Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Izon, D. J.
Right arrow Articles by Lawrence, H. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Izon, D. J.
Right arrow Articles by Lawrence, H. J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, Vol. 92 No. 2 (July 15), 1998: pp. 383-393

Loss of Function of the Homeobox Gene Hoxa-9 Perturbs Early T-Cell Development and Induces Apoptosis in Primitive Thymocytes

By David J. Izon, Sofia Rozenfeld, Stephen T. Fong, László Kömüves, Corey Largman, and H. Jeffrey Lawrence

From the Division of Hematology/Medical Oncology, Department of Medicine, and the Department of Dermatology, Veterans Affairs Medical Center, University of California, San Francisco, CA.


    ABSTRACT
Abstract
Introduction
Methods
Results
Discussion
References

Hox homeobox genes play a crucial role in specifying the embryonic body pattern. However, a role for Hox genes in T-cell development has not been explored. The Hoxa-9 gene is expressed in normal adult and fetal thymuses. Fetal thymuses of mice homozygous for an interruption of the Hoxa-9 gene are one eighth normal size and have a 25-fold decrease in the number of primitive thymocytes expressing the interleukin-2 receptor (IL-2R, CD25). Progression to the double positive (CD4+CD8+) stage is dramatically retarded in fetal thymic organ cultures. This aberrant development is associated with decreased amounts of intracellular CD3 and T-cell receptor beta  (TCRbeta ) and reduced surface expression of IL-7R and E-cadherin. Mutant thymocytes show a significant increase in apoptotic cell death and premature downregulation of bcl-2 expression. A similar phenotype is seen in primitive thymocytes from adult Hoxa-9-/- mice and from mice transplanted with Hoxa-9-/- marrow. Hoxa-9 appears to play a previously unsuspected role in T-cell ontogeny by modulating cell survival of early thymocytes and by regulating their subsequent differentiation.

    INTRODUCTION
Abstract
Introduction
Methods
Results
Discussion
References

THE Hox HOMEOBOX genes play major roles in pattern formation and tissue identity during embryogenesis,1,2 and mutations in Hox genes can produce dramatic morphologic abnormalities involving many body structures.3,4 Recent data have implicated Hox genes in hematopoietic development.5 Hox genes are expressed in stage- and lineage-specific patterns in primitive CD34+ blood cells, in lymphoid cell lines, in developing lymphocytes, and in activated mature T cells.6-9 Furthermore, enforced overexpression of Hox genes in bone marrow cells is associated with a variety of hematologic defects affecting myeloid and lymphoid differentiation.10-13 Recently, we reported defects in myeloid and B-lymphoid hematopoiesis in mice with a targeted disruption of the Hoxa-9 gene.14 Because these animals also displayed reductions in thymic size, we evaluated them for possible defects in T-cell development.

Early thymic development is characterized by a complex series of ordered events (Figs 1C and 3A), including T-cell receptor (TCR) rearrangements and expression of many cell surface molecules, including CD3, CD4, CD8, CD44, and CD25, the alpha  chain of the interleukin-2 receptor (IL-2R; reviewed in Nikolic-Zugic15). Well-defined control points in the T-cell developmental pathway insure that cells that do not complete key steps in the program are eliminated. A major control point involves an early proliferative stage that initiates differentiation of triple-negative (TN) thymocytes, a step requiring signaling through the IL-7 receptor (IL-7R).16 IL-7R signaling, which is mediated at least in part by bcl-2, permits rearrangement of the TCRbeta gene17 and then assembly of the pre-TCR complex, which includes TCRbeta and CD3.18 We demonstrate here that loss of Hoxa-9 function results in maturational defects at this early TN stage of T-cell development and increased death of fetal thymocytes.

    MATERIALS AND METHODS
Abstract
Introduction
Methods
Results
Discussion
References

Mice.   Mice bearing a targeted disruption of Hoxa-9 were furnished by Dr Cynthia Peterson and Dr Mario Capecchi (University of Utah, Salt Lake City, UT). The details of engineering embryonic stem cells with a Hoxa-9 allele disrupted by a NeoR cassette have been described previously.14 Both Hoxa-9+/- and Hoxa-9-/- mice appear externally normal and are fertile. For most experiments, timed pregnancies between heterozygotes were performed to generate homozygotes with heterozygous and wild-type littermates as controls. Because, in all the assays performed, heterozygous animals were indistinguishable from wild-type mice, for some experiments Hoxa-9-/- mice were mated with heterozygotes to generate litters of homozygotes and heterozygotes as controls. Progeny of various intercrosses were genotyped by polymerase chain reaction (PCR) using DNA isolated from tail or toe clips of weanlings and a 3-primer system to distinguish wild-type from mutant Hoxa-9 alleles. The two Hoxa-9-specific primers were CGCTGGAACTGGAGAAGGAGTTTCTG and ATCCTGCGGTTCTGGAACC AGATC; the Neo-specific primer was TCTATCGCCTTCTTGACGAGTTC.

Fluorescence-activated cell sorting (FACS) analysis.   For FACS analysis, cell suspensions from mouse thymuses were washed in phosphate-buffered saline (PBS) with 1% fetal calf serum (FCS) and 0.01% NaN3 (FACS buffer). Fc receptors were blocked, when possible, by preincubation with neat mouse serum or hybridoma supernatant from 2.4G2 (anti-FcR clone). Cells were then stained with appropriately diluted fluorochrome-conjugated antibodies. Cells were analyzed on a Becton Dickinson FACScan using Cellquest software (Becton Dickinson, San Jose, CA). Depending on whether the source of thymic tissue was fetal or adult, 5 × 103 to 1 × 105 cells were routinely analyzed. Dead cells were excluded using forward and side scatter gating or propidium iodide staining where possible.

Antibodies.   Antibodies used for surface staining included anti-alpha beta TCR (H57)-phycoerythrin (PE), anti-CD4-fluorescein isothiocyanate (FITC), anti-CD8alpha -TriColor, anti-CD25-PE (Caltag, South San Francisco, CA), anti-CD44-FITC (Pharmingen, San Diego, CA), and monoclonal antibody ECCD-2 against E-cadherin (Zymed, South San Francisco, CA). Monoclonal antibody A7R34, directed against the murine IL-7R, was furnished by Dr T. Sudo (Toray Industries, Kamakura, Japan).19 Negative controls used were Streptavidin-FITC, Streptavidin-TriColor (Caltag), and Streptavidin-PE (Pharmingen). For the detection of intracytoplasmic proteins, thymocytes were first permeabilized with 0.03% saponin and then stained with specific antibody. Antibodies used for intracellular staining included anti-TCRbeta , anti-CD3 (Caltag), hamster anti-bcl-2 (3F11; Pharmingen), and antihamster-PE (Caltag).

