|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 92 No. 12 (December 15), 1998:
pp. 4792-4797
Incidence of TEL/AML1 Fusion in Children With Relapsed
Acute Lymphoblastic Leukemia
By
Mignon L. Loh,
Lewis B. Silverman,
Mary L. Young,
Donna Neuberg,
Todd R. Golub,
Stephen E. Sallan, and
D. Gary Gilliland
From the Division of Hematology-Oncology, Brigham and Women's
Hospital, Department of Pediatric Oncology the Dana-Farber Cancer
Institute, and the Howard Hughes Medical Institute, Harvard Medical
School, Boston, MA.
 |
ABSTRACT |
The TEL/AML1 fusion associated with t(12;21)(p13;q22) is the
most common gene rearrangement in childhood leukemia, occurring in
approximately 25% of pediatric acute lymphoblastic leukemia (ALL), and
is associated with a favorable prognosis. For example, a cohort of
pediatric patients with ALL retrospectively analyzed for the
TEL/AML1 fusion treated on Dana-Farber Cancer Institute (DFCI)
ALL Consortium protocols between 1980 to 1991 demonstrated a 100%
relapse-free survival in TEL/AML1-positive patients with a
median of 8.3 years of follow-up. However, two recent studies analyzing
pediatric patients with relapsed ALL have reported the same incidence
of the TEL/AML1 rearrangement as in patients with newly
diagnosed ALL, suggesting that TEL/AML1 positivity is not a
favorable prognostic indicator. To clarify this apparent discrepancy, 48 pediatric patients treated on Dana-Farber Cancer Institute (DFCI)
protocols with ALL at first or second relapse were tested for
TEL/AML1 using reverse transcriptase-polymerase chain reaction (RT-PCR). The TEL/AML1 fusion was identified in only 1 of 32 analyzable relapsed ALL patients, in concordance with our previous
reports of improved disease-free survival in TEL/AML1-positive
patients. The low frequency of TEL/AML1-positive patients at
relapse is significantly different than that reported in other studies.
Although there are several potential explanations for the observed
differences in TEL/AML1-positive patients at relapse, it is
plausible that relapse-free survival in TEL/AML1-positive
patients may be changed with different therapeutic approaches. Taken
together, these results support the need for prospective analysis of
prognosis in TEL/AML1-positive patients.
© 1998 by The American Society of Hematology.
| |
INTRODUCTION |
THE TEL/AML1 REARRANGEMENT in
pediatric acute lymphoblastic leukemia (ALL) is the consequence of
t(12;21)(p13;q22).1,2 The gene rearrangement
is cryptic by standard cytogenetics but can be detected using reverse
transcriptase-polymerase chain reaction (RT-PCR), Southern blot, or
fluorescence in situ hybridization (FISH). TEL/AML1 occurs in
20% to 25% of children with B-progenitor ALL and is the most common
gene rearrangement yet identified in any pediatric
leukemia.1,3-13 The TEL/AML1 fusion frequently occurs in patients previously characterized as low or standard risk. A
retrospective analysis of 81 patients treated on Dana-Farber Cancer
Institute (DFCI)-ALL Consortium protocols demonstrated that 22 (27%)
were TEL/AML1-positive.3 Of these, 11 patients were
treated as high risk, although with current risk criteria, 7 patients
would be identified as high risk.14 Moreover, 100% of the
22 TEL/AML1-positive patients remained in complete continuous remission (CCR) with no relapses observed at a median follow-up of 8.3 years.3 One TEL/AML1-positive patient died of a
brain tumor. Sixteen of 54 TEL/AML1-negative patients
relapsed.3
Other investigators have also reported favorable outcomes for
TEL/AML1-positive patients in both retrospective analyses and prospective analyses with relatively short follow-up
(Table 1).4,6,7,12,13,15,16 However, at least four analyses of patients with relapsed ALL have
shown that the frequency of TEL/AML1 positivity at relapse is
similar to that at diagnosis (Table
2).7,17-19 One study retrospectively identified 9 of 35 (26%) patients who were TEL/AML1-positive at
relapse.17 In another retrospective analysis, 32 of 146 (22%) patients enrolled on relapse protocols of the
Berlin-Frankfurt-Munster (BFM) group were TEL/AML1-positive at
first or second relapse.18 Although the incidence of
TEL/AML1-positive patients at relapse approximates that
reported at diagnosis, both studies showed that the duration of initial
remissions was longer in TEL/AML1-positive patients.17,18 TEL/AML1-positive relapsed patients
also had a significantly higher probability of event-free survival
after relapse therapy.18 In a smaller study of 16 relapsed
cases of B-progenitor leukemia, 3 patients who experienced late
relapses (>30 months) had evidence of TEL/AML1
rearrangement.7 It is not clear if these patients were
screened for the TEL/AML1 rearrangement at initial diagnosis.
