|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 92 No. 2 (July 15), 1998:
pp. 383-393
Loss of Function of the Homeobox Gene Hoxa-9 Perturbs Early
T-Cell Development and Induces Apoptosis in Primitive Thymocytes
By
David J. Izon,
Sofia Rozenfeld,
Stephen T. Fong,
László Kömüves,
Corey Largman, and
H. Jeffrey Lawrence
From the Division of Hematology/Medical Oncology, Department of
Medicine, and the Department of Dermatology, Veterans Affairs Medical
Center, University of California, San Francisco, CA.
 |
ABSTRACT |
Hox homeobox genes play a crucial role in specifying the
embryonic body pattern. However, a role for Hox genes in T-cell
development has not been explored. The Hoxa-9 gene is expressed
in normal adult and fetal thymuses. Fetal thymuses of mice homozygous
for an interruption of the Hoxa-9 gene are one eighth normal
size and have a 25-fold decrease in the number of primitive thymocytes expressing the interleukin-2 receptor (IL-2R, CD25). Progression to the
double positive (CD4+CD8+) stage is
dramatically retarded in fetal thymic organ cultures. This aberrant
development is associated with decreased amounts of intracellular CD3
and T-cell receptor (TCR ) and reduced surface
expression of IL-7R and E-cadherin. Mutant thymocytes show a
significant increase in apoptotic cell death and premature downregulation of bcl-2 expression. A similar phenotype is seen in
primitive thymocytes from adult Hoxa-9 / mice
and from mice transplanted with Hoxa-9 /
marrow. Hoxa-9 appears to play a previously unsuspected role in
T-cell ontogeny by modulating cell survival of early thymocytes and by
regulating their subsequent differentiation.
 |
INTRODUCTION |
THE Hox HOMEOBOX genes play major
roles in pattern formation and tissue identity during
embryogenesis,1,2 and mutations in Hox genes can
produce dramatic morphologic abnormalities involving many body
structures.3,4 Recent data have implicated Hox genes in hematopoietic development.5 Hox genes are
expressed in stage- and lineage-specific patterns in primitive
CD34+ blood cells, in lymphoid cell lines, in developing
lymphocytes, and in activated mature T cells.6-9
Furthermore, enforced overexpression of Hox genes in bone
marrow cells is associated with a variety of hematologic defects
affecting myeloid and lymphoid differentiation.10-13 Recently, we reported defects in myeloid and B-lymphoid hematopoiesis in mice with a targeted disruption of the Hoxa-9
gene.14 Because these animals also displayed reductions
in thymic size, we evaluated them for possible defects in T-cell
development.
Early thymic development is characterized by a complex series of
ordered events (Figs 1C and 3A), including T-cell receptor (TCR)
rearrangements and expression of many cell surface molecules, including
CD3, CD4, CD8, CD44, and CD25, the chain of the interleukin-2 receptor (IL-2R; reviewed in Nikolic-Zugic15). Well-defined control points in the T-cell developmental pathway insure that cells
that do not complete key steps in the program are eliminated. A major
control point involves an early proliferative stage that initiates
differentiation of triple-negative (TN) thymocytes, a step requiring
signaling through the IL-7 receptor (IL-7R).16 IL-7R
signaling, which is mediated at least in part by bcl-2, permits
rearrangement of the TCR gene17 and then assembly of the
pre-TCR complex, which includes TCR and CD3.18 We
demonstrate here that loss of Hoxa-9 function results in
maturational defects at this early TN stage of T-cell development and
increased death of fetal thymocytes.
 |
MATERIALS AND METHODS |
Mice.
Mice bearing a targeted disruption of Hoxa-9 were furnished by
Dr Cynthia Peterson and Dr Mario Capecchi (University of Utah, Salt
Lake City, UT). The details of engineering embryonic stem cells with a Hoxa-9 allele disrupted by a NeoR cassette have
been described previously.14 Both
Hoxa-9+/ and
Hoxa-9 / mice appear externally normal and
are fertile. For most experiments, timed pregnancies between
heterozygotes were performed to generate homozygotes with heterozygous
and wild-type littermates as controls. Because, in all the assays
performed, heterozygous animals were indistinguishable from wild-type
mice, for some experiments Hoxa-9 /
mice were mated with heterozygotes to generate litters of homozygotes and heterozygotes as controls. Progeny of various intercrosses were
genotyped by polymerase chain reaction (PCR) using DNA isolated from
tail or toe clips of weanlings and a 3-primer system to distinguish wild-type from mutant Hoxa-9 alleles. The two
Hoxa-9-specific primers were CGCTGGAACTGGAGAAGGAGTTTCTG and
ATCCTGCGGTTCTGGAACC AGATC; the Neo-specific primer was
TCTATCGCCTTCTTGACGAGTTC.
Fluorescence-activated cell sorting (FACS) analysis.
For FACS analysis, cell suspensions from mouse thymuses were washed in
phosphate-buffered saline (PBS) with 1% fetal calf serum (FCS) and
0.01% NaN3 (FACS buffer). Fc receptors were blocked, when
possible, by preincubation with neat mouse serum or hybridoma supernatant from 2.4G2 (anti-FcR clone). Cells were then stained with
appropriately diluted fluorochrome-conjugated antibodies. Cells were
analyzed on a Becton Dickinson FACScan using Cellquest software (Becton
Dickinson, San Jose, CA). Depending on whether the source of thymic
tissue was fetal or adult, 5 × 103 to 1 × 105 cells were routinely analyzed. Dead cells were excluded
using forward and side scatter gating or propidium iodide staining
where possible.
Antibodies.
Antibodies used for surface staining included anti- TCR
(H57)-phycoerythrin (PE), anti-CD4-fluorescein isothiocyanate (FITC), anti-CD8 -TriColor, anti-CD25-PE (Caltag, South San Francisco, CA),
anti-CD44-FITC (Pharmingen, San Diego, CA), and monoclonal antibody
ECCD-2 against E-cadherin (Zymed, South San Francisco, CA). Monoclonal
antibody A7R34, directed against the murine IL-7R, was furnished by Dr
T. Sudo (Toray Industries, Kamakura, Japan).19 Negative
controls used were Streptavidin-FITC, Streptavidin-TriColor (Caltag),
and Streptavidin-PE (Pharmingen). For the detection of intracytoplasmic
proteins, thymocytes were first permeabilized with 0.03% saponin and
then stained with specific antibody. Antibodies used for intracellular
staining included anti-TCR , anti-CD3 (Caltag), hamster anti-bcl-2
(3F11; Pharmingen), and antihamster-PE (Caltag).
Reverse transcription-PCR (RT-PCR) analysis of Hoxa-9
expression in fetal mouse tissues.