Reverse transcription-PCR (RT-PCR) analysis of Hoxa-9 expression in fetal mouse tissues.   RT-PCR analysis was performed following standard procedures, using an oligo (dT) primer at 42°C for 2 hours in a 20 µL reaction containing 10 U of SuperScript II reverse transcriptase (RT; GIBCO BRL, Grand Island, NY), manufacturer's RT buffer, 10 U RNasin (Promega, Madison, WI), 10 mmol/L dithiothreitol (DTT), and each dNTP at 1 mmol/L. Control reactions were performed without RT. Equal aliquots of RT reaction mixtures, normalized by independent PCR for beta -actin, were amplified using primers derived from sequences 3' to the homeodomain: 5' CGCGGATCCGGACCGAGCAAAAGACG AGTG 3' and 5' CCGGAATTCTAGCTTCCACAATCAC 3'. Hoxa-9 and beta -actin PCR were shown to be in the linear range. PCR products were analyzed by Southern blotting with a known Hoxa-9 probe.

Fetal thymic organ cultures.   Day-15.5 fetal thymuses were cultured in Dulbecco's modified Eagle's medium with 10% FCS and 2 mmol/L glutamine, according to methods of Robinson et al,20 with the exception that the filter was floated on the media instead of resting on a gelfoam sponge. Thymocytes were harvested after 6 or 10 days in culture by gently squeezing lobes under a coverslip and then stained and analyzed for FACS.

Assays for apoptosis.   To measure the percentage of hypodiploid cells, nuclei were isolated from freshly harvested day-15.5 fetal thymuses, incubated overnight with a hypotonic solution of propidium iodide, and analyzed on the FACScan at the low flow setting as previously described.21 The average percentage of hypodiploid nuclei (those located left of the 2n DNA) from normal fetal thymuses was approximately 5%. To assay thymocytes for membrane changes consistent with apoptosis, annexin V staining was performed on fetal thymuses. Thymuses were first enzymatically digested into a single-cell suspension by incubating in 100 µL of 1 mg/mL type 1 collagenase in PBS for 30 minutes at 37°C. Cells were stained first with CD45-biotin (Pharmingen) followed by streptavidin-PE (Pharmingen) to select lymphoid cells from contaminating stromal cells. The suspension was then stained with annexin V according to published methods and analyzed by FACS.22

    RESULTS
Abstract
Introduction
Methods
Results
Discussion
References

Reduced cellularity and TN thymocytes in adult and fetal Hoxa-9-/- thymuses.   The thymuses of adult Hoxa-9-/- mice are 60% less cellular than the glands of wild-type littermates (mean cell number, 50.3 ± 14 × 106 for Hoxa-9-/- animals [n = 8] v 120 ± 24 × 106 for wild-type mice [n = 7]; two-tailed P < .05). Adult Hoxa-9-/- thymuses have normal ratios of DP and mature single-positive (SP) cells as defined by CD4 and CD8 expression (Fig 1A). However, using an anti-TCR antibody, a significant contraction in the TN subpopulation was evident (Fig 1A and B), with a twofold reduction in the percentage of TN cells. When absolute cell numbers are compared (Fig 1B), there is a 3.6-fold reduction in TN cells in mutant thymuses compared with wild-type littermates (0.67 ± 0.13 × 106 cells v 2.41 ± 0.48 × 106; P < .01).


View larger version (34K):
[in this window]
[in a new window]
 
Fig 1. Defects in Hoxa-9-/- adult thymuses. (A) Hoxa-9-/- thymuses have reduced percentages of TN cells. FACS analysis using antibodies against CD4, CD8, and alpha beta TCR were performed. Hoxa-9-/- thymuses showed a twofold reduction in the percentage of CD4-CD8- cells (lower left quadrant, middle panels) and significant contraction of TN cells (lower left side panels), with no changes in the percentages of mature populations. The numbers in the CD4-CD8- panel represent the TN cells expressed as a percentage of total thymocytes. (B) Absolute numbers of T-cell subsets. Based on analyses of 5 litters, there were statistically significant decreases in cell numbers of TN, DN, DP, and SP populations of the Hoxa-9-/- thymuses (*P < .05; **P < .01). (C) Schematic representation of normal T-cell development, correlated with FACScan profiles. Note that the CD4-CD8+ subset (lower right quadrant) includes both mature and immature (ISP) cells, which can be distinguished by their expression or lack of expression of TCR (A, lower right side panels).

The thymic defect was much more severe in day-15.5 fetal Hoxa-9-/- mice, whose thymuses had only one eighth the cellularity of those of normal littermates (0.18 ± 0.03 × 105 [n = 8] v 1.4 × 105 ± 0.02 [n = 7]; P < .001). Histologically, the mutant glands appeared much smaller and less cellular (Fig 2A). It should be noted that at this early stage in development the thymus is composed largely of TN thymocytes.


View larger version (47K):
[in this window]
[in a new window]
 
Fig 2. Hoxa-9 in day-15.5 fetal thymuses. (A) Microphotographs of sections of mutant (top) and normal (bottom) day-15.5 fetal thymuses stained with methylene blue (original magnification × 150). Sections were taken through the midportion of each gland. (B) Hoxa-9 gene expression in normal fetal thymus. RT-PCR using primers specific for Hoxa-9 was performed on day-15.5 fetal tissues and the amplified cDNAs probed for Hoxa-9 by Southern blot analysis. Lanes 1 through 5 with RT; lane 1, thymus; lane 2, liver; lane 3, brain; lane 4, heart; lane 5, whole embryo; lane 6, markers (M); lanes 7 through 11, same tissues with no RT; lane 12, control (C) with no DNA. Strong signal is seen in lanes 1 and 2, representing fetal thymus and liver, respectively. (Upper panel) Ethidium bromide staining. (Middle panel) Southern blotting for Hoxa-9. (Lower panel) Actin control.

Expression of Hoxa-9 in murine fetal thymus.   Hoxa-9 expression in normal adult thymuses had been previously demonstrated.14 To determine if this gene was active during fetal thymic development, normal day-15.5 fetal tissues were subjected to RT-PCR analysis. Hoxa-9 mRNA is clearly expressed in thymus and liver, weakly detectable in heart, and virtually absent in brain (Fig 2B).