In a study that assessed the use of the TEL/AML1 fusion
transcript as a marker of minimal residual disease, 2 of 7 patients
relapsed with TEL/AML1 rearrangements in their bone
marrow.19
Taken together, these analyses show that the frequency of the
TEL/AML1 rearrangement in relapsed patients is similar to that reported at diagnosis. This suggests that TEL/AML1 positivity may not be as favorable a prognostic indicator as previously
reported.3,4,6,12,15,16 To clarify the apparent discrepancy
between the favorable prognosis of TEL/AML1 in our previous
study and reports of high TEL/AML1 frequency at relapse, we
screened for the TEL/AML1 fusion using RT-PCR from available
bone marrow from relapsed ALL patients initially treated on DFCI ALL
Consortium protocols from 1981 through 1995.
| |
MATERIALS AND METHODS |
Patients and specimens.
Between January 1, 1981 and December 31, 1995, 683 children (<18
years of age) with newly diagnosed ALL were treated on four consecutive
DFCI ALL Consortium protocols (81-01, 85-01, 87-01, and 91-01) at three
institutions: Boston Children's Hospital and the Dana-Farber Cancer
Institute, International Hospital of Puerto Rico, and, for 81-01 only,
Eastern Maine Medical Center. The initial diagnosis was made at the
treating institution. Informed consent for sample acquisition and
treatment was obtained from parents or guardians at the time of
diagnosis. The therapy delivered to patients on the four DFCI ALL
Consortium protocols is summarized in Table
3. Details of protocols 81-01 and 85-01 have been previously published.20,21 Treatment was based on risk group
assignment at the time of diagnosis (Table
4).
A total of 125 patients initially treated at these three institutions
subsequently relapsed after achieving first clinical remission. Bone
marrow samples obtained at diagnosis and relapse were sent to the DFCI
immunophenotyping lab and tumor bank. Only those patients with cells
obtained in excess of immunophenotyping requirements had samples viably
frozen. Samples were selected without knowledge of age at diagnosis,
sex, race, immunophenotype, cytogenetics, initial risk stratification,
or duration of first clinical remission. When available, paired samples
from initial diagnosis and relapse were analyzed.
Forty-seven patients had 64 available cryopreserved bone marrow samples
obtained from the DFCI tumor bank. Samples from 8 of these patients
failed to yield analyzable RNA. Thirty-nine patients with cryopreserved
bone marrow samples yielded RNA of sufficient quality for analysis of
TEL/AML1 gene rearrangement. In summary, a total of 51 samples
from these 39 patients had adequate RNA for analysis.
RNA extraction and RNA-based PCR.
Total RNA was extracted from cryopreserved bone marrow or peripheral
blood mononuclear cells using guanidinium/acid phenol extraction (RNA
STAT-60; Tel-Test, Friendwood, TX) according to the manufacturer's
instructions. Total RNA (4 µg) was reverse transcribed as previously
described.22 An aliquot of cDNA was then used in a control
PCR reaction to verify the integrity of the RNA sample using TEL
specific primers 458 (5 AGGTCATACTGCATCAGAAC3) and
750R (5ATTATTCTCCATGGGAGACA3) to amplify a 292-bp
TEL fragment spanning exons 4 and 5. Forty cycles of
PCR (94°C for 1 minute, 56°C for 1 minute, and 72°C for 1 minute) were performed as previously described on an MJ Research
thermal cycler (Watertown, MA), and 10 µL of the PCR product was
visualized on 2.5% agarose gels stained with ethidium bromide. Samples
that were negative for the control TEL expression were excluded
from further analysis.
Amplification of the TEL/AML1 fusion was performed in a nested
PCR reaction. First-round PCR used TEL primer 937 (5AACCTCTCTCATCGGGAAGA3) and AML1 primer 1142R
(5CAGAGTGCCATCTGGAACAT3). Forty cycles of PCR were
performed at an initial denaturing step of 94°C for 5 minutes,
followed by cycles of 94°C for 1 minute, 62°C for 1 minute, and
72°C for 1 minute. Four microliters of PCR product was reamplified
with second-round PCR using TEL primer 969 and AML1 primer Z3R.
TEL primer 969 (5GAACCACATCATGGTCTCTG3) and AML1
primer Z3R (5AACGCCTCGCTCATCTTGCCTG3) amplify a 174-bp fragment in 40 cycles of PCR (initial step of 94°C for 5 minutes, followed by cycles of 94°C for 1 minute, 60°C for 1 minute, and 72°C for 1 minute). Subsequent analysis of the PCR product (10 µL) was visualized on 1% agarose/3% NuSieve (Pharmacia, Piscataway, NJ) gels stained with ethidium bromide.
All assays were confirmed at least once. The positive control was RNA
extracted from the Reh cell line that harbors the TEL/AML1 gene
rearrangement.23,24 Negative controls contained PCR
reaction mixture without added cDNA. Appropriate positive and negative controls were used in each reaction. Template cDNA was added in a
separate lab after the PCR master mix was aliquoted into 96-well reaction plates.
Statistics.
