|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 92 No. 2 (July 15), 1998:
pp. 600-606
Epstein-Barr Virus in Nasal Lymphomas Contains Multiple Ongoing
Mutations in the EBNA-1 Gene
By
M.I. Gutiérrez,
G. Spangler,
D. Kingma,
M. Raffeld,
I. Guerrero,
O. Misad,
E.S. Jaffe,
I.T. Magrath, and
K. Bhatia
From the Lymphoma Biology Section, Pediatric Oncology Branch,
Molecular Pathology Section, Pathology Branch, National Cancer
Institute, National Institutes of Health, Bethesda, MD; and the Centro
de Investigación en Cancer "Maes-Heller" and Instituto
Nacional de Enfermedades Neoplásicas, Lima, Perú.
 |
ABSTRACT |
We have described 5 major subtypes of Epstein-Barr virus (EBV) based
on variations in EBNA-1 sequences. These include P-ala (identical to
the prototype B95.8 virus), P-thr, V-pro, V-leu, and V-val. Normal
individuals often carry multiple EBV subtypes, the most common being
P-ala, whereas EBV-associated tumors examined to date always contain a
single subtype, which only on rare occasion is P-ala. The
primary hypotheses that these observations generate are as follows: (1)
Each of these EBV subtypes are naturally occurring, and in normal
individuals the multiplicity of subtypes results from multiple
infections. (2) EBV subtypes in normal individuals are generated in
vivo from a single infecting virus subtype by mutations in EBNA-1. The
second hypothesis essentially excludes the possibilities that the
nonrandom association of certain subtypes with lymphomas is secondary
to the geographic distribution of EBV subtypes and, if proven correct,
could provide strong support for a direct role of EBV in tumorigenesis.
In this report, we provide evidence for the latter hypothesis. We show
that the P-ala EBV subtype present in most nasal lymphomas undergoes
and accumulates multiple mutations consistent with the generation of
variant species of EBNA-1 in vivo. This phenomenon is similar to the
generation of quasispecies in RNA viruses and is the first description
of in vivo generation of subtypes in DNA viruses. In RNA-based viruses, including human immunodeficiency virus and hepatitis C
virus, the emergence of quasispecies is linked to
replication infidelity and significantly influences disease processes
through its effect on viral tropism, the emergence of viruses resistant
to the host defenses or to therapy, and pathogenicity. The present data
thus raise important questions relating to the mechanisms whereby these mutations are generated in EBV and their relevance to the pathogenicity of EBV-associated lymphomas.
| |
INTRODUCTION |
EPSTEIN-BARR VIRUS (EBV), which infects
more than 90% of the world's population, has been known for many
years to be capable of infecting both lymphoid and epithelial cells and
has been detected in lymphoid neoplasms of B- and T-cell origin, in
Hodgkin's disease, and in epithelial cell tumors such as
nasopharyngeal carcinoma (NPC), cervical cancer, and some breast
cancers.1-6
In recent reports, we7,8 and others9,10 have
described alterations (relative to the prototype virus B95.8) in the DNA sequence of EBNA-1, an EBV gene essential for the persistence and
replication of EBV genomes in latently infected cells. These alterations were found in EBV contained in immortalized or neoplastic cells, eg, EBV-transformed cell lines,7,8,10 B-cell
non-Hodgkin's lymphoma (NHL),7,8,10 and NPC8,9
as well as in normal cells from peripheral blood lymphocytes (PBL)7 and oral secretions.8 Recently,
antigenic variation of EBNA-1 resulting from such sequence
heterogeneity has also been observed.11 We have used these
sequence variations to classify EBV according to the amino acid at
position 487 in EBNA-1 into 5 subtypes. Two of these subtypes,
prototype EBNA-1 (P-ala) and the closely related subtype, P-thr, have
been identified in lymphocytes from peripheral blood and in oral
secretions. The 3 other subtypes contain multiple substitutions, and we
have therefore referred to them as variant strains (V-pro, V-leu, and
V-val). V-leu has, to date, only been identified in B-cell NHL, whereas
V-pro has been identified only in normal PBLs.7,8 V-pro
differs from V-leu by one amino acid, suggesting that V-leu is derived
by a tumor-specific mutation (proline to leucine at codon 487). V-val, on the other hand, demonstrates specificity for the oral compartment and has, to date, been identified only in normal oral secretions and in
NPC.8,9
The detection of each of the EBNA-1 subtypes as the sole species of
EBNA-1 in either tumor samples or immortalized cell lines indicates
that each subtype can exist as a separate subspecies. Thus, the
simultaneous presence of clusters of substitutions typical of more than
one EBNA-1 subtype in the blood and saliva of a high fraction of normal
individuals strongly suggests that multiple viral subtypes are
present.7,8 In normal cells, some of these subtypes (ie,
V-pro and V-val) occur only in the presence of the prototype viruses,
P-ala and/or P-thr.