Reduced expression of CD25 (IL-2Ralpha chain) in Hoxa-9-/- thymuses.   T-cell precursors entering the thymus from the fetal liver express high levels of the surface molecule CD44. These primitive TN T cells then proceed through an orderly developmental sequence (Fig 3A) that includes transient expression of the alpha  chain of IL-2R (CD25), during which time active rearrangement of the TCRbeta chain occurs, followed by downregulation of CD44.23 To map the defect in the TN population of Hoxa-9 mice more precisely, day-15.5 fetal thymocytes were analyzed using antibodies against CD44 and CD25. Figure 3B demonstrates a fourfold to fivefold contraction in the percentage of CD25+ cells in the Hoxa-9-/- fetal thymus. When expressed in terms of absolute numbers, the CD25+ cells are reduced by approximately 25-fold (Fig 3C). It was interesting to note that the majority of mutant thymocytes appears to be CD25-CD44- cells (Fig 3B and C). In a normal thymus, CD25-CD44- thymocytes have completed TCRbeta rearrangement; however, as shown below, this is not the case in the mutant fetal thymocytes. The possibility was considered that some of these cells in the Hoxa-9-/- fetal thymus could represent other cell types that are also CD25-CD44-; however, FACS analysis showed no increase in myeloid, NK, or gamma delta T cells (data not shown).


View larger version (35K):
[in this window]
[in a new window]
 
Fig 3. Defective expression of CD25 in developing Hoxa-9-/- T cells. (A) Schematic representation of normal differentiation stages within the TN population of T cells, correlated with FACS scan profiles. The curved arrow points to the stage at which TCRbeta rearrangement is largely completed. (B) FACS analyses of day-15.5 fetal thymocytes was performed using antibodies against CD25 and CD44. A fourfold to fivefold reduction in the percentages of CD25+ cells (both CD44+ and CD44-) was seen in the mutant thymuses. (C) Absolute number of thymocyte subsets in fetal thymuses. Based on FACS analysis of 3 separate litters (representing 9 mutant and 12 control animals), there is an absolute decrease in all four major subsets of T cells in Hoxa-9-/- thymuses, with a 25.9-fold decrease in the CD25+ compartments. (D) A representative FACS analysis of adult CD4-CD8- thymocytes. The percentage of CD25+ cells is decreased in the mutant thymus (right panel). Similar results were seen with 2 additional Hoxa-9-/- thymuses.

To determine whether this defect in CD25 expression persisted into later life, adult CD4-CD8- thymocytes were also analyzed for expression of CD44 and CD25. The Hoxa-9-/- thymuses demonstrated a similar marked decrease in CD25 expression as that in the fetus (Fig 3D), but with no reduction in CD44 expression. Furthermore, lethally irradiated mice reconstituted with Hoxa-9-/- marrow also displayed CD25 downregulation in their CD4-CD8- T cells compared with controls (data not shown). This finding indicated that the defect was transplantable and therefore intrinsic to the hematopoietic cell.

The reduced expression of CD25 in primitive Hoxa-9-/- thymocytes did not represent a global inability to upregulate CD25, because, when activated by concanavalin A for 3 days, mature Thy-1+ T cells from adult Hoxa-9-/- spleens express CD25 equally well as wild-type controls (data not shown). Additionally, the common gamma  chain of the IL-2R was expressed at normal levels in Hoxa-9-/- fetal thymocytes (data not shown), indicating that other components of the IL-2 signaling pathway were not perturbed.

Retarded progression of Hoxa-9-/- thymocytes to DP T cells in fetal thymic organ cultures (FTOC).   To examine the ability of TN cells in Hoxa-9-/- mice to differentiate to DP cells, FTOC were performed. Individual day-15.5 fetal thymuses from Hoxa-9+/+ and Hoxa-9-/- mice were cultured for 6 days, and T-cell development was monitored by FACS analysis. There was a threefold decrease in total numbers of cells recovered from day-15.5 Hoxa-9-/- FTOCs compared with controls (1.99 ± 0.62 × 105 [n = 7] v 6.31 ± 0.95 × 105 [n = 7]; P < .005). In addition, there was a marked retardation in the progression of TN to DP, with a 10-fold increase (38.7% v 3.7%) in the percentage of CD8+ ISP cells and a twofold increase in the percentage of TN cells in Hoxa-9-/- FTOCs (Fig 4A and B).


View larger version (32K):
[in this window]
[in a new window]
 
Fig 4. Abnormal development of Hoxa-9-/- thymocytes in 6-day FTOCs. (A) FACS analysis of thymocytes harvested from 6-day FTOCs using antibodies against CD4, CD8, and alpha beta TCR. There is a marked decrease in the number of DP cells (upper right quadrant of middle panels) in the mutant thymuses, associated with a 10-fold increase in the percentage of CD8+ cells (lower right quadrant). These latter cells are ISPs, ie, TCR-CD8+, as shown in the lower right side panels, where the numbers represent ISP cells as a percentage of total thymocytes. (B) Absolute numbers of T-cell subsets in 6-day FTOCs. Based on analyses from 4 separate FTOC experiments (representing 7 mutant and 8 wild-type thymuses), there is a delay in progression of Hoxa-9-/- thymocytes through the ISP stage and significant reductions in the numbers of more mature DP and SP cells.

The marked relative increase in ISP cells in the day-6 Hoxa-9-/- FTOCs could simply reflect selective loss of CD4+ CD8+ cells. To address this possibility, FTOCs were performed for a longer time period (10 days) to examine progression to DP and mature SP thymocytes. Surprisingly, the Hoxa-9-/- thymuses exhibited significantly increased percentages of mature SP CD4+ and CD8+ cells when compared with wild-type thymuses, indicating that there was no selective loss of DP cells but rather a compensatory enhancement of DP to SP conversion in the mutant thymocytes (Fig 5A). In addition, there was an fivefold increase in the percentage of alpha beta TCRhi DP cells (representing cells undergoing active selection) in the Hoxa-9-/- FTOCs (Fig 5A, upper right panels). This phenomenon is also apparent in the analysis of total cell numbers from the different thymocytes subsets (Fig 5B). It should be noted that, after 10 days in culture, the mutant thymuses now had only a twofold decrease in cellularity compared with wild-type controls.


View larger version (31K):
[in this window]
[in a new window]
 
Fig 5. Accelerated progression of Hoxa-9-/- thymocytes to SP cells in 10-day FTOCs. (A) FACS analysis of thymocytes harvested from 10-day FTOCs using antibodies against CD4, CD8, and alpha beta TCR. Most of the Hoxa-9-/- cells have progressed through the DP stage to become mature SP cells. (B) Absolute numbers of T-cell subsets in 10-day FTOCs. Based on analyses from 3 separate FTOC experiments (representing 4 mutant and 6 wild-type thymuses), the numbers of SP mature cells in the mutant and normal FTOCs are not significantly different, but the number of Hoxa-9-/- DP is markedly reduced.