The Fisher's Exact25 test was used for comparison of
categorical data, and the Wilcoxon Exact test was used when the
categories were ordered.25 Mantel's log rank test was used
to compare duration of first remission between relapsed patients who
were tested and relapsed patients who were not tested.26
The survival distribution for time to relapse data was estimated
according to Kaplan and Meier.27
| |
RESULTS |
Fifty-one cryopreserved bone marrow samples from 39 patients treated on
four consecutive DFCI protocols provided quality RNA for analysis.
Paired bone marrow samples were available in 13 patients at initial
diagnosis and relapse, in 19 patients at relapse only, and in 7 relapsed patients at initial diagnosis only. Four of the 13 patients
for whom bone marrow samples were available at initial diagnosis and at
relapse were previously analyzed at diagnosis and have been
reported.3 The seven relapsed patients who had bone marrow
samples only available at initial diagnosis are reported here but are
not included in the group that was tested. For statistical analysis,
these 7 patients are included in the 93 patients who were not tested.
The presenting characteristics of the remaining 32 patients analyzed
are presented in Table 4 and are compared with the presenting
characteristics of the 93 relapsed patients who were not tested. No
significant differences were found in age at diagnosis,
immunophenotype, sex, presence of central nervous system
(CNS) leukemia, or presence of t(9;22) between the two
groups. Analyzed patients were more likely to have been treated as high
risk or very high risk (P = .04). When using current DFCI risk
classification criteria (high risk includes the presence of any one of
the following: age <1.0 years or  10 years, white blood cell count
[WBC] 50,000/µL, T-cell phenotype, presence of anterior
mediastinal mass, any CNS leukemia), this difference is no longer
significant (P = .22).14 There was a significantly
longer duration of first clinical remission in the 32 patients who were
tested compared with the 93 patients who were not tested (log rank,
P = .01; Table 4). The median follow-up of the remaining 558 patients who were treated on these protocols and did not relapse was
7.8 years.
Only 1 relapsed patient of 32 (90% confidence interval, 0% to 14%)
was found to be TEL/AML1-positive. Additionally, none of the 7 relapsed patients with samples at initial diagnosis only was
TEL/AML1-positive. The relapsed patient harboring the
TEL/AML1 fusion was a male diagnosed at 43 months of age with a
B-progenitor, CD10+ phenotype with a presenting WBC of
40,200/dL and normal cytogenetics. He was stratified and treated as
high-risk on DFCI 91-01 because of a WBC greater than 20,000/µL at
presentation (Table 3). The patient relapsed in bone marrow and
cerebrospinal fluid (CSF) after 23 months of CCR, 2 months
before completion of continuation therapy. Reinduction was
unsuccessful, and he underwent allogeneic bone marrow transplantation
with persistent leukemia. He died of progressive bone marrow and CNS
disease with concomitant bacterial sepsis approximately 6 months after
initial relapse. A bone marrow sample at initial diagnosis was
TEL/AML1-positive. Peripheral blood mononuclear cells were
positive for the TEL/AML1 fusion on day 29 after bone marrow
transplantation, 2 weeks before obtaining a bone marrow aspirate
demonstrating refractory ALL with 58% lymphoblasts. Although no blood
samples were available at initial relapse, the patient had refractory
ALL throughout the last 6 months of his life and never achieved a
clinical remission.
Comparison of these results with other reported analyses of
TEL/AML1 frequency in relapsed patients is shown in
Table 5. Clinical characteristics of the
patients reported in other series appear to be similar to those
reported here. The median duration of first clinical remission for all
relapsed patients and all tested patients appears in concordance with
other reports. However, there is a significant difference between the
incidence of TEL/AML1 in relapsed patients with B-progenitor
ALL treated on DFCI ALL Consortium protocols and the incidence of
TEL/AML1 in relapsed patients with B-progenitor ALL reported by
other investigators.
| |
DISCUSSION |
Only 1 of 32 relapsed patients initially treated on DFCI ALL Consortium
protocols was TEL/AML1-positive. When considering only patients
with a B-progenitor phenotype that did not have the presence of
t(9;22), only 1 of 28 (3.6%) patients was TEL/AML1-positive. This low frequency is consistent with our previous study, in which a
retrospective analysis of newly diagnosed pediatric ALL patients showed
0 of 22 relapsed TEL/AML1-positive patients with 8.3 years of
median follow-up.3 Our results are significantly different when compared with other reported analyses of the incidence of TEL/AML1 in relapsed patients (Table 5).
There are several potential explanations for the differences between
our results and the reports of other investigators. First, there might
be a selection bias in our analysis, because samples were tested
retrospectively based on availability. It is possible that the
incidence of TEL/AML1 rearrangement is lower because a
disproportionately higher number of high/very high-risk patients had
samples available for analysis (Table 4). However, the clinical features of our study cohort appear similar to those reported by other
investigators, including the median length of
remission.17,18 TEL/AML1 positivity at relapse has
been associated with a longer duration of remission.7,17,18
The majority of our study cohort (60%) had a clinical remission that
exceeded 36 months. Therefore, it is unlikely that selection bias alone
explains the low incidence of TEL/AML1 positivity in our
series. To fully address the potential problem of selection bias
inherent in this and other retrospective studies, we are prospectively
analyzing the prognostic significance of TEL/AML1 in all newly
diagnosed patients with ALL treated on the current DFCI ALL Consortium
protocol (95-01).
