CFU-S in BM
from littermates did not increase with hG-CSF administration, relative
to PBS controls. In contrast, 2.9- and 2.2-fold increases were found in
day-8 and day-12 CFU-S, respectively, in BM from Tg mice. In the
spleen, hG-CSF led to marked increases in CFU-S in Tg mice, with day-8
and day-12 CFU-S increased 18.9- and 20.0-fold, respectively. In
littermates, hG-CSF induced a 7.5-fold increase in day-8 CFU-S and a
6.4-fold increase in day-12 CFU-S. Similar results were obtained in
experiment no. 2 in Table 6. Figure 5 shows
the total numbers of hematopoietic progenitors obtained from the BM and
spleen of Tg mice and littermates treated with hG-CSF determined by
methylcellulose clonal culture. Whereas the number of hematopoietic
progenitors in the BM of littermates was decreased by hG-CSF
administration, this treatment increased their numbers in Tg mice. The
increased progenitors in Tg mice contained a mix of types, including
Mix, blast, Mk, GM colony-forming units (CFU-Mix, CFU-Blast , CFU-Mk,
and CFU-GM, respectively), and erythroid burst-forming units
(BFU-E). However, the proportion of CFU-GM in total
clonogenic cells did not change with hG-CSF administration (78.2% and
77.1% in PBS- and hG-CSF-injected Tg mice, respectively).
Hematopoietic progenitors in the spleen increased with hG-CSF
administration, with the most significant increase seen in CFU-GM in
both Tg mice and littermates. However, the proportion of CFU-GM
increased in littermates (71.8% and 83.1% in PBS- and hG-CSF-injected littermates, respectively), but not in Tg mice (74.0%
and 70.7% in PBS- and hG-CSF-injected Tg mice, respectively). Similar
findings were obtained in another independent experiment. These results
indicate that hG-CSF also promotes the development of primitive
hematopoietic progenitors in vivo, but does not exclusively induce
their differentiation to the myeloid lineage.
View larger version (21K):
[in this window]
[in a new window]
| Fig 5.
Hematopoietic progenitors in BM cells from one femur and
one spleen of hG-CSFR-Tg mice and littermates receiving hG-CSF. The
numbers of hematopoietic progenitors were assayed by methylcellulose
clonal culture. "Others" include erythroid and mast cell
progenitors. Representative data from the three separate experiments
are shown.
|
|
| |
DISCUSSION |
G-CSF is a cytokine that specifically stimulates the differentiation of
hematopoietic progenitors to the myeloid lineage through interaction
with its receptor on the cells.24,28 In this study, using
Tg mice expressing the hG-CSFR, the activity of hG-CSF on multipotential progenitors was extensively analyzed. In vitro stimulatory effects of hG-CSF on multipotential progenitors were confirmed in a dose-response study of hG-CSF, culture of
5-FU-resistant progenitors, and single-cell cultures of clone-sorted
hematopoietic progenitors. In particular, a number of Mix and blast
colonies were generated from clone-sorted
Linc-Kit+Sca-1+ cells, but
not from
Linc-Kit+Sca-1 cells
of Tg mice in the presence of hG-CSF, indicating that the proliferation
of primitive multipotential progenitors is directly triggered by hG-CSF
and is not mediated by the effects of accessory cells activated by
hG-CSF. Furthermore, the effect of hG-CSF on the differentiation of
multipotential progenitors expressing the hG-CSFR was examined by
recloning experiments of blast colonies supported by hG-CSF from
5-FU-resistant progenitors of Tg mice. The constituent cells of blast
colonies contained not only myelocytic progenitors, but also various
other types of progenitors, including erythroid, megakaryocytic, mast
cell, and multipotential progenitors, with a distribution similar to
blast colonies supported by mIL-3. The detection of hG-CSFR transgene
RNA transcript in RT-PCR analysis of the secondary colonies suggests
that hematopoietic progenitors in the blast colonies were developed
upon binding of hG-CSF to the receptor on the cells. These observations
indicate that hG-CSF, which normally has activity only in cells of
myeloid lineage, as shown in experiments using littermates, does not
induce the commitment of multipotential progenitors to myeloid lineage
in Tg mice. Rather, hG-CSF supports their differentiation to various lineages.