There are two possibilities that could account for the presence of
multiple EBNA-1 subtypes in the same individual. The subtypes could
arise from a single subtype (that which originally infected the
individual) by a process of sequential mutation and selection, a
process that has a precedence in the generation of RNA virus variants.12-14 Alternatively, the subtypes could be
naturally occurring. The latter possibility would require the added
corollary that individuals must be infected by more than one subtype,
which seems inherently unlikely, because Ebnotyping (ie,
electrophoretic examination of the pattern of EBV nuclear antigens)
data is consistent with infection and persistence of a single virus
type.15 The possibility that the subtypes are generated in
vivo can be best supported by demonstration of molecular heterogeneity
of EBNA-1 in a cell population that is monoclonal for EBV.
Recently, we elected to examine EBV subtypes in nasal lymphoma of NK/T
phenotype, which is essentially always associated with EBV, and found a
remarkable difference from the pattern we have observed in other
tumors. Instead of a single subtype, we observed extensive genetic
heterogeneity of EBNA-1 in the majority of the tumors. Because there is
good evidence that EBV is monoclonal in NK/T nasal
lymphomas,16 this observation provides clear evidence that
EBNA-1 mutations arise in vivo and strongly suggests that the nonrandom
distribution of EBV subtypes highlights a role for EBV in
lymphomagenesis.
| |
MATERIALS AND METHODS |
The tumor biopsies used for this study were obtained as
paraffin-embedded samples from Perú and Mexico and were
classified after further morphologic and detailed immunophenotypic
studies (to be reported separately) as angiocentric lymphomas (REAL
classification17), also referred to as nasal NK/T-cell
lymphomas (NL).18 All of the tumors included in the study
had an NK/T-cell phenotype. Using in situ hybridization to detect
EBER-1 RNA,19 we selected 39 NLs cases that were rich in
EBV-containing tumor cells. These cases had few or no EBV-positive
cells in the reactive cellular infiltrate. To obtain amplifiable DNA, 5 to 7 sections from each nasal lymphoma biopsy were used. Sections were
deparaffinized by several washes in xylene and DNA was extracted by
digestion with proteinase K.
Analysis of EBV EBNA-1 gene.
The EBNA-1 genotype was determined by polymerase chain reaction (PCR)
amplification and subsequent sequence analysis of a 214-bp segment
3 to the ala-gly repeats that contains most of the substitutions
observed in the variant subtypes.7,8 All PCR reactions
included positive and negative DNA controls and blanks that contained
no DNA. The positive DNA controls consisted of samples representing
each of the P-ala, P-thr, and V-leu subtypes of EBNA-1. The amplified
products from these controls were also sequenced to determine the
integrity of the PCR run.
PCR analysis of monoclonality using the 33-bp repeats in LMP-1.
DNA extracted from the NLs, including samples with heterogeneous EBNA-1
sequences, was also used to determine the clonality of EBV in these
tumors. DNA from 13 of these NL samples and from control cell lines or
from EBV containing throat washes obtained from healthy adults was
amplified with primers GGCGCACCTGGAGGTGGTCC and TTTCCAGGAGAGTCGCTAGG.
The amplification was performed using an annealing temperature of
57°C. The amplified products were electrophoresed in a 4% agarose
gel followed by Southern blotting and hybridization to a
32P-labeled internal probe (TGACAATGGCCCACAG-GACCCTG)
homologous to a part of the variable nontandem repeats as described by
Shibata et al.20
Single-stranded confirmation polymorphism (SSCP)
analysis and sequencing of subcloned EBNA-1 species.
PCR-amplified carboxy fragments of EBNA-1 obtained from 6 NLs (NL 4, 7, 13, 20, 21, and 22) and from controls (B95.8, Namalwa, and P3HR1) were
ligated into a TA cloning vector. The ligated products were used to
transform bacteria and single colonies were obtained. Plasmid DNA was
prepared from single isolates and these plasmids were used as a
template to perform PCR amplification in the presence of
32P-dCTP. The migration patterns of the labeled
amplification products were determined by electrophoresis in a 6%
nondenaturing polyacrylamide gel at 15 W for 12 hours and subsequent
autoradiography. Plasmid DNA sequencing was accomplished using the
Sequenase kit (US Biochemicals, Cleveland, OH) following
the method recommended by the manufacturer.
| |
RESULTS |
EBNA-1 carboxy region substitutions.