Second, it is notable that half of the TEL/AML1-positive
patients identified in our previous report were treated as high risk based on a presenting WBC greater than 20,000/µL. The treatment that
these patients received may have been more intense than patients treated on other protocols reporting a higher relapse rate who may use
a higher WBC for risk classification. Only those patients meeting other
standard risk criteria with a WBC greater than 50,000/µL will be
treated as high risk on the current DFCI ALL Consortium protocol. Our
prospective analysis should determine whether the change in risk
stratification based on WBC will influence the outcome of
TEL/AML1-positive patients. However, it should be noted that
the 1 TEL/AML1-positive patient in the currently reported analysis was treated as high risk and still failed to sustain a
clinical remission.
Third, it is possible that the high incidence of TEL/AML1 at
relapse reflects a therapy-related malignancy that is
TEL/AML1-positive; that is, the patients were TEL/AML1
negative at initial diagnosis but were TEL/AML1-positive at
relapse. Many of the patients in the other reports were only analyzed
at relapse and not at initial diagnosis.7,17,18 To date,
there has been 1 case report of a 4-year-old patient with a
B-progenitor, CD10+ ALL whose diagnostic cytogenetics
demonstrated del(6q) and no abnormalities of 12p.28 Bone
marrow obtained at relapse 7 years after CCR demonstrated absence of
the original del(6q) clonal abnormality. Instead, a subtle deletion of
12p on the relapse karyotype led to FISH analysis, which detected the
t(12;21) rearrangement.28 Subsequent RT-PCR identified the
TEL/AML1 gene rearrangement.1 There was no bone
marrow available to determine whether the patient was
TEL/AML1-positive at initial diagnosis.
Although the TEL/AML1 rearrangement has not been shown to occur
in therapy related leukemias, it is usually a cryptic translocation and
may have yet to be identified. Balanced translocations involving AML1 with other fusion partners (ETO, EVI1)
have been demonstrated in therapy-related acute myeloid leukemias
(t-AML), particularly in association with exposure to topoisomerase II
inhibitors, including epipodophyllotoxins and
anthracyclines.29-33 In fact, the majority of relapsed
patients reported by Seeger et al18 and Harbott et
al17 were treated initially on BFM or Co-ALL protocols,
both of which include therapy with these agents.34-36
Additionally, the BFM and CoALL protocols also incorporate the use of
alkylating agents that have an association with myelodysplasia and
t-AML demonstrating unbalanced translocations.29,34-36
Whereas the patients treated on DFCI ALL Consortium protocols received
anthracyclines, none has received epipodophyllotoxins or alkylating
agents as part of their initial therapy (Table 3).
Finally, it is possible that the low incidence of
TEL/AML1-positive relapses in this study reflects differences
in the efficacy of the up-front therapy TEL/AML1-positive
patients. Historically, the DFCI and BFM treatment programs have
achieved similar outcome results in children with newly diagnosed ALL,
but with different treatment strategies.34 The intensive
BFM regimens, which include 2 months of induction therapy and a delayed
reinduction phase, use a greater number of drugs.34,36 The
DFCI regimens, distinguished by early consolidation with intensive
asparaginase for all patients and doxorubicin for higher risk patients,
have used fewer agents but at higher cumulative
dosages.20,21,34 It is possible that TEL/AML1-positive patients represent a biologically distinct
subset of patients whose leukemia is more effectively treated by the agents used more intensively by the DFCI group, such as asparaginase. Ongoing prospective trials may help clarify whether a particular treatment strategy more effectively treats patients with
TEL/AML1-positive ALL. Additionally, the development of
quantitative minimal residual disease assays may prove crucial to
following TEL/AML1-positive patients on different protocols.
At a minimum, these data strongly suggest that the presence of
TEL/AML1 at diagnosis is a favorable prognostic indicator but that treatment specific variables may influence outcome in this potentially curable cohort. Taken together with other published reports, our data would not support consideration of decrements in
therapy for TEL/AML1-positive patients at this time. Rather, they emphasize the ongoing need to confirm the prognostic significance of TEL/AML1 prospectively and to develop sensitive quantitative minimal residual disease assays to follow TEL/AML1-positive
patients on therapy.
| |
ACKNOWLEDGMENT |
The authors thank Virginia Dalton, Gaylord Garroway, Jennifer
Peppe-Bonasera, and Stacey Waters for assistance in obtaining clinical
data and members of the Connell-O'Reilly Cell manipulation and Gene
transfer laboratories at the Dana-Farber Cancer Institute for their
assistance in obtaining samples.
| |
FOOTNOTES |
Submitted March 25, 1998;
accepted August 12, 1998.