RT-PCR analysis was performed following standard procedures, using an
oligo (dT) primer at 42°C for 2 hours in a 20 µL reaction containing 10 U of SuperScript II reverse transcriptase (RT; GIBCO BRL,
Grand Island, NY), manufacturer's RT buffer, 10 U RNasin (Promega, Madison, WI), 10 mmol/L dithiothreitol (DTT), and each dNTP
at 1 mmol/L. Control reactions were performed without RT. Equal
aliquots of RT reaction mixtures, normalized by independent PCR for
-actin, were amplified using primers derived from sequences 3
to the homeodomain: 5 CGCGGATCCGGACCGAGCAAAAGACG AGTG 3
and 5 CCGGAATTCTAGCTTCCACAATCAC 3 . Hoxa-9 and
-actin PCR were shown to be in the linear range. PCR products were
analyzed by Southern blotting with a known Hoxa-9 probe.
Fetal thymic organ cultures.
Day-15.5 fetal thymuses were cultured in Dulbecco's modified Eagle's
medium with 10% FCS and 2 mmol/L glutamine, according to methods of
Robinson et al,20 with the exception that the filter was
floated on the media instead of resting on a gelfoam sponge. Thymocytes
were harvested after 6 or 10 days in culture by gently squeezing lobes
under a coverslip and then stained and analyzed for FACS.
Assays for apoptosis.
To measure the percentage of hypodiploid cells, nuclei were isolated
from freshly harvested day-15.5 fetal thymuses, incubated overnight
with a hypotonic solution of propidium iodide, and analyzed on the
FACScan at the low flow setting as previously described.21 The average percentage of hypodiploid nuclei (those located left of the
2n DNA) from normal fetal thymuses was approximately 5%. To assay
thymocytes for membrane changes consistent with apoptosis, annexin V
staining was performed on fetal thymuses. Thymuses were first
enzymatically digested into a single-cell suspension by incubating in
100 µL of 1 mg/mL type 1 collagenase in PBS for 30 minutes at
37°C. Cells were stained first with CD45-biotin (Pharmingen)
followed by streptavidin-PE (Pharmingen) to select lymphoid cells from
contaminating stromal cells. The suspension was then stained with
annexin V according to published methods and analyzed by
FACS.22
 |
RESULTS |
Reduced cellularity and TN thymocytes in adult and fetal
Hoxa-9 / thymuses.
The thymuses of adult Hoxa-9 / mice
are 60% less cellular than the glands of wild-type littermates (mean
cell number, 50.3 ± 14 × 106 for
Hoxa-9 / animals [n = 8]
v 120 ± 24 × 106 for wild-type mice [n = 7]; two-tailed P < .05). Adult
Hoxa-9 / thymuses have normal ratios
of DP and mature single-positive (SP) cells as defined by CD4 and CD8
expression (Fig 1A). However, using an
anti-TCR antibody, a significant contraction in the TN subpopulation
was evident (Fig 1A and B), with a twofold reduction in the percentage
of TN cells. When absolute cell numbers are compared (Fig 1B), there is
a 3.6-fold reduction in TN cells in mutant thymuses compared with
wild-type littermates (0.67 ± 0.13 × 106 cells
v 2.41 ± 0.48 × 106; P < .01).

View larger version (34K):
[in this window]
[in a new window]
| Fig 1.
Defects in Hoxa-9 / adult
thymuses. (A) Hoxa-9 / thymuses have reduced
percentages of TN cells. FACS analysis using antibodies against CD4,
CD8, and  TCR were performed. Hoxa-9 /
thymuses showed a twofold reduction in the percentage of
CD4 CD8 cells (lower left quadrant, middle
panels) and significant contraction of TN cells (lower left side
panels), with no changes in the percentages of mature
populations. The numbers in the CD4 CD8
panel represent the TN cells expressed as a percentage of total thymocytes. (B) Absolute numbers of T-cell subsets. Based on analyses of 5 litters, there were statistically significant decreases in cell
numbers of TN, DN, DP, and SP populations of the
Hoxa-9 / thymuses (*P < .05;
**P < .01). (C) Schematic representation of normal T-cell
development, correlated with FACScan profiles. Note that the
CD4 CD8+ subset (lower right quadrant)
includes both mature and immature (ISP) cells, which can be
distinguished by their expression or lack of expression of TCR (A,
lower right side panels).
|
|
The thymic defect was much more severe in day-15.5 fetal
Hoxa-9 / mice, whose thymuses had only
one eighth the cellularity of those of normal littermates (0.18 ± 0.03 × 105 [n = 8] v 1.4 × 105 ± 0.02 [n = 7]; P < .001).
Histologically, the mutant glands appeared much smaller and less
cellular (Fig 2A). It should be noted that at this early stage in development the thymus is composed largely of TN thymocytes.

View larger version (47K):
[in this window]
[in a new window]
| Fig 2.
Hoxa-9 in day-15.5 fetal thymuses. (A)
Microphotographs of sections of mutant (top) and normal (bottom)
day-15.5 fetal thymuses stained with methylene blue (original
magnification × 150). Sections were taken through the midportion of
each gland. (B) Hoxa-9 gene expression in normal fetal thymus.
RT-PCR using primers specific for Hoxa-9 was performed on
day-15.5 fetal tissues and the amplified cDNAs probed for Hoxa-9
by Southern blot analysis. Lanes 1 through 5 with RT; lane 1, thymus; lane 2, liver; lane 3, brain; lane 4, heart; lane 5, whole
embryo; lane 6, markers (M); lanes 7 through 11, same tissues with no
RT; lane 12, control (C) with no DNA. Strong signal is seen in lanes 1 and 2, representing fetal thymus and liver, respectively. (Upper panel)
Ethidium bromide staining. (Middle panel) Southern blotting for
Hoxa-9. (Lower panel) Actin control.
|
|
Expression of Hoxa-9 in murine fetal thymus.
Hoxa-9 expression in normal adult thymuses had been previously
demonstrated.14 To determine if this gene was active during fetal thymic development, normal day-15.5 fetal tissues were subjected to RT-PCR analysis. Hoxa-9 mRNA is clearly expressed in thymus and liver, weakly detectable in heart, and virtually absent in brain
(Fig 2B).
Reduced expression of CD25 (IL-2R chain) in
Hoxa-9 / thymuses.