Multiple defects in the TN check point of T-cell development in Hoxa-9-/- thymuses.   Because mutant mice displayed a major defect in early T-cell development, we analyzed the expression of proteins specifically required for the progression of TN cells to DP T cells. Because this step requires signaling through the pre-TCR/CD3 complex, day-15.5 and -16.5 fetal thymuses were analyzed for intracellular CD3 (Fig 6A) and TCRbeta (Fig 6B) expression, respectively. Both were found to be markedly reduced in Hoxa-9-/- thymocytes, indicating defective or retarded TCRbeta rearrangement and assembly of a pre-TCR complex. Interestingly, the reduction of the levels of intracellular TCRbeta was not associated with any measurable reduction in mRNA levels of RAG-1 and RAG-2 as assayed by semiquantitative RT-PCR (J. Taubenberger, personal communication, October 1997). Because previous studies had demonstrated a key role of IL-7R signaling for TCRbeta gene rearrangement,24 IL-7R expression was also analyzed and found to be markedly downregulated compared with heterozygous controls (Fig 6C).


View larger version (35K):
[in this window]
[in a new window]
 
Fig 6. Multiple defects in the TN check point of T-cell development in Hoxa-9-/- thymuses. Day-15.5 or day-16.5 fetal thymocytes were subjected to FACS analysis using the specific antibodies indicated in each panel. (A) Intracellular CD3 expression. The percentage of mutant thymocytes expressing intracellular CD3 is markedly reduced. (B) Intracellular TCRbeta expression. Approximately one fourth of the normal fetal thymocytes have successfully rearranged their TCRbeta chain by day 16.5, whereas the extent of TCRbeta rearrangement in the Hoxa-9-/- T cells is diminished by fourfold. (C) IL-7R expression. The percentage of IL-7R+ thymocytes in Hoxa-9-/- thymuses is significantly decreased as is the mean fluorescence intensity. (D) E-cadherin expression on fetal thymocytes. The fraction of Hoxa-9-/- thymocytes expressing high levels of E-cadherin is diminished by half. All analyses were repeated with at least 3 separate mutant and control animals.

Abnormal expression of E-cadherin in mutant TN thymocytes.   It has been previously demonstrated that the adhesion molecule E-cadherin is expressed on fetal TN thymocytes as well as on thymic epithelial cells25,26 and that treating dispersed fetal thymuses with anti-E-cadherin antibody profoundly disturbs T-cell development.27 Given that E-cadherin has been proposed to be a target gene for certain Hox proteins,28 we wished to determine if E-cadherin expression was perturbed in Hoxa-9-/- TN thymocytes. FACS analysis using an E-cadherin antibody demonstrated that fewer than half of the mutant thymocytes express E-cadherin, whereas approximately 90% of control TN T cells stained brightly (Fig 6D).

Increased apoptotic cell death in fetal Hoxa-9-/- thymocytes.   Because developing T cells need signaling through the IL-7R and the pre-TCR complex for their survival and because both of these receptors appear to be reduced in Hoxa-9-/- thymocytes, we investigated whether there was evidence of decreased cell survival in Hoxa-9-/- TN thymuses. Increased cell death was suspected based on the increased side scatter and reduced average size of viable fetal Hoxa-9-/- thymocytes by forward scatter on FACS analysis and by a significant increase in cells staining with propidium iodide (data not shown). Histology of the mutant glands also showed increased numbers of pyknotic cells and nuclei with areas of condensed chromatin (Fig 7A).


View larger version (34K):
[in this window]
[in a new window]
 
Fig 7. Increased cell death in Hoxa-9-/- fetal thymuses. (A) Microphotographs of sections of mutant (right) and normal (left) day-15.5 fetal thymuses stained with methylene blue (original magnification × 560). The arrow points to a pyknotic nucleus and the arrow heads mark areas of chromatin condensation. (B) Day-15.5 Hoxa-9-/- thymocytes show a marked increase in hypodiploid nuclei by propidium iodide staining and FACS analysis. The percentage of hypodiploid nuclei in mutant thymuses is dramatically increased (lower two panels) as compared with control adult and fetal thymuses (upper two panels). (C) Annexin V staining of fetal thymocytes. Mutant thymuses (n = 7) show an approximate threefold increase in the percentage of cells binding high levels of annexin V as compared with control animals (n = 10), as well as significant increases in the fraction binding intermediate levels. (D) Bcl-2 protein levels in day-15.5 thymocytes. Control thymocytes (n = 12) show high levels in bcl-2 protein in nearly all cells, whereas half of the Hoxa-9-/- thymocytes (n = 4) show markedly reduced levels of bcl-2 (solid lines). Dotted lines depict staining with hamster IgG-PE as a negative control.

To further analyze this phenomenon of increased cell death, cell suspensions from individual day-15.5 fetal Hoxa-9+/+ and Hoxa-9-/- thymuses were stained with a hypotonic propidium iodide solution and analyzed by FACS to measure ploidy. Figure 7B shows that greater than 50% of the fetal Hoxa-9-/- thymocytes are hypodiploid and presumably apoptotic, compared with less than 10% hypodiploid cells in control fetal thymuses. In some of the Hoxa-9-/- thymuses, the percentage of hypodiploid cells exceeded 75%. Finally, analyzing cells for Annexin V binding showed a marked increase in both high and intermediate levels of binding in the mutant T cells, indicating membrane changes seen in early apoptosis (Fig 7C).

The antiapoptotic protein bcl-2 is normally expressed at high level in TN thymocytes and is downregulated in most T cells as they progress to the DP stage.29,30 To ascertain whether bcl-2 expression was altered in primitive Hoxa-9-/- T cells, thymocytes from day-15.5 fetuses were stained intracellularly with anti-bcl-2 antibody. The majority of control thymocytes express high levels of bcl-2, whereas Hoxa-9-/- thymocytes show a distinctive biphasic pattern, with approximately half the cells showing very diminished levels of the protein (Fig 7D).

    DISCUSSION
Abstract
Introduction
Methods
Results
Discussion
References

In summary, Hoxa-9-/- mice have a major defect in fetal thymic development with severe reductions in immature thymocytes and blunted expression of several surface markers, including CD25, IL-7R, and E-cadherin, all accompanied by a marked downregulation of bcl-2 expression and an increase in cell death. These defects are intrinsic to the Hoxa-9-/- hematopoietic cells and not the thymic stroma, because mice transplanted with Hoxa-9-/- bone marrow display similar thymic abnormalities. The perturbations in T-cell development associated with loss of Hoxa-9 function are complex, because, in addition to the marked abnormalities at the TN stage, mutant thymocytes show delayed progression through the ISP stage and a curious acceleration from DP to mature single-positive T cells. It is not clear whether these later abnormalities reflect a true physiologic role for Hoxa-9 at the ISP and DP stages of T-cell differentiation or whether they represent the consequences and/or compensations for the defects seen at the TN stage. The fact that the block in T-cell development in Hoxa-9-/- mice is not complete may indicate that paralogous Hox genes are partially compensating for the mutation. The T-cell defect is much more severe in fetal thymuses than in adults, perhaps because of the stress of rapid growth in the fetal thymus.