Supported in part by the Howard Hughes Medical Institute and Grant No.
CA68484 from the National Institutes of Health. D.G.G. is the Stephen
Birnbaum Scholar of the Leukemia Society of America and an investigator
in the Howard Hughes Medical Institute.
The publication costs of this
article were defrayed in part by
page charge payment. This article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
Address reprint requests to D. Gary Gilliland, PhD, MD, Harvard
Institute of Human Genetics, Howard Hughes Medical Institute, 4 Blackfan Circle, Room 421, Boston, MA 02115.
| |
REFERENCES |
1.
Golub TR, Barker GF, Bohlander SK, Hiebert SW, Ward DC, Bray-Ward P, Morgan E, Raimondi SC, Rowley JD, Gilliland DG:
Fusion of the TEL gene on 12p13 to the AML1 gene on 21q22 in acute lymphoblastic leukemia.
Proc Natl Acad Sci USA
92:4917, 1995[Abstract/Free Full Text]
2.
Romana SP, Mauchauffe M, Le Coniat M, Chumakov I, Le Paslier D, Berger R, Bernard OA:
The t(12;21) of acute lymphoblastic leukemia results in a tel-AML1 gene fusion.
Blood
85:3662, 1995[Abstract/Free Full Text]
3.
McLean TW, Ringold S, Neuberg D, Stegmaier K, Tantravahi R, Ritz J, Koeffler HP, Takeuchi S, Janssen JW, Seriu T, Bartram CR, Sallan SE, Gilliland DG, Golub TR:
TEL/AML-1 dimerizes and is associated with a favorable outcome in childhood acute lymphoblastic leukemia.
Blood
88:4252, 1996[Abstract/Free Full Text]
4.
Borkhardt A, Cazzaniga G, Viehmann S, Valsecchi MG, Ludwig WD, Burci L, Mangioni S, Schrappe M, Riehm H, Lampert F, Basso G, Masera G, Harbott J, Biondi A:
Incidence and clinical relevance of TEL/AML1 fusion genes in children with acute lymphoblastic leukemia enrolled in the German and Italian multicenter therapy trials. Associazione Italiana Ematologia Oncologia Pediatrica and the Berlin-Frankfurt-Munster Study Group.
Blood
90:571, 1997[Abstract/Free Full Text]
5.
Kobayashi H, Satake N, Maseki N, Sakashita A, Kaneko Y:
The der(21)t(12;21) chromosome is always formed in a 12;21 translocation associated with childhood acute lymphoblastic leukaemia.
Br J Haematol
94:105, 1996[Medline]
[Order article via Infotrieve]
6.
Liang DC, Chou TB, Chen JS, Shurtleff SA, Rubnitz JE, Downing JR, Pui CH, Shih LY:
High incidence of TEL/AML1 fusion resulting from a cryptic t(12;21) in childhood B-lineage acute lymphoblastic leukemia in Taiwan.
Leukemia
10:991, 1996[Medline]
[Order article via Infotrieve]
7.
Nakao M, Yokota S, Horiike S, Taniwaki M, Kashima K, Sonoda Y, Koizumi S, Takaue Y, Matsushita T, Fujimoto T, Misawa S:
Detection and quantification of TEL/AML1 fusion transcripts by polymerase chain reaction in childhood acute lymphoblastic leukemia.
Leukemia
10:1463, 1996[Medline]
[Order article via Infotrieve]
8.
Raimondi SC, Shurtleff SA, Downing JR, Rubnitz J, Mathew S, Hancock M, Pui CH, Rivera GK, Grosveld GC, Behm FG:
12p abnormalities and the TEL gene (ETV6) in childhood acute lymphoblastic leukemia.
Blood
90:4559, 1997[Abstract/Free Full Text]
9.
Raynaud S, Cave H, Baens M, Bastard C, Cacheux V, Grosgeorge J, Guidal-Giroux C, Guo C, Vilmer E, Marynen P, Grandchamp B:
The 12;21 translocation involving TEL and deletion of the other TEL allele: Two frequently associated alterations found in childhood acute lymphoblastic leukemia.
Blood
87:2891, 1996[Abstract/Free Full Text]
10.
Romana SP, Poirel H, Leconiat M, Flexor MA, Mauchauffe M, Jonveaux P, Macintyre EA, Berger R, Bernard OA:
High frequency of t(12;21) in childhood B-lineage acute lymphoblastic leukemia.
Blood
86:4263, 1995[Abstract/Free Full Text]
11.
Rubnitz JE, Downing JR, Pui CH, Shurtleff SA, Raimondi SC, Evans WE, Head DR, Crist WM, Rivera GK, Hancock ML, Boyett JM, Buijs A, Grosveld G, Behm FG:
TEL gene rearrangement in acute lymphoblastic leukemia: A new genetic marker with prognostic significance.