Similar observations were obtained in previous in vitro studies of
murine hematopoietic cells transfected with the mouse macrophage colony-stimulating factor receptor29 or EPOR
transgene30 and in hGM-CSFR-Tg3 or mIL-5R-Tg
mice,4 although these studies did not exclude the
possibility that their observations might be modified by the effects of
accessory cells. In the present study, the noninterference of hG-CSF
with the commitment of multipotential progenitors expressing the
hG-CSFR was confirmed by the presence of various progenitors in the
blast colonies supported by hG-CSF derived from clone-sorted
Linc-Kit+Sca-1+ cells. These
results indicate that the differentiation process of multipotential
progenitors was not affected by accessory cells. The results obtained
in these experiments that use cells artificially expressing cytokine
receptors may be artifacts arising from receptor overexpression.
However, we have recently shown that, whereas the IL-6R, a
ligand-binding subunit of IL-6, is expressed on some human myelocytic
progenitors, gp130, a signal-transducing subunit of the IL-6R, is
expressed on most human hematopoietic progenitors. Thus, IL-6 acts on
only myelocytic progenitors, but the addition of soluble IL-6R to IL-6
activates gp130 resulting in the growth of various progenitors, such as
myelocytic, erythroid, megakaryocytic, and multipotential progenitors,
in the presence of SCF31,32 or ligand for
Flk-2/Flt-3.33 This means that the specificity of IL-6
activity depends on the potential of human hematopoietic progenitors to
express the IL-6R. Taken together, these results suggest that cytokines
function as proliferation-promoting factors of hematopoietic
progenitors expressing their receptors and that cellular
differentiation is determined by an intrinsic program, consistent with
the stochastic model of lineage commitment.
Indeed, hG-CSF supported only GM colony formation in a dose-dependent
manner. No other colony types were formed in littermates with up to 500 ng/mL of hG-CSF. In Tg mice, hG-CSF also supported GM colony formation
in a dose-dependent manner similar to that observed in littermates.
However, the number of GM colonies supported by hG-CSF in Tg mice in
the dose-response study and in single-cell cultures of clone-sorted
hematopoietic progenitors was greater than that in littermates. hG-CSF
supported GM colony formation from 5-FU-resistant progenitors in Tg
mice but not in littermates. In addition, hG-CSF supported the
formation of a significant number of GM colonies in
Linc-Kit+Sca-1+ cells from
Tg mice, but only a few GM colonies in littermates. These results
suggest that immature myelocytic progenitors may not express the
G-CSFR, leading to unresponsiveness to hG-CSF in littermates. In Tg
mice, the activity of hG-CSF was not restricted to myeloid lineages.
hG-CSF stimulated the proliferation of various types of hematopoietic
progenitors, including erythroid, megakaryocytic, mast cell, and
multipotential progenitors as well as myelocytic progenitors, in
accordance with reported data of hGM-CSFR-Tg mice.3 However, unlike the result in hGM-CSFR-Tg mice, we observed no erythroid colony and burst formation without EPO, although hG-CSF did
have burst-promoting activity in the presence of EPO. The different
effects on erythroid cell maturation may be due to differences in
signaling pathways between hG-CSFR and hGM-CSFR.
We also examined the effect of hG-CSF on hematopoiesis in Tg mice in
vivo. CFU-S and CFU-Mix/Blast in BM and spleen of Tg mice significantly
increased with hG-CSF treatment, demonstrating that hG-CSF stimulates
the growth of primitive hematopoietic progenitors expressing the
hG-CSFR in vivo. We observed that, although CFU-S and CFU-Mix/Blast
decreased in the BM of littermates, they increased in the spleen to a
lesser degree than in Tg mice. These increases in the spleen of
littermates may be due to migration of progenitors from BM after hG-CSF
treatment, in accordance with the report that G-CSF administration to
normal mice significantly stimulates mobilization of various
hematopoietic progenitors from BM to spleen.34 The
observation that the proportion of CFU-GM in total clonogenic cells was
not affected by hG-CSF treatment, despite the marked expansion of
primitive multipotential progenitors in Tg mice, also indicates that
hG-CSF does not induce a shift of differentiation of progenitors
expressing the hG-CSFR to the myeloid lineage in vivo.