One interpretation of the immunophenotypic findings in Hoxa-9-/- fetal thymuses is that early T-cell development is potentially accelerated, with an abnormally high proportion of the mutant cells having already arrived at the CD25-CD44- stage of TN differentiation by day 15.5 of gestation. However, normal CD25-CD44- TN thymocytes express significant levels of intracellular TCRbeta and CD3, unlike a large majority of the Hoxa-9-/- fetal thymocytes. Thus, one explanation for the role of Hoxa-9 in early T-cell development is that it initiates and/or orchestrates certain molecular events that occur during the CD25+ step of TN differentiation. In this model, the absence of Hoxa-9-/- activity results in increased cell death in thymocytes that reach the CD25-CD44- stage, because few of them have assembled a surface pre-TCR complex through which to receive the required survival signals.

The precise genetic programs that are modulated by Hoxa-9 function during T-cell development remain to be determined. The dramatic reduction in CD25+ TN cells suggests a defect in the IL-2 signaling pathway. Mice with a null mutation of the IL-2Rgamma chain or a dominant-negative mutant IL-2Rgamma chain show a similar slowing of the TN to DP transition.31,32 However, the common IL-2Rgamma chain expression is not reduced in Hoxa-9-/- thymuses, and the activity of the alpha  chain, CD25, is not required for normal T-cell development.33 In addition, expression of CD25 in mature Hoxa-9-/- T cells can still be activated normally by mitogens. CD44 expression is also diminished in the mutant fetal thymocytes, but not in the thymocytes of adult Hoxa-9-/- mice. These data taken together suggest that the lack of CD25 and CD44 expression per se in Hoxa-9-/- fetal thymuses does not account for the observed defects in early T-cell development, but is rather indicating a lack of thymocytes at that stage of TN differentiation in the mutant glands.

The T-cell defects in Hoxa-9-/- mice could also be a consequence of defective IL-7/IL-7R receptor signaling. T-cell precursors entering the thymus appear to be wholly dependent on IL-7 for their survival and for TCRbeta rearrangement.16,34 One expected consequence of blunted IL-7 signaling is decreased cell survival, and in fact Hoxa-9-/- fetal thymuses show a marked increase in cell death. It is important to recognize that the survival signal furnished via the IL-7/IL-7R pathway appears to be largely mediated by bcl-2. Indeed, a bcl-2 transgene can completely rescue the defect in T-cell development seen in animals with mutant IL-7 receptors.35,36 Thus, the defective expression of IL-7R and/or bcl-2 in Hox-a9-/- thymuses could contribute to the observed defects in T-cell development.

Thymic epithelial cells are the predominant source of IL-7 in the thymus,37 and scanning electron microscopy has shown the intimate connection between developing T cells and the surrounding thymic epithelium.38 It is therefore conceivable that perturbations in the normally tight interactions between developing thymocytes and thymic epithelium underlie the defect in Hoxa-9-/- animals. One of the adhesion molecules that appears to mediate these tight interactions is E-cadherin, and interfering with homotypic E-cadherin interactions between thymic epithelium and primitive thymocytes severely perturbs thymocyte development.27 Some data suggest that adhesion molecules, including N-CAM and certain cadherins, are transcriptionally regulated by Hox proteins.39-41 A Hoxa-1 mutant mouse has been shown to have reduced cadherin-6 expression in the head folds of day-8.5 embryos.42 Evidence linking Hox proteins to the regulation of E-cadherin comes from work by Goomer et al,28 who demonstrated that Hoxd-9 could bind to DNA sequences in an enhancer in the E-cadherin gene. A reporter construct containing this enhancer element could be activated by Hoxd-9 in transient transcription assays and overexpression of Hoxd-9 upregulated expression of the endogenous E-cadherin gene. These results are interesting, because Hoxd-9 has a high degree of homology (>90% identity at the amino acid level) to Hoxa-9, and both proteins can bind to the same DNA target sequence (W.-F. Shen and C. Largman, unpublished observations).

Previous studies have furnished evidence for a link between homeobox genes and the regulation of cell proliferation. Kawabe et al43 reported that the orphan homeobox gene HOX11 could interact with genes involved in cell-cycle control and that misexpression of HOX11 in frog oocytes produced G2 arrest. It is noteworthy that we failed to demonstrate any significant alteration in cell cycling in the Hoxa-9-/- thymocytes (D. Izon, data not shown). Alternatively, there is evidence that homeobox genes may regulate cell survival and death. Expression of the homeobox fusion gene E2A-PBX1 in transgenic mice severely perturbs lymphoid development, with severe lymphopenia and high levels of apoptosis.44 Other investigators used antisense oligonucleotides to block the expression of PAX-type homeobox genes and observed apoptotic cell death.45

Homeobox genes are vital for cell lineage commitment decisions during embryogenesis and later development in such diverse species as flies and mammals. Hox genes are active in hematopoietic stem cells6 and have been implicated in leukemogenesis.11,46 However, until recently, there has been little definitive evidence to suggest that they function in normal blood cell development. The results presented here clearly demonstrate that Hoxa-9 is required for full and efficient T-cell maturation and that loss of Hoxa-9 function perturbs the chronology of early T-cell differentiation. These experiments suggest a novel and unexpected role for a Hox gene in T-cell development, modulating the death and differentiative potential of early thymocytes.

    FOOTNOTES

   Submitted March 12, 1998; accepted April 24, 1998.
   Supported in part by National Institutes of Health Grants No. RO1 DK 48642 (H.J.L.) and N44 DK 3-2219 (C.L.) and grants from the Department of Veterans Affairs (H.J.L. and C.L.). H.J.L. is a recipient of a VA Career Development Award.
   Address reprint requests to H. Jeffrey Lawrence, MD, Hematology Research (151H), Veterans Affairs Medical Center, 4150 Clement St, San Francisco, CA 94121; e-mail: lawrencej{at}vacom.ucsf.edu.
   The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.