J Clin Oncol
15:1150, 1997[Abstract/Free Full Text]
12.
Shurtleff SA, Buijs A, Behm FG, Rubnitz JE, Raimondi SC, Hancock ML, Chan GC, Pui CH, Grosveld G, Downing JR:
TEL/AML1 fusion resulting from a cryptic t(12;21) is the most common genetic lesion in pediatric ALL and defines a subgroup of patients with an excellent prognosis.
Leukemia
9:1985, 1995[Medline]
[Order article via Infotrieve]
13.
Lanza C, Volpe G, Basso G, Gottardi E, Barisone E, Spinelli M, Ricotti E, Cilli V, Perfetto F, Madon E, Saglio G:
Outcome and lineage involvement in t(12;21) childhood acute lymphoblastic leukaemia [see comments].
Br J Haematol
97:460, 1997[Medline]
[Order article via Infotrieve]
14.
Smith M, Arthur D, Camitta B, Carroll AJ, Crist W, Gaynon P, Gelber R, Heerema N, Korn EL, Link M, Murphy S, Pui CH, Pullen J, Reamon G, Sallan SE, Sather H, Shuster J, Simon R, Trigg M, Tubergen D, Uckun F, Ungerleider R:
Uniform approach to risk classification and treatment assignment for children with acute lymphoblastic leukemia [see comments].
J Clin Oncol
14:18, 1996[Abstract]
15.
Rubnitz JE, Shuster JJ, Land VJ, Link MP, Pullen DJ, Camitta BM, Pui CH, Downing JR, Behm FG:
Case-control study suggests a favorable impact of TEL rearrangement in patients with B-lineage acute lymphoblastic leukemia treated with antimetabolite-based therapy: A Pediatric Oncology Group study.
Blood
89:1143, 1997[Abstract/Free Full Text]
16.
Cayuela JM, Baruchel A, Orange C, Madani A, Auclerc MF, Daniel MT, Schaison G, Sigaux F:
TEL-AML1 fusion RNA as a new target to detect minimal residual disease in pediatric B-cell precursor acute lymphoblastic leukemia.
Blood
88:302, 1996[Abstract/Free Full Text]
17.
Harbott J, Viehmann S, Borkhardt A, Henze G, Lampert F:
Incidence of TEL/AML1 fusion gene analyzed consecutively in children with acute lymphoblastic leukemia in relapse.
Blood
90:4933, 1997[Abstract/Free Full Text]
18.
Seeger K, Adams HP, Buchwald D, Beyermann B, Kremens B, Niemeyer C, Ritter J, Schwabe D, Harms D, Schrappe M, Henze G:
TEL-AML1 fusion transcript in relapsed childhood acute lymphoblastic leukemia.
Blood
91:1716, 1998[Abstract/Free Full Text]
19.
Satake N, Kobayashi H, Tsunematsu Y, Kawasaki H, Horikoshi Y, Koizumi S, Kaneko Y:
Minimal residual disease with TEL-AML1 fusion transcript in childhood acute lymphoblastic leukaemia with t(12;21).
Br J Haematol
97:607, 1997[Medline]
[Order article via Infotrieve]
20.
Clavell LA, Gelber RD, Cohen HJ, Hitchcock-Bryan S, Cassady JR, Tarbell NJ, Blattner SR, Tantravahi R, Leavitt P, Sallan SE:
Four-agent induction and intensive asparaginase therapy for treatment of childhood acute lymphoblastic leukemia.
N Engl J Med
315:657, 1986[Abstract]
21.
Schorin MA, Blattner S, Gelber RD, Tarbell NJ, Donnelly M, Dalton V, Cohen HJ, Sallan SE:
Treatment of childhood acute lymphoblastic leukemia: Results of Dana-Farber Cancer Institute/Children's Hospital Acute Lymphoblastic Leukemia Consortium Protocol 85-01.
J Clin Oncol
12:740, 1994[Abstract]
22.
Sambrook J, Fritsch EF, Maniatis T:
Molecular Cloning: A Laboratory Manual (ed 2). Cold Spring Harbor, New York, Cold Spring Harbor Laboratory, 1989.
23.
Venuat AM, Testu MJ, Rosenfeld C:
Cytogenetic abnormalities in a human null cell leukemia line (REH).
Cancer Genet Cytogenet
3:327, 1981[Medline]
[Order article via Infotrieve]
24.
Uphoff CC, MacLeod RA, Denkmann SA, Golub TR, Borkhardt A, Janssen JW, Drexler HG:
Occurrence of TEL-AML1 fusion resulting from (12;21) translocation in human early B-lineage leukemia cell lines.
Leukemia
11:441, 1997[Medline]
[Order article via Infotrieve]
25.
Cox DR:
Analysis of Binary Data. London, UK, Methuen, 1970.
26.
Mantel N:
Evaluation of survival data and two new rank order statistics arising in its consideration.
Cancer Chemother Rep
50:163, 1966[Medline]
[Order article via Infotrieve]
27.