Unlike other neoplasms in which we have invariably detected only a
single variant subtype of EBNA-1 associated with each tumor biopsy,7,8 in NLs only 6 of the 39 tumors (NL 1, 3, 4, 5, 29, and 30) carried a single EBNA-1 sequence (homogenous for all codons
sequenced). The remaining 33 tumors carried both the prototype EBNA-1
and EBNA-1 with substitutions common to the variant subtypes mainly
V-pro, V-leu, and V-val (codons 499, 502, 520, and 524). A small number
of novel substitutions were observed, eg, at codon 486. Several nasal
lymphomas (such as NL 4, 17, 26, and 27) carried an EBNA-1 species with
only a subset of the substitutions that we have found to be typical of
one or the other of the variant EBNA-1 subtypes. A large fraction of
tumors (12/39; NL 7, 10, 18, 20, 21, 22, 23, 24, 25, 28, 31, and 37)
carried at least a 2-base substitution at codon 487, such
that this codon now potentially coded for as many as 4 amino acids.
However, these substitutions were not random and only represented those
amino acids that we have previously associated with the EBNA-1
subtypes. Interestingly, the only change specific for P-thr, ie,
GCT-ACT at position 487, was present in only 4 tumors. The pattern of
codon substitutions is described in Fig 1.
View larger version (27K):
[in this window]
[in a new window]
| Fig 1.
This bar graph illustrates the codon substitution and
their frequency in the carboxy fragment of EBNA-1 sequenced from 39 nasal lymphomas. Only those codons that showed mutations are depicted. The prototype P-ala sequence is shown in the x-axis. The top panel shows the substitutions in the respective codons in the subtypes previously described. The most frequent substitutions observed in NL
are shown above the graph. At codon 487, **T means ACT, CCT, CTT,
and/or GTT.
|
|
EBV clonality in NL with multiple EBNA-1 species.
Southern blot analysis of EBV DNA using a probe that detects a 500-bp
tandem repeat sequence in the terminal repeat region of the EBV genome
has often been used to demonstrate monoclonality of EBV association
with tumors. Nasal lymphomas have been previously studied in this way
and EBV has been reported to be monoclonal.21 Unfortunately, such analysis requires a relatively large amount of high
molecular weight DNA that cannot be obtained from paraffin-embedded material. Clonality determination using a PCR-based analysis of the
repeats from the terminal region is difficult because the size of the
target DNA that needs to be amplified is several kilobases long. We
therefore sought to use an alternative marker that is readily examined
by PCR. The LMP-1 sequence contains tandem repeats of 33 bp, the number
of which varies among different isolates. We examined this region of
LMP, also referred to as LYDMA,20 in 13 NLs, including some
that showed heterogeneity of the carboxy fragments of EBNA-1. A single
PCR band of varying size was obtained from each of the NL samples as
well as from the monoclonal controls, including EBV-infected cell lines
Raji, Daudi, and Ag876. As a polyclonal control, we obtained DNA
samples from EBV-positive throat washes from healthy individuals. As
expected, PCR did not generate a unique band.
Monoclonal NLs contain independent and multiple EBNA-1 molecules with
varying substitutions.
As expected from previous Southern blot analyses, the results of the
LMP-33bp repeat PCR indicated monoclonality. Thus, the marked
variability in the carboxy terminus of EBNA-1 in NLs could only result
from an ongoing process of substitutions. To more directly demonstrate
this, we subcloned the amplified carboxy region of EBNA-1 from 6 NLs
(4, 7, 13, 20, 21, and 22). Among these, we included 1 (NL-4) that
carried a single EBNA-1 variant based on direct sequencing of amplified
carboxy terminus DNA (Table 1). The other 5 showed the presence of multiple EBNA-1 variants with respect to the
carboxy terminus. In a previous study, we had documented the absence of
multiple variants in subcloned products obtained from amplification of
EBNA-1 from BL samples or from spontaneously transformed B-cell
lines.7 In the present study, as additional controls, we
also amplified and subcloned carboxy fragments from a B-cell line that
carried the B95.8 virus and from EBV associated with the B-cell
lymphoma cell lines P3HR1 and Namalwa. A subset (4 to 10 clones) of the
subcloned EBNA-1 products from all 6 NL samples and the controls was
assessed for sequence integrity by SSCP analysis, followed by
sequencing the clones with a migration identical to B95.8 and with
abnormal migration (Fig 2 and Table 1).