T-cell precursors entering the thymus from the fetal liver express high
levels of the surface molecule CD44. These primitive TN T cells then
proceed through an orderly developmental sequence (Fig 3A) that includes transient expression
of the chain of IL-2R (CD25), during which time active
rearrangement of the TCR chain occurs, followed by downregulation of
CD44.23 To map the defect in the TN population of
Hoxa-9 mice more precisely, day-15.5 fetal thymocytes were
analyzed using antibodies against CD44 and CD25. Figure 3B demonstrates
a fourfold to fivefold contraction in the percentage of
CD25+ cells in the
Hoxa-9 / fetal thymus. When expressed
in terms of absolute numbers, the CD25+ cells are reduced
by approximately 25-fold (Fig 3C). It was interesting to note that the
majority of mutant thymocytes appears to be
CD25 CD44 cells (Fig 3B and C). In
a normal thymus, CD25 CD44
thymocytes have completed TCR rearrangement; however, as shown below, this is not the case in the mutant fetal thymocytes. The possibility was considered that some of these cells in the
Hoxa-9 / fetal thymus could represent
other cell types that are also
CD25 CD44 ; however, FACS analysis
showed no increase in myeloid, NK, or  T cells (data not
shown).

View larger version (35K):
[in this window]
[in a new window]
| Fig 3.
Defective expression of CD25 in developing
Hoxa-9 / T cells. (A) Schematic representation
of normal differentiation stages within the TN population of T cells,
correlated with FACS scan profiles. The curved arrow points to the
stage at which TCR rearrangement is largely completed. (B) FACS
analyses of day-15.5 fetal thymocytes was performed using antibodies
against CD25 and CD44. A fourfold to fivefold reduction in the
percentages of CD25+ cells (both CD44+ and
CD44 ) was seen in the mutant thymuses. (C) Absolute
number of thymocyte subsets in fetal thymuses. Based on FACS analysis
of 3 separate litters (representing 9 mutant and 12 control animals),
there is an absolute decrease in all four major subsets of T cells in Hoxa-9 / thymuses, with a 25.9-fold decrease
in the CD25+ compartments. (D) A representative FACS
analysis of adult CD4 CD8 thymocytes. The
percentage of CD25+ cells is decreased in the mutant thymus
(right panel). Similar results were seen with 2 additional
Hoxa-9 / thymuses.
|
|
To determine whether this defect in CD25 expression persisted into
later life, adult CD4 CD8
thymocytes were also analyzed for expression of CD44 and CD25. The
Hoxa-9 / thymuses demonstrated a
similar marked decrease in CD25 expression as that in the fetus (Fig
3D), but with no reduction in CD44 expression. Furthermore, lethally
irradiated mice reconstituted with
Hoxa-9 / marrow also displayed CD25
downregulation in their CD4 CD8 T
cells compared with controls (data not shown). This finding indicated
that the defect was transplantable and therefore intrinsic to the
hematopoietic cell.
The reduced expression of CD25 in primitive
Hoxa-9 / thymocytes did not represent
a global inability to upregulate CD25, because, when activated by
concanavalin A for 3 days, mature Thy-1+ T cells from adult
Hoxa-9 / spleens express CD25 equally
well as wild-type controls (data not shown). Additionally, the common
chain of the IL-2R was expressed at normal levels in
Hoxa-9 / fetal thymocytes (data not
shown), indicating that other components of the IL-2 signaling pathway
were not perturbed.
Retarded progression of Hoxa-9 /
thymocytes to DP T cells in fetal thymic organ cultures (FTOC).
To examine the ability of TN cells in
Hoxa-9 / mice to differentiate to DP
cells, FTOC were performed. Individual day-15.5 fetal thymuses from
Hoxa-9+/+ and Hoxa-9 /
mice were cultured for 6 days, and T-cell development was monitored by
FACS analysis. There was a threefold decrease in total numbers of cells
recovered from day-15.5 Hoxa-9 / FTOCs
compared with controls (1.99 ± 0.62 × 105 [n = 7] v 6.31 ± 0.95 × 105 [n = 7]; P < .005). In addition, there was a marked
retardation in the progression of TN to DP, with a 10-fold increase
(38.7% v 3.7%) in the percentage of CD8+ ISP
cells and a twofold increase in the percentage of TN cells in
Hoxa-9 / FTOCs
(Fig 4A and B).

View larger version (32K):
[in this window]
[in a new window]
| Fig 4.
Abnormal development of Hoxa-9 /
thymocytes in 6-day FTOCs. (A) FACS analysis of thymocytes harvested
from 6-day FTOCs using antibodies against CD4, CD8, and  TCR.
There is a marked decrease in the number of DP cells (upper right
quadrant of middle panels) in the mutant thymuses, associated with a
10-fold increase in the percentage of CD8+ cells (lower
right quadrant). These latter cells are ISPs, ie, TCR CD8+, as shown in the lower right side
panels, where the numbers represent ISP cells as a percentage of total
thymocytes. (B) Absolute numbers of T-cell subsets in 6-day FTOCs.
Based on analyses from 4 separate FTOC experiments (representing 7 mutant and 8 wild-type thymuses), there is a delay in progression of
Hoxa-9 / thymocytes through the ISP stage and
significant reductions in the numbers of more mature DP and SP cells.
|
|
The marked relative increase in ISP cells in the day-6
Hoxa-9 / FTOCs could simply reflect
selective loss of CD4+ CD8+ cells. To address
this possibility, FTOCs were performed for a longer time period (10 days) to examine progression to DP and mature SP thymocytes.
Surprisingly, the Hoxa-9 / thymuses
exhibited significantly increased percentages of mature SP
CD4+ and CD8+ cells when compared with
wild-type thymuses, indicating that there was no selective loss of DP
cells but rather a compensatory enhancement of DP to SP conversion in
the mutant thymocytes (Fig 5A). In
addition, there was an fivefold increase in the percentage of
 TCRhi DP cells (representing cells undergoing active
selection) in the Hoxa-9 / FTOCs (Fig
5A, upper right panels). This phenomenon is also apparent in the
analysis of total cell numbers from the different thymocytes subsets
(Fig 5B). It should be noted that, after 10 days in culture, the mutant
thymuses now had only a twofold decrease in cellularity compared with
wild-type controls.

View larger version (31K):
[in this window]
[in a new window]
| Fig 5.
Accelerated progression of
Hoxa-9 / thymocytes to SP cells in 10-day
FTOCs. (A) FACS analysis of thymocytes harvested from 10-day FTOCs
using antibodies against CD4, CD8, and  TCR. Most of the Hoxa-9 / cells have progressed through the DP
stage to become mature SP cells. (B) Absolute numbers of T-cell subsets
in 10-day FTOCs. Based on analyses from 3 separate FTOC experiments
(representing 4 mutant and 6 wild-type thymuses), the numbers of SP
mature cells in the mutant and normal FTOCs are not significantly
different, but the number of Hoxa-9 / DP is
markedly reduced.
|
|
Multiple defects in the TN check point of T-cell development in
Hoxa-9 / thymuses.
