|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 92 No. 2 (July 15), 1998:
pp. 607-615
Impaired Granulocytic Differentiation In Vitro in Hematopoietic
Cells Lacking Retinoic Acid Receptors 1 and
By
Jean Labrecque,
Deborah Allan,
Pierre Chambon,
Norman N. Iscove,
David Lohnes, and
Trang Hoang
From the Clinical Research Institute of Montréal,
Montréal, Québec, Canada; the Departments of Pharmacology,
Molecular Biology, and Biochemistry, Université de
Montréal, Montréal, Québec, Canada; the Laboratoire
de Génétique Moléculaire des Eukaryotes du CNRS,
Strasbourg, France; and the Ontario Cancer Institute, Toronto, Ontario,
Canada.
 |
ABSTRACT |
Transcripts for the retinoic acid receptors (RARs) 1, 2, 1,
and 2 were found in the granulocytic lineage (Gr-1+
cells) through semiquantitative polymerase chain reaction (PCR) analysis. The screening of single cell cDNA libraries derived from
hematopoietic progenitors also showed the presence of RAR and, to a
lesser extent, RAR transcripts in committed granulocyte (colony-forming unit-granulocyte [CFU-G]) or granulocyte-macrophage (CFU-GM) colony-forming cells. The contribution of RAR 1 and to
hematopoietic cell differentiation was therefore investigated in mice
bearing targeted disruption of either one or both of these loci.
Because RAR and RAR 1 compound null mutants die shortly after
birth, bone marrow cells were collected from fetuses at 18.5 days
postcoitum (dpc) and evaluated for growth and differentiation in
culture in the presence of Steel factor (SF), interleukin-3 (IL-3), and
erythropoietin (Epo). The frequency of colony-forming cells from bone
marrow populations derived from RAR 1/ double null mice was not
significantly different from that of RAR or RAR 1 single nulls or
from wild-type controls. In addition, the distribution of erythroid,
granulocyte, and macrophage colonies was comparable between
hematopoietic cells from all groups, suggesting that lineage commitment
was not affected by the lack of RAR 1 and/or RAR . Colony
cells were then harvested individually and evaluated by morphologic
criteria. While terminal granulocyte differentiation was evident in
wild-type cells and colonies from either single null mutant, colonies
derived from RAR 1 /  / bone
marrow populations were blocked at the myelocyte and, to a lesser
extent, at the metamyelocyte stages, whereas erythroid and macrophage
differentiation was not affected. Together, these results indicate that
both RAR 1 and are required for terminal maturation in the
granulocytic lineage in vitro, but appear to be dispensable for the
early stages of hematopoietic cell development. Our results raise the
possibility that in acute promyelocytic leukemia (APL), the different
RAR fusion proteins cause differentiation arrest at a stage when
further maturation requires not only RAR , but also RAR . Finally,
bone marrow cells appear to differentiate normally in vivo, suggesting
an effective compensation mechanism in the RAR 1/ double null
mice.
 |
INTRODUCTION |
THE GENERATION OF hematopoietic cells
proceeds through complex yet discrete differentiation events that
include an irreversible commitment step from a multipotent precursor,
followed by terminal maturation events resulting in functional end
cells (ie, granulocytes, monocytes, erythrocytes, platelets, and
lymphocytes). There is increasing evidence that differentiation along a
given pathway is driven by lineage-restricted transcription factors
that act cell autonomously to activate a defined set of target genes,
thus specifying cell types in normal hematopoiesis (reviewed by
Orkin1). Leukemic cells, however, are arrested at specific
stages of differentiation and leukemias have thus been classified into
distinct subtypes according to their morphologic appearance. Several of
the French-American-British (FAB) classification subtypes correlate
with consistent chromosomal translocations, which frequently involve
loci encoding transcription factors. Not surprisingly, these
transcription factors are also often crucial for normal hematopoiesis
(reviewed by Wolff2).