View larger version (39K):
[in this window]
[in a new window]
| Fig 2.
SSCP analysis of EBNA-1. EBNA-1 PCR products were first
subcloned in a TA cloning vector. Independent clones were then analyzed for SSCP migrations. The sequence analysis of these subcloned fragments
is given in Table 1. Lane numbers in the figure are also
shown in Table 1. Migration pattern of 5 clones from NL 21 (lanes 1 through 5), 6 clones from NL 22 (lanes 6 through 11), 4 clones from NL
20 (lanes 12 through 16), 4 clones from NL 7 (lanes 17 through 21), 10 clones from NL 13 (lanes 22 through 31), and 8 clones from NL 4 (lanes
32 through 39) are shown. Control samples in the SSCP analysis include
P-ala EBNA-1 amplified from B95.8 (lane B) and V-leu EBNA-1 amplified
from P3HR1 (lane H). Several clones from the NLs migrate identically to
the B95.8 pattern (eg, lanes 6, 9, 10, and 11 corresponding to clones
1, 5, 6, and 7, respectively, from NL 22).
|
|
All the amplified DNA fragments from subclones obtained from the B95.8
(P-ala) EBNA-1 migrated uniformly. The patterns of migration of the
fragments from subclones obtained from P3HR1 and Namalwa (both with
V-leu EBNA-1 subtype) were different from B95.8 but identical to each
other. All the DNA fragments from subclones of Namalwa and P3HR1 also
migrated uniformly. Examples of the migration pattern of DNA fragments
from these controls are seen in lanes B and H in Fig 2. The results of
SSCP analysis of DNA from the 6 NLs are also shown in Fig 2. From
several of the EBNA-1 subclones derived from NL 7, 13, 20, 21, and 22, a single fragment that migrated identically to the fragment obtained from B95.8 was observed, but in other clones, different patterns of
migration were seen. This was in agreement with the direct sequencing
results that predicted the presence of multiple EBNA-1 subtypes in many
of the tumors, including the prototype. In contrast, all 9 subclones
obtained from NL 4 demonstrated a homogeneous migration pattern and a
sequence pattern identical to that obtained by direct sequencing. Both
the migration pattern and the sequences of these subclones were, as
expected, different from those seen with the EBNA-1 from prototype EBV.
Comparison of the EBNA-1 sequence obtained by direct sequencing of the
PCR products obtained from tumor DNA and those obtained by first
subcloning PCR amplified EBNA-1 fragments is depicted in Table 1.
Subcloned EBNA-1 fragments from NL 7,13, 20, 21, and 22 that showed an
SSCP migration pattern identical to the prototype EBNA-1, as expected,
also had identical nucleotide sequences to the same EBNA-1 fragment
amplified from B95.8. Three variant fragments obtained from NL-21 each
carried mutations relative to B95.8 EBNA-1. Most of the variations
observed in sequence analysis of uncloned DNA can be derived from the
composite of the sequences of the independent clones. Some of these
mutations were common to the 3 subclones, whereas others were present
in only 1 or 2 of the subclones. As is also evident from the SSCP
analysis (Fig 2, lanes 4 and 5), clones 21-5 and 21-6 also differed by
a single base mutation (GAT-GAG) at codon 500 (Table 1). Similarly,
subclones from tumor number 20 specifically, 20-3 and 20-6 (Fig 2,
lanes 13 and 16), and subclones from tumor number 7, 7-5 and 7-7 (Fig 2, lanes 18 and 20), also differed by mutations in a single codon. From
other tumor samples, we also identified several subclones that carried
only a single mutation, compared with the prototype EBNA-1, eg, 13-6, 20-11, 21-1, and 22-14. None of the BL controls (Namalwa and P3HR1)
demonstrated any heterogeneity among the subclones either by SSCP or by
sequencing.