Because mutant mice displayed a major defect in early T-cell
development, we analyzed the expression of proteins specifically required for the progression of TN cells to DP T cells. Because this
step requires signaling through the pre-TCR/CD3 complex, day-15.5 and
-16.5 fetal thymuses were analyzed for intracellular CD3
(Fig 6A) and TCR (Fig 6B) expression,
respectively. Both were found to be markedly reduced in
Hoxa-9 / thymocytes, indicating
defective or retarded TCR rearrangement and assembly of
a pre-TCR complex. Interestingly, the reduction of the levels of
intracellular TCR was not associated with any measurable reduction
in mRNA levels of RAG-1 and RAG-2 as assayed by semiquantitative RT-PCR
(J. Taubenberger, personal communication, October 1997). Because
previous studies had demonstrated a key role of IL-7R signaling for
TCR gene rearrangement,24 IL-7R expression was also
analyzed and found to be markedly downregulated compared with
heterozygous controls (Fig 6C).

View larger version (35K):
[in this window]
[in a new window]
| Fig 6.
Multiple defects in the TN check point of T-cell
development in Hoxa-9 / thymuses. Day-15.5 or
day-16.5 fetal thymocytes were subjected to FACS analysis using the
specific antibodies indicated in each panel. (A) Intracellular CD3
expression. The percentage of mutant thymocytes expressing
intracellular CD3 is markedly reduced. (B) Intracellular TCR
expression. Approximately one fourth of the normal fetal thymocytes
have successfully rearranged their TCR chain by day 16.5, whereas
the extent of TCR rearrangement in the
Hoxa-9 / T cells is diminished by fourfold.
(C) IL-7R expression. The percentage of IL-7R+ thymocytes
in Hoxa-9 / thymuses is significantly
decreased as is the mean fluorescence intensity. (D) E-cadherin
expression on fetal thymocytes. The fraction of
Hoxa-9 / thymocytes expressing high levels of
E-cadherin is diminished by half. All analyses were repeated with at
least 3 separate mutant and control animals.
|
|
Abnormal expression of E-cadherin in mutant TN thymocytes.
It has been previously demonstrated that the adhesion molecule
E-cadherin is expressed on fetal TN thymocytes as well as on thymic
epithelial cells25,26 and that treating dispersed fetal thymuses with anti-E-cadherin antibody profoundly disturbs T-cell development.27 Given that E-cadherin has been proposed to
be a target gene for certain Hox proteins,28 we wished to
determine if E-cadherin expression was perturbed in
Hoxa-9 / TN thymocytes. FACS analysis
using an E-cadherin antibody demonstrated that fewer than half of the
mutant thymocytes express E-cadherin, whereas approximately 90% of
control TN T cells stained brightly (Fig 6D).
Increased apoptotic cell death in fetal
Hoxa-9 / thymocytes.
Because developing T cells need signaling through the IL-7R and the
pre-TCR complex for their survival and because both of these receptors
appear to be reduced in Hoxa-9 /
thymocytes, we investigated whether there was evidence of decreased cell survival in Hoxa-9 / TN thymuses.
Increased cell death was suspected based on the increased side scatter
and reduced average size of viable fetal Hoxa-9 / thymocytes by forward scatter
on FACS analysis and by a significant increase in cells staining with
propidium iodide (data not shown). Histology of the mutant glands
also showed increased numbers of pyknotic cells and nuclei with areas
of condensed chromatin (Fig 7A).

View larger version (34K):
[in this window]
[in a new window]
| Fig 7.
Increased cell death in Hoxa-9 /
fetal thymuses. (A) Microphotographs of sections of mutant (right) and
normal (left) day-15.5 fetal thymuses stained with methylene blue
(original magnification × 560). The arrow points to a pyknotic
nucleus and the arrow heads mark areas of chromatin condensation. (B)
Day-15.5 Hoxa-9 / thymocytes show a marked
increase in hypodiploid nuclei by propidium iodide staining and FACS
analysis. The percentage of hypodiploid nuclei in mutant thymuses is
dramatically increased (lower two panels) as compared with control
adult and fetal thymuses (upper two panels). (C) Annexin V staining of
fetal thymocytes. Mutant thymuses (n = 7) show an approximate
threefold increase in the percentage of cells binding high levels of
annexin V as compared with control animals (n = 10), as well as
significant increases in the fraction binding intermediate levels. (D)
Bcl-2 protein levels in day-15.5 thymocytes. Control thymocytes (n = 12) show high levels in bcl-2 protein in nearly all cells, whereas half of the Hoxa-9 / thymocytes (n = 4) show
markedly reduced levels of bcl-2 (solid lines). Dotted lines depict
staining with hamster IgG-PE as a negative control.
|
|
To further analyze this phenomenon of increased cell death, cell
suspensions from individual day-15.5 fetal
Hoxa-9+/+ and
Hoxa-9 / thymuses were stained with a
hypotonic propidium iodide solution and analyzed by FACS to measure
ploidy. Figure 7B shows that greater than 50% of the fetal
Hoxa-9 / thymocytes are hypodiploid
and presumably apoptotic, compared with less than 10% hypodiploid
cells in control fetal thymuses. In some of the
Hoxa-9 / thymuses, the percentage of
hypodiploid cells exceeded 75%. Finally, analyzing cells for Annexin V
binding showed a marked increase in both high and intermediate levels
of binding in the mutant T cells, indicating membrane changes seen in
early apoptosis (Fig 7C).
The antiapoptotic protein bcl-2 is normally expressed at high level in
TN thymocytes and is downregulated in most T cells as they progress to
the DP stage.29,30 To ascertain whether bcl-2 expression
was altered in primitive Hoxa-9 / T
cells, thymocytes from day-15.5 fetuses were stained intracellularly with anti-bcl-2 antibody. The majority of control thymocytes express high levels of bcl-2, whereas Hoxa-9 /
thymocytes show a distinctive biphasic pattern, with approximately half the cells showing very diminished levels of the protein (Fig 7D).
 |
DISCUSSION |
In summary, Hoxa-9 / mice have a major
defect in fetal thymic development with severe reductions in immature
thymocytes and blunted expression of several surface markers, including
CD25, IL-7R, and E-cadherin, all accompanied by a marked downregulation of bcl-2 expression and an increase in cell death. These defects are
intrinsic to the Hoxa-9 /
hematopoietic cells and not the thymic stroma, because mice
transplanted with Hoxa-9 / bone marrow
display similar thymic abnormalities. The perturbations in T-cell
development associated with loss of Hoxa-9 function are
complex, because, in addition to the marked abnormalities at the TN
stage, mutant thymocytes show delayed progression through the ISP stage
and a curious acceleration from DP to mature single-positive T cells.