Retinoids are essential regulators of complex differentiation processes
(reviewed by Lohnes et al3). The retinoid signal is
transduced by two families of nuclear receptors, the retinoic acid (RA)
receptors (RAR , , and and their isoforms) and the retinoid X
receptors (RXR , , and ) (reviewed by Kastner4). RARs function as ligand-inducible transcription regulators by binding,
together with an RXR partner,5 to specific
cis-acting sequences (RA response elements; RAREs). RARs can be
activated by both all-trans and 9-cis RA, whereas RXRs
are activated only by 9-cis RA. RXRs are also essential
heterodimeric partners for a number of other nuclear receptor
signalling pathways.6,7
Targeted gene disruption has been used to evaluate the function of RAR
types and isoforms in vivo. Mice deficient for RAR 1, the major
RAR isoform, and RAR 2 are apparently unaffected.3,8,9 However, ablation of all RAR or isoforms results in a low
frequency of skeletal malformations, as well as a subset of defects
related to postpartum vitamin A deficiency.3,8 In contrast
to the relatively minor consequence of disruption of a single receptor, defects evoked by loss of various combinations of RARs recapitulate essentially all of the pathologies associated with congenital vitamin A
deficiency, together with the appearance of malformations not
previously seen in such dietary manipulation
studies.3,10,11 Thus, gene targeting suggests some degree
of functional redundancy between RARs5,12,13 (reviewed by
Perlmann and Evans14).
A role for RAR in hematopoiesis was first suggested by its locating
at the breakpoint of several chromosomal translocations associated with
acute promyelocytic leukemia (APL; M3 in the FAB classification). The
predominant t(15;17) translocation and the variant t(11;17) and t(5;17)
translocations result in the creation of PML-RAR , PLZF-RAR , and
NPM-RAR chimeras, respectively.15-20 In APL,
granulocytic differentiation is blocked at the promyelocyte stage. RA
treatment in vivo relieves this block and favors terminal granulocyte
differentiation in patients with the t(15;17)
translocation,21-24 albeit resulting in the appearance of
polymorphonuclear cells with abnormal granulations.25
Together, these observations indicate an important role for RAR in
terminal granulocyte differentiation.
Both PML-RAR and PLZF-RAR inhibit RA-dependent transactivation of
wild-type RARs.26-28 Moreover, a dominant negative
C-terminal truncated RAR (RAR 403) can also elicit
differentiation arrest in the granulocytic lineage at the promyelocyte
stage.29 These observations further suggest that
attenuation of RAR signaling plays an important role in the
pathogenesis of APL. Dominant negative mutants, however, can interfere
with the function of all RAR types, and could conceivably affect other
RXR-dependent pathways, such that the contribution of each RAR to
hematopoiesis has not been clearly established. To directly address the
role of RAR 1 and RAR in hematopoietic cell differentiation, we
evaluated the growth and differentiation potential of bone marrow cells
from mice in which either one or both loci were inactivated.
 |
MATERIALS AND METHODS |
Generation of RAR mutants.
The RAR 1, RAR , and RAR 1/ knockout animals used in these
studies have been described previously.8-10 To generate
wild-type and RAR null fetuses, the appropriate matings were
established and females surveyed daily for a vaginal plug; noon of the
day of plug was considered 0.5 dpc. Females were killed at 18.5 dpc, fetuses obtained by caesarean section, and genotype assigned by polymerase chain reaction (PCR) using placental DNA as previously described.30
Isolation of bone marrow cells and methylcellulose cultures.
Long bones and the sternum were freed of surrounding tissues and cut
into small pieces. Bone marrow cells were isolated by repeated
aspiration through a Pasteur pipette and bone particles eliminated
through differential deposition in Iscove's medium (IMDM; GIBCO, Grand
Island, NJ) supplemented with 10% fetal calf serum (FCS).