| |
DISCUSSION |
In the present study, we have identified multiple variations of EBNA-1
in EBV present in nasal NK/T-cell lymphomas. This contrasts with our
previous studies in which we reported that EBV present in tumor samples
derived from EBV-associated BL and NPC always contains a single EBNA-1
variant.7,8 Because EBV is monoclonal in these
tumors,1,3 this finding is not surprising. In BL-associated EBV, EBNA-1 is either P-thr or V-leu (which differs from V-pro by a
single amino acid substitution at codon 487) but never contains mixtures of these or other subtypes. Similarly, NPC-associated EBV is
either P-thr or V-val. Surprisingly, however, the prototype, P-ala,
which is frequently present in the normal population, is rarely
associated with these two malignancies.7,8 In contrast, in
NK/T nasal lymphomas, we frequently detected the P-ala EBV, but only in
the presence of additional variant EBNA-1 subtypes. Moreover, multiple
variant EBNA-1 species were present in 33 of the 39 tumors (Fig 1).
Similar sequence patterns were observed in NK/T nasal lymphomas from
Mexico and Peru. Interestingly, in none of the 6 NLs that carried a
single EBNA-1 subtype was this P-ala EBNA-1. Thus, NLs, like other
tumors, do not appear to contain a homogenous P-ala
subtype.
Two possible explanations for these observations can be considered. (1)
Some nasal lymphomas are monoclonal for EBV and contain a single
variant EBNA-1 subtype, whereas others, which contain multiple EBNA-1
subtypes, are not monoclonal for EBV; or (2) nasal lymphomas that
contain multiple EBNA-1 subtypes are also monoclonal for EBV, but the
EBNA-1 in these tumors undergoes continuous mutation. Our analysis of
LMP-1 (LMP-33bp repeat) sequences, coupled to previous demonstrations
that NK/T-cell nasal lymphomas are monoclonal,21 strongly
supports the second possibility. It is interesting that multiple EBNA-1
subtypes were observed in this study only in the presence of EBNA-1
clones identical to P-ala, also suggesting that this subtype is not
oncogenic or is not compatible with the persistence of the neoplastic
phenotype when present alone. Either possibility strongly supports the
likelihood that EBNA-1 is relevant to oncogenesis. Because a few of the
tumors we examined did not carry a mixture of variant EBNA-1 genotypes,
the possibility that in each case a precursor tumor cell was infected
by a virus that had already undergone substitutions in EBNA-1 remains.
In the majority of the tumors, in which the prototype virus may have been, at one point, the only subtype present, the virus was subjected to mutational pressure within the carboxy terminus, thus generating one
or more additional subtypes in addition to P-ala. However, this model
does require that multiple EBNA-1 subtypes are present in individual
tumor cells, requiring, for its proof, PCR analysis of microdissected
cells. This will be the topic of a future research project.
Several of the substitutions we detected in NK/T lymphoma were similar
to those that we have described previously, although we also often
observed clones that were not completely identical to those in EBNA-1
variants derived from other tumors and normal cells (Fig 1). For
example, codons 486 and 529, not normally mutated in the EBNA-1
subtypes, were mutated in 6 and 10 NLs, respectively. A surprisingly
large fraction of the tumors carried at least 2-base substitutions at codon 487, such that this codon could potentially code
for four amino acids. However, these substitutions were not random,
with the 4 possible amino acids being those that we have previously
associated with the different EBNA-1 subtypes, namely alanine, leucine,
proline, and valine. Seventy-seven percent of the NLs had a
substitution at codon 487, and alanine, proline, leucine, and valine
were observed in 92%, 62%, 33%, and 38% of the tumors,
respectively. Surprisingly, in view of its frequency in normal cells,
BL and NPC, a threonine at position 487 was rarely present in the NLs
(4/39). In contrast to the lack of a threonine substitution, as many as
56% of the NLs carried a specific substitution at codon 528 (ATT-GTT),
which is typically present only in the V-val subtype (Fig 1). The
EBNA-1 in these same 528(val) tumors invariably also carried
substitutions in the amino-terminus that are also present in the V-val
subtype.
Analysis of subcloned EBNA-1 PCR products from NK/T-cell lymphomas
showed that the mutational process was ongoing. Each of the tumors
contained EBNA-1 molecules containing one or more mutations (Table 1),
and several of the mutations were detected in more than one of the
independent clones, consistent with the incremental accumulation of
mutations. Mutations at codon 487, although frequent, were invariably
associated with mutations in at least 3 or 4 other codons and subclones
with other mutations, but without codon 487 mutations, were also
recovered (eg, subclone NL-21-4 in Table 1 and NL-4), suggesting that
mutations at position 487 usually occur after other mutations have
occurred. Overall, the pattern of these mutations showed a tendency to
generate the various subtypes we have previously described and further
substantiate the negative association of the P-ala strain with
EBV-containing tumors. These data are also consistent with the in vivo
generation of EBNA-1 subtypes and provide an explanation for the
apparent invariable association of V-pro and V-val with P-ala or P-thr.