    ACKNOWLEDGMENT

The authors are grateful to Drs C. Peterson and M. Capecchi for furnishing the Hoxa-9-/- mice and to Dr T. Sudo for supplying antibody A7R34. We also thank Drs R.K. Humphries, G. Sauvageau, and A. Kruisbeek for their critical review of the data and Drs J. Taubenberger, S. Boehme, and J.M. McCune for many helpful comments.

    REFERENCES
Abstract
Introduction
Methods
Results
Discussion
References

1. Lawrence PA, Morata G: Homeobox genes: Their function in Drosophila segmentation and pattern formation. Cell 78:181, 1994[Medline] [Order article via Infotrieve]

2. Krumlauf R: Hox genes in vertebrate development. Cell 78:191, 1994[Medline] [Order article via Infotrieve]

3. Chisaka O, Musci TS, Capecchi MR: Developmental defects of the ear, cranial nerves, and hindbrain resulting from targeted disruption of the mouse homeobox gene Hox 1.6. Nature 355:516, 1992[Medline] [Order article via Infotrieve]

4. Ramirez-Solis R, Zheng H, Whiting J, Krumlauf R, Bradley A: Hoxb-4 (Hox 2.6) mutant mice show homeotic transformation of a cervical vertebra and defects in the closure of the sternal rudiments. Cell 73:279, 1993[Medline] [Order article via Infotrieve]

5. Lawrence HJ, Sauvageau G, Humphries RK, Largman C: The role of HOX homeobox genes in normal and leukemic hematopoiesis. Stem Cells 14:281, 1996[Abstract]

6. Sauvageau G, Lansdorp PM, Eaves CE, Hogge DE, Dragowska WH, Reid DS, Largman C, Lawrence HJ, Humphries RK: Differential expression of homeobox genes in functionally distinct CD34+ subpopulations of human bone marrow cells. Proc Natl Acad Sci USA 91:12223, 1994[Abstract/Free Full Text]

7. Care A, Testa U, Bassani A, Tritarelli E, Montesoro E, Samoggia P, Cianetti L, Peschle C: Coordinate expression and proliferative role of HOXB genes in activated adult T lymphocytes. Mol Cell Biol 14:4872, 1994[Abstract/Free Full Text]

8. Giampaolo A, Sterpetti P, Bugacrini D, Samoggia P, Pelosi P, Valtieri F, Peschle C: Key functional role and lineage-specific expression of selected HOXB genes in purified hematopoietic progenitor differentiation. Blood 84:3637, 1994[Abstract/Free Full Text]

9. Kongsuwan K, Webb E, Housiaux P, Adams JM: Expression of multiple homeobox genes within diverse mammalian haemopoietic lineages. EMBO J 7:2131, 1988[Medline] [Order article via Infotrieve]

10. Sauvageau G, Thorsteinsdottir U, Eaves CJ, Lawrence HJ, Largman C, Lansdorp PM, Humphries RK: Overexpression of HOXB4 in hematopoietic cells causes the selective expansion of more primitive populations in vitro and in vivo. Genes Dev 9:1753, 1995[Abstract/Free Full Text]

11. Thorsteinsdottir U, Sauvageau G, Hough MR, Dragowska W, Lansdorp PM, Lawrence HJ, Largman C, Humphries RK: Overexpression of HOXA10 in murine hematopoietic cells perturbs both myeloid and lymphoid differentiation and leads to acute myeloid leukemia. Mol Cell Biol 17:495, 1997[Abstract]

12. Sauvageau G, Thorsteinsdottir U, Hough MR, Hugo P, Lawrence HJ, Largman C, Humphries RK: Overexpression of HOXB3 in hematopoietic cells causes defective lymphoid development and progressive myeloproliferation. Immunity 6:13, 1997[Medline] [Order article via Infotrieve]

13. Perkins AC, Cory S: Conditional immortalization of mouse myelomonocytic, megakaryocytic and mast cell progenitors by the Hox-2.4 homeobox gene. EMBO J 12:3835, 1993[Medline] [Order article via Infotrieve]

14. Lawrence HJ, Helgason CD, Sauvageau G, Fong ST, Izon DJ, Humphries RK, Largman C: Mice bearing a targeted disruption of the homeobox gene HOXA9 have defects in myeloid, erythroid and lymphoid hematopoiesis. Blood 89:1922, 1997[Abstract/Free Full Text]

15. Nikolic-Zugic J: Intrathymic T-Cell Development. Austin, TX, R.G. Landes, 1994

16. Peschon JJ, Morrissey PJ, Grabstein KH, Ramsdell FJ, Maraskovsky E, Bliniak BC, Park LS, Siegler SF, Williams DE, Ware CB, Meyer JD, Davison BL: Early lymphocyte expansion is severely impaired in interleukin 7 receptor-deficient mice. J Exp Med 180:1955, 1994[Abstract/Free Full Text]

17. Mombaerts P, Clarke AR, Rudnicki MA, Iacomini J, Itohara S, Lafaille JJ, Wang L, Ichikawa Y, Jaenisch R, Hooper ML, Tonegawa S: Mutations in T-cell antigen receptor genes alpha  and beta  block thymocyte development at different stages. Nature 360:225, 1992[Medline] [Order article via Infotrieve]

18. Groettrup M, Ungewiss K, Azogui O, Palacios R, Owne MJ, Hayday AC, von Boehmer H: A novel disulfide-linked heterodimer on pre-T cells consists of the T cell receptor beta  chain and a 33 kd glycoprotein. Cell 75:283, 1993[Medline] [Order article via Infotrieve]

19. Sudo T, Nishikawa S, Ohno N, Akiyama N, Tamakoshi M, Yoshida H, Nishikawa S-I: Expression and function of the interleukin 7 receptor in murine lymphocytes. Proc Natl Acad Sci USA 90:9125, 1993[Abstract/Free Full Text]

20. Robinson JH, Owen JJT: Generation of T cell function in organ culture of foetal mouse thymus. II. Mixed lymphocyte culture reactivity. Clin Exp Immunol 27:322, 1977[Medline] [Order article via Infotrieve]

21. Nicoletti I, Miglorati G, Pagliacci MC, Gignani F, Riccardi C: A rapid and simple method for measuring thymocyte apoptosis by propidium iodide staining and flow cytometry. J Immunol Methods 139:271, 1991[Medline] [Order article via Infotrieve]

22. Vermes I, Haanen C, Steffens-Nakken H, Reutlingsperger CPM: A novel assay for apoptosis: Flow cytometric detection of phosphatidylserine expression on early apoptotic cells using fluorescein labeled Annexin V. J Immunol Methods 184:39, 1995[Medline] [Order article via Infotrieve]