It is generally held that self-renewal of hematopoietic stem cells
occurs according to a stochastic rule similar to the differentiation of
progenitor cells. Cytokines supporting the development of hematopoietic stem cells have not been found; hence, in vitro culture of
transplantable human stem cells has been unsuccessful. On the other
hand, whereas expression of cytokine receptors on human hematopoietic
stem cells has not been extensively analyzed, we recently found that
the hG-CSFR is expressed on myelocytic progenitors, but not primitive hematopoietic stem cells (Ebihara et al, unpublished
data). In this context, it is of interest to determine if
the activity of hG-CSF observed in the present study is applicable to
development of hematopoietic stem cells expressing the hG-CSFR. If it
is applicable, hG-CSF could support the development of human stem cells
in which the hG-CSFR is artificially expressed, without fear of loss of their stem cell activity. This strategy may possibly open up new molecular approaches to in vitro expansion of transplantable human hematopoietic stem and progenitor cells.
| |
ACKNOWLEDGMENT |
The authors thank S. Nagata for preparation of hG-CSFR plasmid; I. Nishijima for helpful discussions and technical advice; S. Hanada, I. Hirose, I. Suyama, and K. Sudo for excellent technical assistance; and
M. Ohara for comments on the manuscript.
| |
FOOTNOTES |
Submitted January 12, 1998;
accepted August 11, 1998.
Supported in part by the Japan Society for the Promotion of Science.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to Tatsutoshi Nakahata, MD, PhD,
Department of Clinical Oncology, The Institute of Medical Science, The
University of Tokyo, 4-6-1 Shirokanedai, Minato-ku, Tokyo 108, Japan;
e-mail: nakahata{at}ims.u-tokyo.ac.jp.
| |
REFERENCES |
1.
Ogawa M, Porter PN, Nakahata T:
Renewal and commitment to differentiation of hemopoietic stem cells (an interpretive review).
Blood
61:823, 1983[Free Full Text]
2.
Van Zant G, Goldwasser E:
Competition between erythropoietin and colony stimulating factor for target cells in mouse marrow.
Blood
53:946, 1979[Free Full Text]
3.
Nishijima I, Nakahata T, Hirabayashi Y, Inoue T, Kurata H, Miyajima A, Hayashi N, Iwakura Y, Arai K, Yokota T:
A human GM-CSF receptor expressed in transgenic mice stimulates proliferation and differentiation of hemopoietic progenitors to all lineages in response to human GM-CSF.
Mol Cell Biol
6:497, 1995
4.
Takagi M, Hara T, Ichihara M, Takatsu K, Miyajima A:
Multi-colony stimulating activity of interleukin 5 (IL-5) on hematopoietic progenitors from transgenic mice that express IL-5 receptor subunit constitutively.
J Exp Med
181:889, 1995[Abstract/Free Full Text]
5.
Zsebo KM, Cohen AM, Murdock DC, Boone TC, Inoue H, Chazin VR, Hines D, Souza LM:
Recombinant human granulocyte colony-stimulating factor: Molecular and biological characterization.
Immunobiology
172:175, 1986[Medline]
[Order article via Infotrieve]
6.
Nicola NA:
Hemopoietic cell growth factors and their receptors.
Annu Rev Biochem
58:45, 1989[Medline]
[Order article via Infotrieve]
7.
Clark SC, Kamen R:
The human hematopoietic colony-stimulating factors.
Science
236:1229, 1987[Abstract/Free Full Text]
8.
Demetri GD, Griffin JD:
Granulocyte colony-stimulating factor and its receptor.