Kaplan E, Meier P:
Nonparametric estimation from incomplete observations.
J Am Stat Assoc
53:457, 1958
28.
Filatov LV, Saito M, Behm FG, Rivera GK, Raimondi SC:
A subtle deletion of 12p by routine cytogenetics is found to be a translocation to 21q by fluorescence in situ hybridization: t(12;21)(p13;q22).
Cancer Genet Cytogenet
89:136, 1996[Medline]
[Order article via Infotrieve]
29.
Pedersen-Bjergaard J, Rowley JD:
The balanced and the unbalanced chromosome aberrations of acute myeloid leukemia may develop in different ways and may contribute differently to malignant transformation.
Blood
83:2780, 1994[Abstract/Free Full Text]
30.
Pedersen-Bjergaard J, Johansson B, Philip P:
Translocation (3;21)(q26;q22) in therapy-related myelodysplasia following drugs targeting DNA-topoisomerase II combined with alkylating agents, and in myeloproliferative disorders undergoing spontaneous leukemic transformation.
Cancer Genet Cytogenet
76:50, 1994[Medline]
[Order article via Infotrieve]
31.
Pedersen-Bjergaard J, Pedersen M, Roulston D, Philip P:
Different genetic pathways in leukemogenesis for patients presenting with therapy-related myelodysplasia and therapy-related acute myeloid leukemia.
Blood
86:3542, 1995[Abstract/Free Full Text]
32.
Nucifora G, Begy CR, Kobayashi H, Roulston D, Claxton D, Pedersen-Bjergaard J, Parganas E, Ihle JN, Rowley JD:
Consistent intergenic splicing and production of multiple transcripts between AML1 at 21q22 and unrelated genes at 3q26 in (3;21)(q26;q22) translocations.
Proc Natl Acad Sci USA
91:4004, 1994[Abstract/Free Full Text]
33.
Pui CH, Relling MV, Rivera GK, Hancock ML, Raimondi SC, Heslop HE, Santana VM, Ribeiro RC, Sandlund JT, Mahmoud HH, Evans WE, Crist WM, Krance RA:
Epipodophyllotoxin-related acute myeloid leukemia: A study of 35 cases.
Leukemia
9:1990, 1995[Medline]
[Order article via Infotrieve]
34.
Niemeyer CM, Reiter A, Riehm H, Donnelly M, Gelber RD, Sallan SE:
Comparative results of two intensive treatment programs for childhood acute lymphoblastic leukemia: The Berlin-Frankfurt-Munster and Dana-Farber Cancer Institute protocols.
Ann Oncol
2:745, 1991[Abstract/Free Full Text]
35.
Janka-Schaub GE, Harms D, Goebel U, Graubner U, Gutjahr P, Haas RJ, Juergens H, Spaar HJ, Winkler K:
Randomized comparison of rotational chemotherapy in high-risk acute lymphoblastic leukaemia of childhood Follow up after 9 years. Coall Study Group.
Eur J Pediatr
155:640, 1996[Medline]
[Order article via Infotrieve]
36.
Reiter A, Schrappe M, Ludwig W-D, Hiddemann W, Sauter S, Henze G, Zimmermann M, Lampert F, Havers W, Niethammer D, Odenwald E, Ritter J, Mann G, Welte K, Gadner H, Riehm H:
Chemotherapy in 998 unselected childhood acute lymphoblastic leukemia patients. Results and conclusions of the multicenter trial ALL-BFM 86.
Blood
84:3122, 1994[Abstract/Free Full Text]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
M. S. Brassesco, A. P. Montaldi, D. E. Gras, M. L. Camparoto, N. M. Martinez-Rossi, C. A. Scrideli, L. G. Tone, and E. T. Sakamoto-Hojo
Cytogenetic and molecular analysis of MLL rearrangements in acute lymphoblastic leukaemia survivors
Mutagenesis,
March 1, 2009;
24(2):
153 - 160.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. E. Rubnitz, D. Wichlan, M. Devidas, J. Shuster, S. B. Linda, J. Kurtzberg, B. Bell, S. P. Hunger, A. Chauvenet, C.-H. Pui, et al.
Prospective Analysis of TEL Gene Rearrangements in Childhood Acute Lymphoblastic Leukemia: A Children's Oncology Group Study
J. Clin. Oncol.,
May 1, 2008;
26(13):
2186 - 2191.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. Accordi, S. Pillozzi, M. C. Dell'Orto, G. Cazzaniga, A. Arcangeli, G. t. Kronnie, and G. Basso
Hepatocyte Growth Factor Receptor c-MET Is Associated with FAS and When Activated Enhances Drug-induced Apoptosis in Pediatric B Acute Lymphoblastic Leukemia with TEL-AML1 Translocation
J. Biol. Chem.,
October 5, 2007;
282(40):
29384 - 29393.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. L. Loh, M. A. Goldwasser, L. B. Silverman, W.-M. Poon, S. Vattikuti, A. Cardoso, D. S. Neuberg, K. M. Shannon, S. E. Sallan, and D. G. Gilliland
Prospective analysis of TEL/AML1-positive patients treated on Dana-Farber Cancer Institute Consortium Protocol 95-01
Blood,
June 1, 2006;
107(11):
4508 - 4513.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. D. Growney, H. Shigematsu, Z. Li, B. H. Lee, J. Adelsperger, R. Rowan, D. P. Curley, J. L. Kutok, K. Akashi, I. R. Williams, et al.