Bone marrow cells were counted and either cytosmeared for evaluation by
morphologic criteria or cultured in methylcellulose, as previously
described.31-33 For methylcellulose cultures, 5 × 104 mononuclear cells were plated in 1 mL of IMDM
supplemented with 10 % FCS, bovine serum albumin (20 mg/mL; Sigma, St
Louis, MO), iron saturated transferrin (160 µg/mL; Sigma),
recombinant murine SF, WEHI-3 conditioned medium (2.5%, as a source of
IL-3) and recombinant human erythropoietin (hu Epo; 1 U/mL), and viscified with 1% methylcellulose (Fluka, Rokonka, NY).
Colonies were scored on day 7 of culture with an inverted microscope as
described.31 After counting, colonies were harvested
individually and cells evaluated by morphologic criteria using
Giemsa-stained cytosmears.
Isolation of Gr-1+ cells.
Gr-1+ and Gr-1 cells were purified from
wild-type adult mouse bone marrow by immunomagnetic selection. Briefly,
after erythrocyte lysis by osmotic shock, nucleated bone marrow cells
were depleted of B cells through incubation with magnetic beads coupled
to a polyclonal goat antimouse antibody at a bead to cell ratio of 8. Negative cells were coated with human Ig (Sigma) in ice cold IMDM/10%
FCS for 30 minutes to block Fc binding. The cells (5 × 106) were then labeled with purified Gr-1 (1 µg/100 µL)
for 30 minutes, washed, followed by a second labeling with MAR18.5
(specific for rat chains). After washing, the cells were
resuspended in medium containing goat antimouse coupled magnetic beads
as above. Both positive and negative cells were resorted twice to
eliminate nonspecific cosedimenting cells and cell pellets (5 × 106) frozen for RNA extraction.
Semiquantitative reverse transcription-PCR (RT-PCR)
analysis.
RNA was purified from approximately 5 × 106 Gr-1+ or Gr-1 cells or
from 100 µg of newborn mouse skin by Trizol extraction (GIBCO-BRL). Approximately 2 µg of RNA was reverse transcribed with 300 U of Moloney murine leukemia virus (MMLV) reverse transcriptase
(GIBCO-BRL) using hexanucleotide primers under standard reaction
conditions. One tenth (2 µL) of the first strand cDNA was then used
as substrate for PCR amplification using primers specific for the
transcripts of interest. Amplification reactions were terminated every
second cycle from 25 to 35 cycles or after 50 cycles. Reaction products were resolved on a 1.5% agarose gel, transferred to Gene Screen plus
membranes (DuPont) according to the manufacture's instructions, and
hybridized with end-labeled oligonucleotides corresponding to internal
sequences specific to each predicted PCR product. Oligonucleotides used
for PCR were as follows; for amplification of RAR isoforms, the
primer CCGGATGATTTGTCTTGACA was used in combination with either
GTTGGGCTGACCACCCAACC or AGTGACCTGCAGACTTAGGC for amplification of
RAR 1 or RAR 2, respectively; RAR transcripts (all isoforms)
were amplified using the oligonucleotides ACATGAACCCTTGACCCCAAG and TTTAAACTAGATTCTGGTGG; RAR isoforms were amplified using the primer CTTCACAGGAGCTGACCCCAT and either AGCCTGGCCCAGTATGTAGG or ATCCCTTACCCCCCATGC for RAR 1 or RAR 2, respectively; -actin
was amplified using the primers GAGGGCATACCCCTCGTAGAT and
CAGAAGGATTCCTATGTGGGC. End-labeled oligonucleotides used for
Southern blot analysis to confirm the fidelity of amplification were as
follows; RAR isoforms, ATCGAGACCCAGAGCAGCAG; RAR isoforms,
CCATCGAGACACAGA; RAR isoforms, CAGAGCACCAGCTCGGAGGA; -actin,
AGAGAGGTATCCTGACC.
Analysis of single cell cDNA.