Blood
78:2791, 1991[Free Full Text]
9.
Fukunaga R, Ishizaka-Ikeda E, Seto Y, Nagata S:
Expression cloning of a receptor for murine granulocyte colony-stimulating factor.
Cell
61:341, 1990[Medline]
[Order article via Infotrieve]
10.
Nicola NA, Metcalf D:
Binding of 125I-labeled granulocyte colony-stimulating factor to normal murine hemopoietic cells.
J Cell Physiol
124:313, 1985[Medline]
[Order article via Infotrieve]
11.
Hogan B, Beddington R, Constantini F, Lacy E:
Manipulating the Mouse Embryo. Cold Spring Harbor, NY, Cold Spring Harbor Laboratory, 1994, p 226.
12.
Sambrook J, Fritsch EF, Maniatis T:
Molecular Cloning. Cold Spring Harbor, NY, Cold Spring Harbor Laboratory, 1989, p 9.31.
13.
Chomczynski P, Sacchi N:
Single-step method of RNA isolation by acid-guanidium thiocyanate-phenol-chloroform extraction.
Anal Biochem
162:156, 1987[Medline]
[Order article via Infotrieve]
14.
Nakahata T, Ogawa M:
Clonal origin of murine hemopoietic colonies with apparent restriction to granulocyte-macrophage-megakaryocyte (GMM) differentiation.
J Cell Physiol
111:239, 1982[Medline]
[Order article via Infotrieve]
15.
Nakahata T, Ogawa M:
Identification in culture of a class of hemopoietic colony-forming units with extensive capability to self-renew and generate multipotential hemopoietic colonies.
Proc Natl Acad Sci USA
79:3843, 1982[Abstract/Free Full Text]
16.
Nakeff A, McQueen SD:
In vitro colony assay for a new class of megakaryocyte precursor: Colony-forming unit megakaryocyte (CFU-M).
Proc Soc Exp Biol Med
151:587, 1976[Medline]
[Order article via Infotrieve]
17.
Jackson CW:
Cholinesterase as a possible marker for early cells of the megakaryocytic series.
Blood
42:413, 1973[Abstract/Free Full Text]
18.
Nakahata T, Kobayashi T, Ishiguro A, Tsuji K, Naganuma K, Ando O, Yagi Y, Tadokoro K, Akebane T:
Extensive proliferation of mature connective-tissue type mast cells in vitro.
Nature
324:65, 1986[Medline]
[Order article via Infotrieve]
19.
Tajima S, Tsuji K, Ebihara Y, Sui XW, Tanaka R, Muraoka K, Yoshida M, Yamada K, Yasukawa K, Taga T, Kishimoto T, Nakahata T:
Analysis of interleukin 6 receptor and gp130 expressions and proliferative capability of human CD34+ cells.
J Exp Med
184:1357, 1996[Abstract/Free Full Text]
20.
Okumura N, Tsuji K, Ebihara Y, Tanaka I, Sawai N, Koike K, Komiyama A, Nakahata T:
Chemotactic and chemokinetic activities of stem cell factor on murine hematopoietic progenitor cells.
Blood
87:4100, 1996[Abstract/Free Full Text]
21.
Koike K, Nakahata T, Takagi M, Kobayashi T, Ishiguro A, Tsuji K, Naganuma K, Okano A, Akiyama Y, Akabane T:
Synergism of BSF-2/interleukin 6 and interleukin 3 on development of multipotential hemopoietic progenitors in serum-free culture.
J Exp Med
168:879, 1988[Abstract/Free Full Text]
22.
Till JE, McCulloch EA, Siminovitch L:
A stochastic model of stem cell proliferation, based on the growth of spleen colony-forming cells.
Proc Natl Acad Sci USA
51:29, 1964[Free Full Text]
23.
Suematsu S, Matsusaka T, Matsuda T, Ohno S, Miyazaki J, Yamamura K, Hirano T, Kishimoto T:
Generation of plasmacytomas with the chromosomal translocation t(12;15) in interleukin 6 transgenic mice.