Loss of Runx1 perturbs adult hematopoiesis and is associated with a myeloproliferative phenotype
Blood,
July 15, 2005;
106(2):
494 - 504.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B.-M. Frost, E. Forestier, G. Gustafsson, P. Nygren, M. Hellebostad, O. G. Jonsson, J. Kanerva, K. Schmiegelow, R. Larsson, G. Lonnerholm, et al.
Translocation t(12;21) is related to in vitro cellular drug sensitivity to doxorubicin and etoposide in childhood acute lymphoblastic leukemia
Blood,
October 15, 2004;
104(8):
2452 - 2457.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G. Zaza, W. Yang, L. Kager, M. Cheok, J. Downing, C.-H. Pui, C. Cheng, M. V. Relling, and W. E. Evans
Acute lymphoblastic leukemia with TEL-AML1 fusion has lower expression of genes involved in purine metabolism and lower de novo purine synthesis
Blood,
September 1, 2004;
104(5):
1435 - 1441.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Konrad, M. Metzler, S. Panzer, I. Ostreicher, M. Peham, R. Repp, O. A. Haas, H. Gadner, and E. R. Panzer-Grumayer
Late relapses evolve from slow-responding subclones in t(12;21)-positive acute lymphoblastic leukemia: evidence for the persistence of a preleukemic clone
Blood,
May 1, 2003;
101(9):
3635 - 3640.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
W. A. G. Stams, M. L. den Boer, H. B. Beverloo, J. P. P. Meijerink, R. L. Stigter, E. R. van Wering, G. E. Janka-Schaub, R. Slater, and R. Pieters
Sensitivity to L-asparaginase is not associated with expression levels of asparagine synthetase in t(12;21)+ pediatric ALL
Blood,
April 1, 2003;
101(7):
2743 - 2747.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
W. L. Carroll, D. Bhojwani, D.-J. Min, E. Raetz, M. Relling, S. Davies, J. R. Downing, C. L. Willman, and J. C. Reed
Pediatric Acute Lymphoblastic Leukemia
Hematology,
January 1, 2003;
2003(1):
102 - 131.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. J. Moos, E. A. Raetz, M. A. Carlson, A. Szabo, F. E. Smith, C. Willman, Q. Wei, S. P. Hunger, and W. L. Carroll
Identification of Gene Expression Profiles That Segregate Patients with Childhood Leukemia
Clin. Cancer Res.,
October 1, 2002;
8(10):
3118 - 3130.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. M. Ford, K. Fasching, E. R. Panzer-Grumayer, M. Koenig, O. A. Haas, and M. F. Greaves
Origins of "late" relapse in childhood acute lymphoblastic leukemia with TEL-AML1 fusion genes
Blood,
August 1, 2001;
98(3):
558 - 564.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Seeger, A. V. Stackelberg, T. Taube, D. Buchwald, G. Korner, M. Suttorp, W. Dorffel, W. Tausch, and G. Henze
Relapse of TEL-AML1-Positive Acute Lymphoblastic Leukemia in Childhood: A Matched-Pair Analysis
J. Clin. Oncol.,
July 1, 2001;
19(13):
3188 - 3193.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Seeger, K.-A. Kreuzer, U. Lass, T. Taube, D. Buchwald, C. Eckert, G. Körner, C.-A Schmidt, and G. Henze
Molecular Quantification of Response to Therapy and Remission Status in TEL-AML1-Positive Childhood ALL by Real-Time Reverse Transcription Polymerase Chain Reaction
Cancer Res.,
March 1, 2001;
61(6):
2517 - 2522.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
N. L. R.-v. Woerden, R. Pieters, A. H. Loonen, I. Hubeek, E. van Drunen, H. B. Beverloo, R. M. Slater, J. Harbott, J. Seyfarth, E. R. van Wering, et al.
TEL/AML1 gene fusion is related to in vitro drug sensitivity for L-asparaginase in childhood acute lymphoblastic leukemia
Blood,
August 1, 2000;
96(3):
1094 - 1099.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Seeger, D. Buchwald, A. Peter, T. Taube, A. von Stackelberg, G. Schmitt, G. Henze;, M. L. Loh, L. B. Silverman, D. Neuberg, et al.
TEL-AML1 Fusion in Relapsed Childhood Acute Lymphoblastic Leukemia
Blood,
July 1, 1999;
94(1):
374 - 376.
[Full Text]
[PDF]
|
|
|
|
|
Top
Abstract
Introduction