It is not clear whether these later abnormalities reflect a true
physiologic role for Hoxa-9 at the ISP and DP stages of T-cell
differentiation or whether they represent the consequences and/or compensations for the defects seen at the TN stage. The fact that the block in T-cell development in
Hoxa-9 / mice is not complete may
indicate that paralogous Hox genes are partially compensating
for the mutation. The T-cell defect is much more severe in fetal
thymuses than in adults, perhaps because of the stress of rapid growth
in the fetal thymus.
One interpretation of the immunophenotypic findings in
Hoxa-9 / fetal thymuses is that early
T-cell development is potentially accelerated, with an abnormally high
proportion of the mutant cells having already arrived at the
CD25 CD44 stage of TN
differentiation by day 15.5 of gestation. However, normal
CD25 CD44 TN thymocytes express
significant levels of intracellular TCR and CD3, unlike a large
majority of the Hoxa-9 / fetal
thymocytes. Thus, one explanation for the role of Hoxa-9 in
early T-cell development is that it initiates and/or
orchestrates certain molecular events that occur during the
CD25+ step of TN differentiation. In this model, the
absence of Hoxa-9 / activity results
in increased cell death in thymocytes that reach the
CD25 CD44 stage, because few of
them have assembled a surface pre-TCR complex through which to receive
the required survival signals.
The precise genetic programs that are modulated by Hoxa-9
function during T-cell development remain to be determined. The dramatic reduction in CD25+ TN cells suggests a defect in
the IL-2 signaling pathway. Mice with a null mutation of the IL-2R
chain or a dominant-negative mutant IL-2R chain show a similar
slowing of the TN to DP transition.31,32 However, the
common IL-2R chain expression is not reduced in Hoxa-9 / thymuses, and the activity of
the chain, CD25, is not required for normal T-cell
development.33 In addition, expression of CD25 in mature
Hoxa-9 / T cells can still be
activated normally by mitogens. CD44 expression is also diminished in
the mutant fetal thymocytes, but not in the thymocytes of adult
Hoxa-9 / mice. These data taken
together suggest that the lack of CD25 and CD44 expression per se in
Hoxa-9 / fetal thymuses does not
account for the observed defects in early T-cell development, but is
rather indicating a lack of thymocytes at that stage of TN
differentiation in the mutant glands.
The T-cell defects in Hoxa-9 / mice
could also be a consequence of defective IL-7/IL-7R receptor signaling.
T-cell precursors entering the thymus appear to be wholly dependent on
IL-7 for their survival and for TCR rearrangement.16,34
One expected consequence of blunted IL-7 signaling is decreased cell
survival, and in fact Hoxa-9 / fetal
thymuses show a marked increase in cell death. It is important to
recognize that the survival signal furnished via the IL-7/IL-7R pathway
appears to be largely mediated by bcl-2. Indeed, a bcl-2 transgene can
completely rescue the defect in T-cell development seen in animals with
mutant IL-7 receptors.35,36 Thus, the defective expression
of IL-7R and/or bcl-2 in
Hox-a9 / thymuses could contribute to
the observed defects in T-cell development.
Thymic epithelial cells are the predominant source of IL-7 in the
thymus,37 and scanning electron microscopy has shown the intimate connection between developing T cells and the surrounding thymic epithelium.38 It is therefore conceivable that
perturbations in the normally tight interactions between developing
thymocytes and thymic epithelium underlie the defect in
Hoxa-9 / animals. One of the adhesion
molecules that appears to mediate these tight interactions is
E-cadherin, and interfering with homotypic E-cadherin interactions
between thymic epithelium and primitive thymocytes severely perturbs
thymocyte development.27 Some data suggest that adhesion
molecules, including N-CAM and certain cadherins, are transcriptionally
regulated by Hox proteins.39-41 A Hoxa-1 mutant mouse has been shown to have reduced cadherin-6 expression in
the head folds of day-8.5 embryos.42 Evidence linking
Hox proteins to the regulation of E-cadherin comes from work by
Goomer et al,28 who demonstrated that Hoxd-9 could
bind to DNA sequences in an enhancer in the E-cadherin gene. A reporter
construct containing this enhancer element could be activated by
Hoxd-9 in transient transcription assays and overexpression of
Hoxd-9 upregulated expression of the endogenous E-cadherin
gene. These results are interesting, because Hoxd-9 has a high
degree of homology (>90% identity at the amino acid level) to
Hoxa-9, and both proteins can bind to the same DNA target
sequence (W.-F. Shen and C. Largman, unpublished
observations).
Previous studies have furnished evidence for a link between homeobox
genes and the regulation of cell proliferation. Kawabe et
al43 reported that the orphan homeobox gene HOX11 could
interact with genes involved in cell-cycle control and that
misexpression of HOX11 in frog oocytes produced G2 arrest. It is
noteworthy that we failed to demonstrate any significant alteration in
cell cycling in the Hoxa-9 /
thymocytes (D. Izon, data not shown). Alternatively, there is evidence
that homeobox genes may regulate cell survival and death. Expression of
the homeobox fusion gene E2A-PBX1 in transgenic mice severely perturbs
lymphoid development, with severe lymphopenia and high levels of
apoptosis.44 Other investigators used antisense oligonucleotides to block the expression of PAX-type homeobox genes and
observed apoptotic cell death.45
Homeobox genes are vital for cell lineage commitment decisions during
embryogenesis and later development in such diverse species as flies
and mammals. Hox genes are active in hematopoietic stem
cells6 and have been implicated in
leukemogenesis.11,46 However, until recently, there has
been little definitive evidence to suggest that they function in normal
blood cell development. The results presented here clearly demonstrate
that Hoxa-9 is required for full and efficient T-cell
maturation and that loss of Hoxa-9 function perturbs the
chronology of early T-cell differentiation. These experiments suggest a
novel and unexpected role for a Hox gene in T-cell development,
modulating the death and differentiative potential of early thymocytes.
 |
FOOTNOTES |
Submitted March 12, 1998;
accepted April 24, 1998.
Supported in part by National Institutes of Health Grants No. RO1 DK
48642 (H.J.L.) and N44 DK 3-2219 (C.L.) and grants from the Department
of Veterans Affairs (H.J.L. and C.L.). H.J.L. is a recipient of a VA
Career Development Award.