Proc Natl Acad Sci USA
89:232, 1992[Abstract/Free Full Text]
24.
Nagata S, Tsuchiya M, Asano S, Kaziro Y, Yamazaki T, Yamamoto O, Hirata Y, Kubota N, Oheda M, Nomura H, Ono M:
Molecular cloning and expression of cDNA for human granulocyte colony-stimulating factor.
Nature
319:415, 1986[Medline]
[Order article via Infotrieve]
25.
Tsuchiya M, Asano S, Kaziro Y, Nagata S:
Isolation and characterization of the cDNA for murine granulocyte colony-stimulating factor.
Proc Natl Acad Sci USA
83:7633, 1986[Abstract/Free Full Text]
26.
Okada S, Nakauchi H, Nagayoshi K, Nishikawa S, Miura Y, Suda T:
In vivo and in vitro stem cell function of c-kit and Sca-1-positive murine hematopoietic cells.
Blood
80:3044, 1992[Abstract/Free Full Text]
27.
Spangrude GJ, Brooks DM:
Mouse strain variability in the expression of the hematopoietic stem cell antigen Ly-6A/E by bone marrow cells.
Blood
82:3327, 1993[Abstract/Free Full Text]
28.
Souza LM, Boone TC, Gabrilove J, Lai PH, Zsebo KM, Murdock DC, Chazin VR, Bruszewski JLH, Chen KK, Barendt J, Platzer E, Moore MAS, Mertelsmann R:
Recombinant human granulocyte colony-stimulating factor. Effects on normal and leukemic myeloid cells.
Science
232:61, 1986[Abstract/Free Full Text]
29.
Pharr PN, Ogawa M, Hofbauer A, Longmore GD:
Expression of an activated erythropoietin or a colony-stimulating factor I receptor by pluripotent progenitors enhances colony formation but does not induce differentiation.
Proc Natl Acad Sci USA
91:7482, 1994[Abstract/Free Full Text]
30.
Dubart A, Feger F, Lacout C, Goncalves F, Vainchenker W, Dumenil D:
Murine pluripotent hematopoietic progenitors constitutively expressing a normal erythropoietin receptor proliferate in response to erythropoietin without preferential erythroid cell differentiation.
Mol Cell Biol
14:4834, 1994[Abstract/Free Full Text]
31.
Sui X, Tsuji K, Tajima S, Tanaka R, Muraoka K, Ebihara Y, Ikebuchi K, Yasukawa K, Taga T, Kishimoto T, Nakahata T:
Erythropoietin-independent erythrocyte production: Signals through gp130 and c-kit dramatically promote erythropoiesis from human CD34+ cells.
J Exp Med
183:837, 1996[Abstract/Free Full Text]
32.
Sui X, Tsuji K, Tanaka R, Tajima S, Muraoka K, Ebihara Y, Ikebuchi K, Yasukawa K, Taga T, Kishimoto T, Nakahata T:
gp130 and c-Kit signals synergize for ex vivo expansion of human primitive hemopoietic progenitor cells.
Proc Natl Acad Sci USA
92:2859, 1996[Abstract/Free Full Text]
33.
Ebihara Y, Tsuji K, Lyman SD, Sui X, Yoshida M, Muraoka K, Yamada K, Tanaka R, Nakahata T:
Synergistic action of Flt3 and gp130 signalings in human hematopoiesis.
Blood
90:4363, 1997[Abstract/Free Full Text]
34.
Molineux G, Pojda Z, Dexter TM:
A comparison of hematopoiesis in normal and splenectomized mice treated with granulocyte colony-stimulating factor.
Blood
75:563, 1990[Abstract/Free Full Text]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
Y. Li, S. Chen, J. Yuan, Y. Yang, J. Li, J. Ma, X. Wu, M. Freund, K. Pollok, H. Hanenberg, et al.
Mesenchymal stem/progenitor cells promote the reconstitution of exogenous hematopoietic stem cells in Fancg-/- mice in vivo
Blood,
March 5, 2009;
113(10):
2342 - 2351.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Iwasaki, C. Somoza, H. Shigematsu, E. A. Duprez, J. Iwasaki-Arai, S.-i. Mizuno, Y. Arinobu, K. Geary, P. Zhang, T. Dayaram, et al.