Our data are also consistent with the possibility that BL and NPC, and
a small fraction of NK/T-cell lymphomas, arise from cells infected by a
virus already mutated in its carboxy terminus region, whereas a larger
fraction of NK/T-cell lymphomas arise from cells containing prototype
(P-ala) virus that undergo mutations in the premalignant or the
malignant cells themselves. It remains possible that P-thr, which,
unlike the V strains, may occur in isolation in normal cells,
represents a second free-living strain of virus.
Finally, the in vivo generation of multiple EBV subtypes, as
demonstrated here in NK/T-cell lymphomas, is reminiscent of the generation of quasispecies in RNA viruses. This is the first
description of such a process in DNA viruses and raises important
questions relating to the mechanisms of these mutations. Although it is possible that they occur merely as a result of genetic instability in
the tumor, several arguments suggest that this may not be the case: the
pattern of mutations is similar to the substitutions in the EBV
subtypes observed in normal individuals, and deletions or insertions at
polynucleotide tracts, a characteristic of microsatellite instability,
was not observed, although such a phenotype has been demonstrated in
certain hematological malignancies.22 In RNA viruses, the RNA-dependent RNA polymerases have no proofreading activity, which leads to a high frequency of nucleotide substitutions during replication. Thus, viral populations in infected individuals become heterogeneous mixtures of variants or quasispecies. Although the
EBV DNA-dependent DNA polymerase lacks some proofreading
activity,23 such that replication would normally be
associated with the generation of mutations, there is no evidence that
this polymerase is involved in the generation of the genetic
variability we have observed. Because the virus is monoclonal in tumor
cells, multiple cycles of viral replication would appear to be
excluded, and mutations must presumably arise during replication of
latent viral genomes, which is dependent on the host DNA polymerase.
Therefore, either the environment in the NK-cell background is
conducive to the emergence of genetic heterogeneity or EBV possesses a
mechanism for driving EBNA-1 mutation. Moreover, because we have
demonstrated EBNA-1 hypervariability only in NK/T-cell lymphomas, it is
possible that the generation of EBNA-1 subtypes in normal individuals
occurs only in certain cell types, eg, NK cells or a subset of NK
cells. Alternatively, stringent selection of EBNA-1 variants occurs in most cell types, but not NK/T-cell lymphomas. Whatever the mechanism, the nonrandom disassociation of the EBV subtypes with normal and neoplastic cells suggests that the generation of heterogeneity in
EBNA-1 influences both the biology and the pathogenicity of the virus.
| |
FOOTNOTES |
Submitted August 25, 1997;
accepted March 11, 1998.
Address reprint requests to K. Bhatia, PhD, National Institutes of
Health, Bldg 10, Room 13N240, 10 Center Dr MSC 1928, Bethesda, MD
20892-1928; e-mail: BhatiaK{at}Pbmac.nci.nih.gov.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.
| |
ACKNOWLEDGMENT |
The authors acknowledge Dr Kojo Elenitoba-Johnson (Molecular Pathology
Section, National Cancer Institute) for helping with the diagnosis and
the work up of the Mexican nasal lymphomas.
| |
REFERENCES |
1.
Magrath IT,
Jain V,
Bhatia K:
Epstein-Barr virus and Burkitt's lymphoma.
Semin Cancer Biol
3:285,
1992[Medline]
[Order article via Infotrieve]
2.
Su IJ,
Hsieh HC,
Lin KH,
Uen WC,
Kao CL,
Chen CJ,
Cheng AL,
Kadin ME,
Chen JY:
Aggressive peripheral T-cell lymphomas containing Epstein-Barr viral DNA: A clinicopathologic and molecular analysis.
Blood
77:799,
1991[Abstract/Free Full Text]
3.
Young LS,
Dawson CW,
Clark D,
Rupani H,
Busson P,
Tursz T,
Johnson A,
Rickinson AB:
Epstein-Barr virus gene expression in nasopharyngeal carcinoma.
J Gen Virol
69:1051,
1988[Abstract/Free Full Text]
4.
Kitano Y,
Fujisaki S,
Nacamura N,
Miyasaki K,
Katsuki T,
Okamura H:
Immunological disorder against the Epstein-Barr virus infection and prognosis in patients with cervical carcinoma.