Address reprint requests to H. Jeffrey Lawrence, MD, Hematology
Research (151H), Veterans Affairs Medical Center, 4150 Clement St, San
Francisco, CA 94121; e-mail: lawrencej{at}vacom.ucsf.edu.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.
 |
ACKNOWLEDGMENT |
The authors are grateful to Drs C. Peterson and M. Capecchi for
furnishing the Hoxa-9 / mice and to Dr
T. Sudo for supplying antibody A7R34. We also thank Drs R.K. Humphries,
G. Sauvageau, and A. Kruisbeek for their critical review of the data
and Drs J. Taubenberger, S. Boehme, and J.M. McCune for many helpful
comments.
 |
REFERENCES |
1.
Lawrence PA,
Morata G:
Homeobox genes: Their function in Drosophila segmentation and pattern formation.
Cell
78:181,
1994[Medline]
[Order article via Infotrieve]
2.
Krumlauf R:
Hox genes in vertebrate development.
Cell
78:191,
1994[Medline]
[Order article via Infotrieve]
3.
Chisaka O,
Musci TS,
Capecchi MR:
Developmental defects of the ear, cranial nerves, and hindbrain resulting from targeted disruption of the mouse homeobox gene Hox 1.6.
Nature
355:516,
1992[Medline]
[Order article via Infotrieve]
4.
Ramirez-Solis R,
Zheng H,
Whiting J,
Krumlauf R,
Bradley A:
Hoxb-4 (Hox 2.6) mutant mice show homeotic transformation of a cervical vertebra and defects in the closure of the sternal rudiments.
Cell
73:279,
1993[Medline]
[Order article via Infotrieve]
5.
Lawrence HJ,
Sauvageau G,
Humphries RK,
Largman C:
The role of HOX homeobox genes in normal and leukemic hematopoiesis.
Stem Cells
14:281,
1996[Medline]
[Order article via Infotrieve]
6.
Sauvageau G,
Lansdorp PM,
Eaves CE,
Hogge DE,
Dragowska WH,
Reid DS,
Largman C,
Lawrence HJ,
Humphries RK:
Differential expression of homeobox genes in functionally distinct CD34+ subpopulations of human bone marrow cells.
Proc Natl Acad Sci USA
91:12223,
1994[Abstract/Free Full Text]
7.
Care A,
Testa U,
Bassani A,
Tritarelli E,
Montesoro E,
Samoggia P,
Cianetti L,
Peschle C:
Coordinate expression and proliferative role of HOXB genes in activated adult T lymphocytes.
Mol Cell Biol
14:4872,
1994[Abstract/Free Full Text]
8.
Giampaolo A,
Sterpetti P,
Bugacrini D,
Samoggia P,
Pelosi P,
Valtieri F,
Peschle C:
Key functional role and lineage-specific expression of selected HOXB genes in purified hematopoietic progenitor differentiation.
Blood
84:3637,
1994[Abstract/Free Full Text]
9.
Kongsuwan K,
Webb E,
Housiaux P,
Adams JM:
Expression of multiple homeobox genes within diverse mammalian haemopoietic lineages.
EMBO J
7:2131,
1988[Medline]
[Order article via Infotrieve]
10.
Sauvageau G,
Thorsteinsdottir U,
Eaves CJ,
Lawrence HJ,
Largman C,
Lansdorp PM,
Humphries RK:
Overexpression of HOXB4 in hematopoietic cells causes the selective expansion of more primitive populations in vitro and in vivo.
Genes Dev
9:1753,
1995[Abstract/Free Full Text]
11.
Thorsteinsdottir U,
Sauvageau G,
Hough MR,
Dragowska W,
Lansdorp PM,
Lawrence HJ,
Largman C,
Humphries RK:
Overexpression of HOXA10 in murine hematopoietic cells perturbs both myeloid and lymphoid differentiation and leads to acute myeloid leukemia.
Mol Cell Biol
17:495,
1997[Abstract]
12.
Sauvageau G,
Thorsteinsdottir U,
Hough MR,
Hugo P,
Lawrence HJ,
Largman C,
Humphries RK:
Overexpression of HOXB3 in hematopoietic cells causes defective lymphoid development and progressive myeloproliferation.
Immunity
6:13,
1997[Medline]
[Order article via Infotrieve]
13.
Perkins AC,
Cory S:
Conditional immortalization of mouse myelomonocytic, megakaryocytic and mast cell progenitors by the Hox-2.4 homeobox gene.
EMBO J
12:3835,
1993[Medline]
[Order article via Infotrieve]
14.
Lawrence HJ,
Helgason CD,
Sauvageau G,
Fong ST,
Izon DJ,
Humphries RK,
Largman C:
Mice bearing a targeted disruption of the homeobox gene HOXA9 have defects in myeloid, erythroid and lymphoid hematopoiesis.
Blood
89:1922,
1997[Abstract/Free Full Text]
15. Nikolic-Zugic J: Intrathymic T-Cell Development. Austin, TX,
R.G. Landes, 1994
16.
Peschon JJ,
Morrissey PJ,
Grabstein KH,
Ramsdell FJ,
Maraskovsky E,
Bliniak BC,
Park LS,
Siegler SF,
Williams DE,
Ware CB,
Meyer JD,
Davison BL:
Early lymphocyte expansion is severely impaired in interleukin 7 receptor-deficient mice.
J Exp Med
180:1955,
1994[Abstract/Free Full Text]
17.
Mombaerts P,
Clarke AR,
Rudnicki MA,
Iacomini J,
Itohara S,
Lafaille JJ,
Wang L,
Ichikawa Y,
Jaenisch R,
Hooper ML,
Tonegawa S:
Mutations in T-cell antigen receptor genes and block thymocyte development at different stages.
Nature
360:225,
1992[Medline]
[Order article via Infotrieve]
18.
Groettrup M,
Ungewiss K,
Azogui O,
Palacios R,
Owne MJ,
Hayday AC,
von Boehmer H:
A novel disulfide-linked heterodimer on pre-T cells consists of the T cell receptor chain and a 33 kd glycoprotein.
Cell
75:283,
1993[Medline]
[Order article via Infotrieve]
19.
Sudo T,
Nishikawa S,
Ohno N,
Akiyama N,
Tamakoshi M,
Yoshida H,
Nishikawa S-I:
Expression and function of the interleukin 7 receptor in murine lymphocytes.
Proc Natl Acad Sci USA
90:9125,
1993[Abstract/Free Full Text]
20.
Robinson JH,
Owen JJT:
Generation of T cell function in organ culture of foetal mouse thymus. II. Mixed lymphocyte culture reactivity.
Clin Exp Immunol
27:322,
1977[Medline]
[Order article via Infotrieve]
21.