23. Godfrey DI, Kennedy J, Suda T, Zlotnik A: A developmental pathway involving four phenotypically and functionally distinct subsets of CD3-CD4-CD8- triple-negative adult mouse thymocytes defined by CD44 and CD25 expresssion. J Immunol 150:4244, 1993[Abstract]

24. Muegge K, Vila MP, Durum SK: Interleukin-7: A cofactor for V(D)J rearrangement of the T cell receptor beta  gene. Science 261:93, 1993[Abstract/Free Full Text]

25. Lee M-G, Sharrow SO, Farr AG, Singer A, Udey MC: Expression of the homotypic adhesion molecule E-cadherin by immature murine thymocytes and thymic epithelial cells. J Immunol 152:5653, 1994[Abstract]

26. Munro SB, Duclos AJ, Jackson AR, Baines MG, Blaschuk OW: Characterization of cadherins expressed by murine thymocytes. Cell Immunol 169:309, 1996[Medline] [Order article via Infotrieve]

27. Muller KM, Luedecker CJ, Udey MC, Farr AG: Involvement of E-cadherin in thymus organogenesis and thymocyte maturation. Immunity 6:257, 1997[Medline] [Order article via Infotrieve]

28. Goomer RS, Holst BD, Wood IC, Jones FS, Edelman GM: Regulation in vitro of an L-CAM enhancer by homeobox genes HOXD9 and HNF-1. Proc Natl Acad Sci USA 91:7985, 1994[Abstract/Free Full Text]

29. Gratiot-Deans J, Ding L, Turka LA, Nunez G: bcl-2 proto-oncogene expression during human T cell development: Evidence for biphasic regulation. J Immunol 151:83, 1993[Abstract]

30. Veis DJ, Sentman C, Bach EA, Korsmeyer SJ: Expression of the bcl-2 protein in murine and human thymocytes and in peripheral T lymphocytes. J Immunol 151:2546, 1993[Abstract]

31. DiSanto JP, Muller W, Guy-Grand D, Fischer A, Rajewsky K: Lymphoid development in mice with a targeted deletion of the interleukin 2 receptor gamma  chain. Proc Natl Acad Sci USA 92:377, 1995[Abstract/Free Full Text]

32. Ohbo K, Suda T, Hashiyama M, Mantani A, Ikebe M, Miyakawa K, Moriyama M, Nakamura M, Katsuki M, Takahashi K, Yamamura K, Sugamura K: Modulation of hematopoiesis in mice with a truncated mutant of the interleukin-2 receptor gamma  chain. Blood 87:956, 1996[Abstract/Free Full Text]

33. Willerford DM, Chen J, Ferry JA, Davidson L, Ma A, Alt FW: Interleukin-2 receptor alpha  chain regulates the size and content of the peripheral lymphoid compartment. Immunity 3:521, 1995[Medline] [Order article via Infotrieve]

34. Suda T, Zlotnik A: IL-7 maintains the T cell precursor potential of CD3-CD4-CD8- thymocytes. J Immunol 146:3068, 1991[Abstract]

35. Akashi K, Kondo M, von Freeden-Jeffry U, Murray R, Weissman IL: Bcl-2 rescues T lymphopoiesis in interleukin-7 receptor-deficient mice. Cell 89:1033, 1997[Medline] [Order article via Infotrieve]

36. Maraskovsky E, O'Reilly LA, Teepe M, Corcoran LM, Peschon JJ, Strasser A: Bcl-2 can rescue T lymphocyte development in interleukin-7 receptor-deficient mice but not in mutant rag-1-/- mice. Cell 89:1011, 1997[Medline] [Order article via Infotrieve]

37. Moore N, Anderson G, Smith CA, Owen JJ, Jenkinson EJ: Analysis of cytokine gene expression in subpopulations of freshly isolated thymocytes and thymic stromal cells using semiquantitative polymerase chain reaction. Eur J Immunol 23:922, 1993[Medline] [Order article via Infotrieve]

38. {R}39. Jones FS, Chalepakis G, Gruss P, Edelman GM: Activation of the cytotactin promoter by the homeobox-containing gene Evx-1. Proc Natl Acad Sci USA 89:2091, 1992 van Ewijk W: Cell surface topography of thymic microenvironments. Lab Invest 59:579, 1988[Medline] [Order article via Infotrieve]

40. Jones FS, Prediger EA, Bittner DA, De Robertis EM, Edelman GM: Cell adhesion molecules as targets for Hox genes: Neural cell adhesion molecule promoter activity is modulated by cotransfection with Hox-2.5 and -2.4. Proc Natl Acad Sci USA 89:2086, 1992[Abstract/Free Full Text]

41. Tomotsune D, Shoji H, Wakamatsu Y, Kondoh H, Takahashi N: A mouse homologue of the Drosophila tumour-suppressor gene I(2)gI controlled by Hox-C8 in vivo. Nature 365:69, 1993[Medline] [Order article via Infotrieve]

42. Inoue T, Chisaka O, Matsunami H, Takeichi M: Cadherin-6 expression transiently delineates specific rhombomeres, other neural tube subdivisions, and neural crest subpopulations in mouse embryos. Dev Biol 183:183, 1997[Medline] [Order article via Infotrieve]

43. Kawabe T, Muslin AJ, Korsmeyer SJ: HOX11 interacts with protein phosphatases PP2A and PP1 and disrupts a G2/M cell-cycle checkpoint. Nature 385:454, 1997[Medline] [Order article via Infotrieve]

44. Dedera DA, Waller EK, LeBrun DP, Sen-Majumdar A, Stevens ME, Barsh GS, Cleary ML: Chimeric homeobox gene E2A-PBX1 induces proliferation, apoptosis and malignant lymphomas in transgenic mice. Cell 74:833, 1993[Medline] [Order article via Infotrieve]

45. Bernasconi M, Remppis A, Fredericks WJ, Rauscher FJ III, Schafer BW: Induction of apoptosis in rhabdomyosarcoma cells through down-regulation of PAX proteins. Proc Natl Acad Sci USA 93:13164, 1996[Abstract/Free Full Text]

46. Borrow J, Shearman AM, Stanton VPJ, Becher R, Collins T, Williams AJ, Dube I, Katz F, Kwong YL, Morris C, Ohyashiki K, Toyama K, Rowley J, Housman DE: The t(7;11)(p15;p15) translocation in acute myeloid leukemia fuses the genes for nucleoporin NUP98 and class I homeoprotein HOXA9. Nat Genet 12:159, 1996[Medline] [Order article via Infotrieve]


© 1998 by the American Society of Hematology.
 