Gynecol Oncol
57:150,
1995[Medline]
[Order article via Infotrieve]
5.
Labrecque LG,
Barnes DM,
Fentiman IS,
Griffin BE:
Epstein Barr virus in epithelial cell tumors: A breast cancer study.
Cancer Res
55:49,
1995
6.
Glaser SL,
Lin RJ,
Stewart SL,
Ambinder RF,
Jarret RF,
Brousset P,
Pallesen G,
Gulley ML,
Khan G,
O'Grady J,
Hummel M,
Preciado MV,
Knecht H,
Chan JK,
Claviez A:
Epstein-Barr virus-associated Hodgkin's disease: Epidemiologic characteristics in international data.
Int J Cancer
70:375,
1997[Medline]
[Order article via Infotrieve]
7.
Bhatia K,
Raj A,
Gutiérrez MI,
Judde J-G,
Spangler G,
Venkatesh H,
Magrath IT:
Variation in the sequence of Epstein Barr virus nuclear antigen 1 in normal peripheral blood lymphocytes and in Burkitt's lymphoma.
Oncogene
13:177,
1996[Medline]
[Order article via Infotrieve]
8.
Gutiérrez MI,
Raj A,
Spangler G,
Sharma A,
Hussain A,
Judde J-G,
Tsao SW,
Yuen PW,
Joab I,
Magrath IT,
Bhatia K:
Sequence variations in EBNA-1 may dictate restriction of tissue distribution of Epstein Barr virus in normal and tumor cells.
J Gen Virol
78:1663,
1997[Abstract]
9.
Snudden DK,
Smith PR,
Lai D,
Ng M-H,
Griffin BE:
Alterations in the structure of the EBV nuclear antigen, EBNA-1, in epithelial cell tumors.
Oncogene
10:1545,
1995[Medline]
[Order article via Infotrieve]
10.
Wrightham MN,
Stewart JP,
Janjua NJ,
Pepper SD,
Sample C,
Rooney CM,
Arrand JR:
Antigenic and sequence variation in the C. terminal unique domain of the Epstein-Barr virus nuclear antigen EBNA-1.
Virology
208:521,
1995[Medline]
[Order article via Infotrieve]
11.
Iwakiri D,
Nakamura H,
Ono Y,
Fujiwara S:
Antigenic variation of the Epstein-Barr virus nuclear antigen EBNA-1 as revealed by monoclonal antibodies.
Virus Res
50:139,
1997[Medline]
[Order article via Infotrieve]
12.
Molla A,
Korneyeva M,
Gao Q,
Vasasanonda S,
Schipper P,
Mo HM,
Markowitz M,
Chernyavsky T,
Niu P,
Lyons N,
Hssu A:
Ordered accumulation of mutations in HIV protease confers resistance to Ritonavir.
Nat Med
2:760,
1996[Medline]
[Order article via Infotrieve]
13.
Duarte EA,
Novella IS,
Weaver SC,
Domingo E,
Wain-Hobson S,
Clarke DK,
Moya A,
Elena SF,
de la Torre JC,
Holland JJ:
RNA virus quasispecies: Significance for viral disease and epidemiology.
Infect Agents Dis
3:201,
1994[Medline]
[Order article via Infotrieve]
14.
Eigen M:
The origin of genetic information; viruses as models.
Gene
135:37,
1993[Medline]
[Order article via Infotrieve]
15.
Gratama JW,
Oosterveer MA,
Klein G,
Ernberg I:
EBNA size polymorphism can be used to trace Epstein-Barr virus spread within families.
J Virol
64:4703,
1990[Abstract/Free Full Text]
16.
Jaffe E:
Nasal and nasal-type T/NK cell lymphoma: A unique form of lymphoma associated with the Epstein-Barr virus.
Histopathology
27:581,
1995[Medline]
[Order article via Infotrieve]
17.
Harris NL,
Jaffe ES,
Stein H,
Banks PM,
Chan JK,
Cleary ML,
Delsol G,
De Wolf-Peeters C,
Falini B,
Gatter KC:
A revised European-American classification of lymphoid neoplasms: A proposal from the International Lymphoma Study Group.
Blood
84:1361,
1994[Free Full Text]
18.
Jaffe ES,
Chan JK,
Su IJ,
Frizzera G,
Mori S,
Feller AC,
Ho FC:
Report of the Workshop on nasal and related extranodal angiocentric T/natural killer cell lymphomas. Definition, differential diagnosis and epidemiology.