Distinctive and indispensable roles of PU.1 in maintenance of hematopoietic stem cells and their differentiation
Blood,
September 1, 2005;
106(5):
1590 - 1600.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Yasuda, M. Shirakata, A. Iwama, A. Ishii, Y. Ebihara, M. Osawa, K. Honda, H. Shinohara, K. Sudo, K. Tsuji, et al.
Role of Dok-1 and Dok-2 in Myeloid Homeostasis and Suppression of Leukemia
J. Exp. Med.,
December 20, 2004;
200(12):
1681 - 1687.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Iwasaki-Arai, H. Iwasaki, T. Miyamoto, S. Watanabe, and K. Akashi
Enforced Granulocyte/Macrophage Colony-stimulating Factor Signals Do Not Support Lymphopoiesis, but Instruct Lymphoid to Myelomonocytic Lineage Conversion
J. Exp. Med.,
May 19, 2003;
197(10):
1311 - 1322.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Nosaka, S. Morita, H. Kitamura, H. Nakajima, F. Shibata, Y. Morikawa, Y. Kataoka, Y. Ebihara, T. Kawashima, T. Itoh, et al.
Mammalian Twisted Gastrulation Is Essential for Skeleto-Lymphogenesis
Mol. Cell. Biol.,
April 15, 2003;
23(8):
2969 - 2980.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Mitsui, S. Watanabe, Y. Taniguchi, S. Hanada, Y. Ebihara, T. Sato, T. Heike, M. Mitsuyama, T. Nakahata, and K. Tsuji
Impaired neutrophil maturation in truncated murine G-CSF receptor-transgenic mice
Blood,
April 15, 2003;
101(8):
2990 - 2995.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Matsuoka, K. Tsuji, H. Hisakawa, M.-j. Xu, Y. Ebihara, T. Ishii, D. Sugiyama, A. Manabe, R. Tanaka, Y. Ikeda, et al.
Generation of definitive hematopoietic stem cells from murine early yolk sac and paraaortic splanchnopleures by aorta-gonad-mesonephros region-derived stromal cells
Blood,
July 1, 2001;
98(1):
6 - 12.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Matsuoka, Y. Ebihara, M.-j. Xu, T. Ishii, D. Sugiyama, H. Yoshino, T. Ueda, A. Manabe, R. Tanaka, Y. Ikeda, et al.
CD34 expression on long-term repopulating hematopoietic stem cells changes during developmental stages
Blood,
January 15, 2001;
97(2):
419 - 425.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Shimizu, I. Kitabayashi, N. Kamada, T. Abe, N. Maseki, K. Suzukawa, and M. Ohki
AML1-MTG8 leukemic protein induces the expression of granulocyte colony-stimulating factor (G-CSF) receptor through the up-regulation of CCAAT/enhancer binding protein epsilon
Blood,
July 1, 2000;
96(1):
288 - 296.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. G. Lutz, C. Moog-Lutz, E. Coumau-Gatbois, L. Kobari, Y. Di Gioia, and Y. E. Cayre
Myeloblastin is a granulocyte colony-stimulating factor-responsive gene conferring factor-independent growth to hematopoietic cells
PNAS,
February 15, 2000;
97(4):
1601 - 1606.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F.-C. Yang, K. Tsuji, A. Oda, Y. Ebihara, M.-j. Xu, A. Kaneko, S. Hanada, T. Mitsui, A. Kikuchi, A. Manabe, et al.
Differential Effects of Human Granulocyte Colony-Stimulating Factor (hG-CSF) and Thrombopoietin on Megakaryopoiesis and Platelet Function in hG-CSF Receptor-Transgenic Mice
Blood,
August 1, 1999;
94(3):
950 - 958.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Top
Abstract
Introduction