0006-4971/98/92-0052$3.00/0

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
BloodHome page
J. Faber, A. V. Krivtsov, M. C. Stubbs, R. Wright, T. N. Davis, M. van den Heuvel-Eibrink, C. M. Zwaan, A. L. Kung, and S. A. Armstrong
HOXA9 is required for survival in human MLL-rearranged acute leukemias
Blood, March 12, 2009; 113(11): 2375 - 2385.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
A. D. Schimmer, S. O'Brien, H. Kantarjian, J. Brandwein, B. D. Cheson, M. D. Minden, K. Yee, F. Ravandi, F. Giles, A. Schuh, et al.
A Phase I Study of the Pan Bcl-2 Family Inhibitor Obatoclax Mesylate in Patients with Advanced Hematologic Malignancies
Clin. Cancer Res., December 15, 2008; 14(24): 8295 - 8301.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
W.-F. Shen, Y.-L. Hu, L. Uttarwar, E. Passegue, and C. Largman
MicroRNA-126 Regulates HOXA9 by Binding to the Homeobox
Mol. Cell. Biol., July 15, 2008; 28(14): 4609 - 4619.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. R. Gothert, R. L. Brake, M. Smeets, U. Duhrsen, C. G. Begley, and D. J. Izon
NOTCH1 pathway activation is an early hallmark of SCL T leukemogenesis
Blood, November 15, 2007; 110(10): 3753 - 3762.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
Y.-L. Hu, E. Passegue, S. Fong, C. Largman, and H. J. Lawrence
Evidence that the Pim1 kinase gene is a direct target of HOXA9
Blood, June 1, 2007; 109(11): 4732 - 4738.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
N. Miyake, A. C.M. Brun, M. Magnusson, K. Miyake, D. T. Scadden, and S. Karlsson
HOXB4-Induced Self-Renewal of Hematopoietic Stem Cells Is Significantly Enhanced by p21 Deficiency
Stem Cells, March 1, 2006; 24(3): 653 - 661.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
H. J. Lawrence, J. Christensen, S. Fong, Y.-L. Hu, I. Weissman, G. Sauvageau, R. K. Humphries, and C. Largman
Loss of expression of the Hoxa-9 homeobox gene impairs the proliferation and repopulating ability of hematopoietic stem cells
Blood, December 1, 2005; 106(12): 3988 - 3994.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. Soulier, E. Clappier, J.-M. Cayuela, A. Regnault, M. Garcia-Peydro, H. Dombret, A. Baruchel, M.-L. Toribio, and F. Sigaux
HOXA genes are included in genetic and biologic networks defining human acute T-cell leukemia (T-ALL)
Blood, July 1, 2005; 106(1): 274 - 286.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
L. Rossig, C. Urbich, T. Bruhl, E. Dernbach, C. Heeschen, E. Chavakis, K.-i. Sasaki, D. Aicher, F. Diehl, F. Seeger, et al.
Histone deacetylase activity is essential for the expression of HoxA9 and for endothelial commitment of progenitor cells
J. Exp. Med., June 6, 2005; 201(11): 1825 - 1835.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
C. M. Ferrell, S. T. Dorsam, H. Ohta, R. K. Humphries, M. K. Derynck, C. Haqq, C. Largman, and H. J. Lawrence
Activation of Stem-Cell Specific Genes by HOXA9 and HOXA10 Homeodomain Proteins in CD34+ Human Cord Blood Cells
Stem Cells, May 1, 2005; 23(5): 644 - 655.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
M. S. Lee, K. Hanspers, C. S. Barker, A. P. Korn, and J. M. McCune
Gene expression profiles during human CD4+ T cell differentiation
Int. Immunol., August 1, 2004; 16(8): 1109 - 1124.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
C. W. So, H. Karsunky, P. Wong, I. L. Weissman, and M. L. Cleary
Leukemic transformation of hematopoietic progenitors by MLL-GAS7 in the absence of Hoxa7 or Hoxa9
Blood, April 15, 2004; 103(8): 3192 - 3199.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
T. Bruhl, C. Urbich, D. Aicher, A. Acker-Palmer, A. M. Zeiher, and S. Dimmeler
Homeobox A9 Transcriptionally Regulates the EphB4 Receptor to Modulate Endothelial Cell Migration and Tube Formation
Circ. Res., April 2, 2004; 94(6): 743 - 751.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. M. Bjornsson, N. Larsson, A. C. M. Brun, M. Magnusson, E. Andersson, P. Lundstrom, J. Larsson, E. Repetowska, M. Ehinger, R. K. Humphries, et al.
Reduced Proliferative Capacity of Hematopoietic Stem Cells Deficient in Hoxb3 and Hoxb4
Mol. Cell. Biol., June 1, 2003; 23(11): 3872 - 3883.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
B. M. Owens and R. G. Hawley
HOX and Non-HOX Homeobox Genes in Leukemic Hematopoiesis
Stem Cells, September 1, 2002; 20(5): 364 - 379.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
U. Thorsteinsdottir, A. Mamo, E. Kroon, L. Jerome, J. Bijl, H. J. Lawrence, K. Humphries, and G. Sauvageau
Overexpression of the myeloid leukemia-associated Hoxa9 gene in bone marrow cells induces stem cell expansion
Blood, January 1, 2002; 99(1): 121 - 129.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
F. M. Raaphorst, A. P. Otte, F. J. van Kemenade, T. Blokzijl, E. Fieret, K. M. Hamer, D. P. E. Satijn, and C. J. L. M. Meijer
Distinct BMI-1 and EZH2 Expression Patterns in Thymocytes and Mature T Cells Suggest a Role for Polycomb Genes in Human T Cell Differentiation
J. Immunol., May 15, 2001; 166(10): 5925 - 5934.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
P. Ernst, J. Wang, M. Huang, R. H. Goodman, and S. J. Korsmeyer
MLL and CREB Bind Cooperatively to the Nuclear Coactivator CREB-Binding Protein
Mol. Cell. Biol., April 1, 2001; 21(7): 2249 - 2258.
[Abstract] [Full Text]


Home page
Mol. Cell. Biol.Home page
K. R. Calvo, D. B. Sykes, M. Pasillas, and M. P. Kamps
Hoxa9 Immortalizes a Granulocyte-Macrophage Colony-Stimulating Factor-Dependent Promyelocyte Capable of Biphenotypic Differentiation to Neutrophils or Macrophages, Independent of Enforced Meis Expression
Mol. Cell. Biol., May 1, 2000; 20(9): 3274 - 3285.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Izon, D. J.
Right arrow Articles by Lawrence, H. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Izon, D. J.
Right arrow Articles by Lawrence, H. J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 1998 by American Society of Hematology         Online ISSN: 1528-0020