Am J Surg Pathol
20:103,
1996[Medline]
[Order article via Infotrieve]
19.
Barletta JM,
Kingma DW,
Ling Y,
Charache P,
Mann RB,
Ambinder RF:
Rapid in situ hybridization for the diagnosis of latent Epstein-Barr virus infection.
Mol Cell Probes
7:105,
1993[Medline]
[Order article via Infotrieve]
20.
Shibata D,
Weiss LM,
Nathwani BN,
Brynes RK,
Levine AM:
Epstein-Barr virus in benign lymph node biopsies from individuals infected with the human immunodeficiency virus is associated with concurrent or subsequent development of non-Hodgkin's lymphoma.
Blood
77:1527,
1991[Abstract/Free Full Text]
21.
Ho FC,
Srivastava G,
Loke SL,
Fu KH,
Leung bP,
Liang R,
Choy D:
Presence of Epstein-Barr virus DNA in nasal lymphomas of B and T cell type.
Hematol Oncol
8:271,
1990[Medline]
[Order article via Infotrieve]
22.
Gartenhaus RB:
Microsatellite instability in hematologic malignancies.
Leuk Lymphoma
25:455,
1997[Medline]
[Order article via Infotrieve]
23.
Grossberger D,
Clough W:
Incorporation into DNA of the base analog 2-aminopurine by the Epstein-Barr virus-induced DNA polymerase in vivo and in vitro.
Proc Natl Acad Sci USA
78:7271,
1981[Abstract/Free Full Text]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
M. I. Gutierrez, S. E. Straus, M. M. Ibrahim, J. K. Dale, and K. Bhatia
RESPONSE: Re: Discrete Alterations in the BZLF1 Promoter in Tumor and Non-Tumor-Associated Epstein-Barr Virus
J Natl Cancer Inst,
July 2, 2003;
95(13):
1009 - 1009.
[Full Text]
[PDF]
|
|
|
|
|
|
|
W.-Y. Wang, Y.-C. Chien, J.-S. Jan, C.-M. Chueh, and J.-C. Lin
Consistent Sequence Variation of Epstein-Barr Virus Nuclear Antigen 1 in Primary Tumor and Peripheral Blood Cells of Patients with Nasopharyngeal Carcinoma
Clin. Cancer Res.,
August 1, 2002;
8(8):
2586 - 2590.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G. M. Jenkins, M. Worobey, C. H. Woelk, and E. C. Holmes
Nonquasispecies Evidence for the Evolution of RNA Viruses
Mol. Biol. Evol.,
June 1, 2001;
18(6):
987 - 994.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
B. Z. Carter, M. Milella, D. C. Altieri, and M. Andreeff
Cytokine-regulated expression of survivin in myeloid leukemia
Blood,
May 1, 2001;
97(9):
2784 - 2790.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. MacKenzie, D. Gray, R. Pinto-Paes, L. F. M. Barrezueta, A. A. Armstrong, F. A. Alexander, D. J. McGeoch, and R. F. Jarrett
Analysis of Epstein-Barr virus (EBV) nuclear antigen 1 subtypes in EBV-associated lymphomas from Brazil and the United Kingdom
J. Gen. Virol.,
October 1, 1999;
80(10):
2741 - 2745.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
K. Bhatia, I. Magrath;, G. Habeshaw, and A. B. Rickinson
EBNA-1 Sequences in Endemic and Sporadic Burkitt's Lymphoma
J. Virol.,
August 1, 1999;
73(8):
7096 - 7097.
[Full Text]
|
|
|
|
|
|
|
K. L. Chang, Y.-Y. Chen, W.-G. Chen, K. Hayashi, C. Bacchi, M. Bacchi, and L. M. Weiss
EBNA-1 Gene Sequences in Brazilian and American Patients With Hodgkin's Disease
Blood,
July 1, 1999;
94(1):
244 - 250.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G. Habeshaw, Q. Y. Yao, A. I. Bell, D. Morton, and A. B. Rickinson
Epstein-Barr Virus Nuclear Antigen 1 Sequences in Endemic and Sporadic Burkitt's Lymphoma Reflect Virus Strains Prevalent in Different Geographic Areas
J. Virol.,
February 1, 1999;
73(2):
965 - 975.
[Abstract]
[Full Text]
|
|
|
|
|
Abstract
Introduction
Abstract