Nicoletti I,
Miglorati G,
Pagliacci MC,
Gignani F,
Riccardi C:
A rapid and simple method for measuring thymocyte apoptosis by propidium iodide staining and flow cytometry.
J Immunol Methods
139:271,
1991[Medline]
[Order article via Infotrieve]
22.
Vermes I,
Haanen C,
Steffens-Nakken H,
Reutlingsperger CPM:
A novel assay for apoptosis: Flow cytometric detection of phosphatidylserine expression on early apoptotic cells using fluorescein labeled Annexin V.
J Immunol Methods
184:39,
1995[Medline]
[Order article via Infotrieve]
23.
Godfrey DI,
Kennedy J,
Suda T,
Zlotnik A:
A developmental pathway involving four phenotypically and functionally distinct subsets of CD3 CD4 CD8 triple-negative adult mouse thymocytes defined by CD44 and CD25 expresssion.
J Immunol
150:4244,
1993[Abstract]
24.
Muegge K,
Vila MP,
Durum SK:
Interleukin-7: A cofactor for V(D)J rearrangement of the T cell receptor gene.
Science
261:93,
1993[Abstract/Free Full Text]
25.
Lee M-G,
Sharrow SO,
Farr AG,
Singer A,
Udey MC:
Expression of the homotypic adhesion molecule E-cadherin by immature murine thymocytes and thymic epithelial cells.
J Immunol
152:5653,
1994[Abstract]
26.
Munro SB,
Duclos AJ,
Jackson AR,
Baines MG,
Blaschuk OW:
Characterization of cadherins expressed by murine thymocytes.
Cell Immunol
169:309,
1996[Medline]
[Order article via Infotrieve]
27.
Muller KM,
Luedecker CJ,
Udey MC,
Farr AG:
Involvement of E-cadherin in thymus organogenesis and thymocyte maturation.
Immunity
6:257,
1997[Medline]
[Order article via Infotrieve]
28.
Goomer RS,
Holst BD,
Wood IC,
Jones FS,
Edelman GM:
Regulation in vitro of an L-CAM enhancer by homeobox genes HOXD9 and HNF-1.
Proc Natl Acad Sci USA
91:7985,
1994[Abstract/Free Full Text]
29.
Gratiot-Deans J,
Ding L,
Turka LA,
Nunez G:
bcl-2 proto-oncogene expression during human T cell development: Evidence for biphasic regulation.
J Immunol
151:83,
1993[Abstract]
30.
Veis DJ,
Sentman C,
Bach EA,
Korsmeyer SJ:
Expression of the bcl-2 protein in murine and human thymocytes and in peripheral T lymphocytes.
J Immunol
151:2546,
1993[Abstract]
31.
DiSanto JP,
Muller W,
Guy-Grand D,
Fischer A,
Rajewsky K:
Lymphoid development in mice with a targeted deletion of the interleukin 2 receptor chain.
Proc Natl Acad Sci USA
92:377,
1995[Abstract/Free Full Text]
32.
Ohbo K,
Suda T,
Hashiyama M,
Mantani A,
Ikebe M,
Miyakawa K,
Moriyama M,
Nakamura M,
Katsuki M,
Takahashi K,
Yamamura K,
Sugamura K:
Modulation of hematopoiesis in mice with a truncated mutant of the interleukin-2 receptor chain.
Blood
87:956,
1996[Abstract/Free Full Text]
33.
Willerford DM,
Chen J,
Ferry JA,
Davidson L,
Ma A,
Alt FW:
Interleukin-2 receptor chain regulates the size and content of the peripheral lymphoid compartment.
Immunity
3:521,
1995[Medline]
[Order article via Infotrieve]
34.
Suda T,
Zlotnik A:
IL-7 maintains the T cell precursor potential of CD3 CD4 CD8 thymocytes.
J Immunol
146:3068,
1991[Abstract]
35.
Akashi K,
Kondo M,
von Freeden-Jeffry U,
Murray R,
Weissman IL:
Bcl-2 rescues T lymphopoiesis in interleukin-7 receptor-deficient mice.
Cell
89:1033,
1997[Medline]
[Order article via Infotrieve]
36.
Maraskovsky E,
O'Reilly LA,
Teepe M,
Corcoran LM,
Peschon JJ,
Strasser A:
Bcl-2 can rescue T lymphocyte development in interleukin-7 receptor-deficient mice but not in mutant rag-1 / mice.
Cell
89:1011,
1997[Medline]
[Order article via Infotrieve]
37.
Moore N,
Anderson G,
Smith CA,
Owen JJ,
Jenkinson EJ:
Analysis of cytokine gene expression in subpopulations of freshly isolated thymocytes and thymic stromal cells using semiquantitative polymerase chain reaction.
Eur J Immunol
23:922,
1993[Medline]
[Order article via Infotrieve]
38. {R}39. Jones FS, Chalepakis G, Gruss P, Edelman GM: Activation of the cytotactin promoter by the homeobox-containing gene Evx-1. Proc Natl Acad Sci USA 89:2091, 1992
van Ewijk W:
Cell surface topography of thymic microenvironments.
Lab Invest
59:579,
1988[Medline]
[Order article via Infotrieve]
40.
Jones FS,
Prediger EA,
Bittner DA,
De Robertis EM,
Edelman GM:
Cell adhesion molecules as targets for Hox genes: Neural cell adhesion molecule promoter activity is modulated by cotransfection with Hox-2.5 and -2.4.
Proc Natl Acad Sci USA
89:2086,
1992[Abstract/Free Full Text]
41.
Tomotsune D,
Shoji H,
Wakamatsu Y,
Kondoh H,
Takahashi N:
A mouse homologue of the Drosophila tumour-suppressor gene I(2)gI controlled by Hox-C8 in vivo.
Nature
365:69,
1993[Medline]
[Order article via Infotrieve]
42.
Inoue T,
Chisaka O,
Matsunami H,
Takeichi M:
Cadherin-6 expression transiently delineates specific rhombomeres, other neural tube subdivisions, and neural crest subpopulations in mouse embryos.
Dev Biol
183:183,
1997[Medline]
[Order article via Infotrieve]
43.
Kawabe T,
Muslin AJ,
Korsmeyer SJ:
HOX11 interacts with protein phosphatases PP2A and PP1 and disrupts a G2/M cell-cycle checkpoint.
Nature
385:454,
1997[Medline]
[Order article via Infotrieve]
44.
Dedera DA,
Waller EK,
LeBrun DP,
Sen-Majumdar A,
Stevens ME,
Barsh GS,
Cleary ML:
Chimeric homeobox gene E2A-PBX1 induces proliferation, apoptosis and malignant lymphomas in transgenic mice.
Cell
74:833,
1993[Medline]
[Order article via Infotrieve]
45.
Bernasconi M,
Remppis A,
Fredericks WJ,
Rauscher FJ III,
Schafer BW:
Induction of apoptosis in rhabdomyosarcoma cells through down-regulation of PAX proteins.
Proc Natl Acad Sci USA
93:13164,
1996[Abstract/Free Full Text]
46.
Borrow J,
Shearman AM,
Stanton VPJ,
Becher R,
Collins T,
Williams AJ,
Dube I,
Katz F,
Kwong YL,
Morris C,
Ohyashiki K,
Toyama K,
Rowley J,
Housman DE:
The t(7;11)(p15;p15) translocation in acute myeloid leukemia fuses the genes for nucleoporin NUP98 and class I homeoprotein HOXA9.
Nat Genet
12:159,
1996[Medline]
[Order article via Infotrieve]

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
Y.-L. Hu, S. Fong, C. Ferrell, C. Largman, and W.-F. Shen
HOXA9 Modulates Its Oncogenic Partner Meis1 To Influence Normal Hematopoiesis
Mol. Cell. Biol.,
September 15, 2009;
29(18):
5181 - 5192.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Faber, A. V. Krivtsov, M. C. Stubbs, R. Wright, T. N. Davis, M. van den Heuvel-Eibrink, C. M. Zwaan, A. L. Kung, and S. A. Armstrong
HOXA9 is required for survival in human MLL-rearranged acute leukemias
Blood,
March 12, 2009;
113(11):
2375 - 2385.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. D. Schimmer, S. O'Brien, H. Kantarjian, J. Brandwein, B. D. Cheson, M. D. Minden, K. Yee, F. Ravandi, F. Giles, A. Schuh, et al.
A Phase I Study of the Pan Bcl-2 Family Inhibitor Obatoclax Mesylate in Patients with Advanced Hematologic Malignancies
Clin. Cancer Res.,
December 15, 2008;
14(24):
8295 - 8301.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W.-F. Shen, Y.-L. Hu, L. Uttarwar, E. Passegue, and C. Largman
MicroRNA-126 Regulates HOXA9 by Binding to the Homeobox
Mol. Cell. Biol.,
July 15, 2008;
28(14):
4609 - 4619.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. R. Gothert, R. L. Brake, M. Smeets, U. Duhrsen, C. G. Begley, and D. J. Izon
NOTCH1 pathway activation is an early hallmark of SCL T leukemogenesis
Blood,
November 15, 2007;
110(10):
3753 - 3762.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-L. Hu, E. Passegue, S. Fong, C. Largman, and H. J. Lawrence
Evidence that the Pim1 kinase gene is a direct target of HOXA9
Blood,
June 1, 2007;
109(11):
4732 - 4738.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. J. Lawrence, J. Christensen, S. Fong, Y.-L. Hu, I. Weissman, G. Sauvageau, R. K. Humphries, and C. Largman
Loss of expression of the Hoxa-9 homeobox gene impairs the proliferation and repopulating ability of hematopoietic stem cells
Blood,
December 1, 2005;
106(12):
3988 - 3994.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Soulier, E. Clappier, J.-M. Cayuela, A. Regnault, M. Garcia-Peydro, H. Dombret, A. Baruchel, M.-L. Toribio, and F. Sigaux
HOXA genes are included in genetic and biologic networks defining human acute T-cell leukemia (T-ALL)
Blood,
July 1, 2005;
106(1):
274 - 286.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Rossig, C. Urbich, T. Bruhl, E. Dernbach, C. Heeschen, E. Chavakis, K.-i. Sasaki, D. Aicher, F. Diehl, F. Seeger, et al.
Histone deacetylase activity is essential for the expression of HoxA9 and for endothelial commitment of progenitor cells
J. Exp. Med.,
June 6, 2005;
201(11):
1825 - 1835.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. S. Lee, K. Hanspers, C. S. Barker, A. P. Korn, and J. M. McCune
Gene expression profiles during human CD4+ T cell differentiation
Int. Immunol.,
August 1, 2004;
16(8):
1109 - 1124.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. W. So, H. Karsunky, P. Wong, I. L. Weissman, and M. L. Cleary
Leukemic transformation of hematopoietic progenitors by MLL-GAS7 in the absence of Hoxa7 or Hoxa9
Blood,
April 15, 2004;
103(8):
3192 - 3199.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Bruhl, C. Urbich, D. Aicher, A. Acker-Palmer, A. M. Zeiher, and S. Dimmeler
Homeobox A9 Transcriptionally Regulates the EphB4 Receptor to Modulate Endothelial Cell Migration and Tube Formation
Circ. Res.,
April 2, 2004;
94(6):
743 - 751.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Bjornsson, N. Larsson, A. C. M. Brun, M. Magnusson, E. Andersson, P. Lundstrom, J. Larsson, E. Repetowska, M. Ehinger, R. K. Humphries, et al.
Reduced Proliferative Capacity of Hematopoietic Stem Cells Deficient in Hoxb3 and Hoxb4
Mol. Cell. Biol.,
June 1, 2003;
23(11):
3872 - 3883.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
U. Thorsteinsdottir, A. Mamo, E. Kroon, L. Jerome, J. Bijl, H. J. Lawrence, K. Humphries, and G. Sauvageau
Overexpression of the myeloid leukemia-associated Hoxa9 gene in bone marrow cells induces stem cell expansion
Blood,
January 1, 2002;
99(1):
121 - 129.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. M. Raaphorst, A. P. Otte, F. J. van Kemenade, T. Blokzijl, E. Fieret, K. M. Hamer, D. P. E. Satijn, and C. J. L. M. Meijer
Distinct BMI-1 and EZH2 Expression Patterns in Thymocytes and Mature T Cells Suggest a Role for Polycomb Genes in Human T Cell Differentiation
J. Immunol.,
May 15, 2001;
166(10):
5925 - 5934.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Ernst, J. Wang, M. Huang, R. H. Goodman, and S. J. Korsmeyer
MLL and CREB Bind Cooperatively to the Nuclear Coactivator CREB-Binding Protein
Mol. Cell. Biol.,
April 1, 2001;
21(7):
2249 - 2258.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
K. R. Calvo, D. B. Sykes, M. Pasillas, and M. P. Kamps
Hoxa9 Immortalizes a Granulocyte-Macrophage Colony-Stimulating Factor-Dependent Promyelocyte Capable of Biphenotypic Differentiation to Neutrophils or Macrophages, Independent of Enforced Meis Expression
Mol. Cell. Biol.,
May 1, 2000;
20(9):
3274 - 3285.
[Abstract]
[Full Text]
|
 |
|
|
|