3 murine RAR or cDNA probes corresponding to sequences
immediately upstream of the polyadenylation signal was generated by
3 rapid amplification of cDNA ends (RACE) using
TTGGACACTCTAAGCGGA and TTGAGGACGACTCCTCGA as 5 primers for
RAR and , respectively. The identity of the amplified product was
confirmed by restriction analysis and by specific hybridization to
internal oligonucleotides. Southern blots of single cell cDNA libraries
identified to specific progenitors by sib analysis as detailed
previously,34,35 were hybridized to the probes, exposed to
a PhosphorImager screen, and quantitated.
 |
RESULTS |
Gr-1 is a cell surface marker of the Ly-6 family of adhesion molecules
and its expression is restricted to more differentiated granulocytes,36 whereas granulocyte precursors
(colony-forming unit-granulocyte [CFU-G]) and other hematopoietic
lineage precursors are Gr-1 .37 Because
of differentiation arrest at the promyelocyte stage in APL and its
association with expression of dominant negative RAR chimeras, we
chose to study RAR gene expression in bone marrow populations separated
on the basis of Gr-1 expression. After cell sorting, the purity of the
Gr-1+ population was confirmed through morphologic
examination of cytosmears and was found to consist of 97%
differentiated granulocytes (metamyelocytes, bands and
polymorphonuclear [PMN]) and 1.5% myelocytes.
Myeloblasts and promyelocytes were found in the Gr-1
population, together with cells of all other lineages.
RT-PCR analysis of Gr-1+ and Gr-1 cells
indicated that the RAR 1 message was present in both cell
populations, although Gr-1 cells appeared to express
much less of this transcript compared with the Gr-1+ pool
(Fig 1). In contrast, RAR 2 transcripts
were undetectable in Gr-1 cells under conditions
where it was readily observed in Gr-1+ isolates.
Transcripts encoding RAR isoforms were undetectable after 35 cycles
of PCR, irrespective of Gr-1 status. However, RAR 2 transcripts were
detected in Gr-1+, and to a lesser extent in
Gr-1 , cells after 50 cycles of amplification.
RAR 1 transcripts were barely detectable in the former cell
population and were undetectable in Gr-1 cells.
RAR transcripts were not detectable in either cell population despite extensive PCR amplification (data not shown). Thus, RAR 1 appears to be the major RAR transcript in Gr-1+ cells,
while RAR 2, RAR 1 and RAR 2 are much less abundant. In contrast,
only RAR 1 and 2 were detected at low levels in
GR-1 cells. Similar results were observed with cells
that were sorted by flow cytometry, suggesting that these low levels of
RAR 1 and RAR 2 in GR-1 cells were not due to
contaminating Gr-1+ cells (data not shown).

View larger version (29K):
[in this window]
[in a new window]
| Fig 1.
Semiquantitative PCR analysis of RAR expression in
differentiated granulocytes (Gr-1+) and other cell types
(Gr-1 ). Cells were separated as described in Materials
and Methods. The PCR reaction was performed for 25 to 35 cycles for
RAR 1 and RAR 2 and 50 cycles for RAR and RAR . Shown is a
Southern blot analysis of the PCR product hybridized with an internal
oligonucleotide probe specific for each amplification product, as
described in Materials and Methods.
|
|
To further address the possibility of RAR expression in a rare
subpopulation of GR-1 cells, we derived probes from
the 3 untranslated region (UTR) of RAR and RAR
cDNAs for the screening of single cell cDNAs from hematopoietic
precursors that were identified through sib analysis as detailed
previously.34 Previous studies have validated these sample
sets through hybrization with a ribosomal L32 probe, which showed a
uniform level in all cDNA libraries.34 In contrast, RAR
and RAR expression was observed mainly in myeloid cells, with
highest levels in maturing cell populations, specifically in all
macrophage populations from fetal liver and in two of five B-cell
populations from fetal liver grown in the presence of
colony-stimulating factor (CSF)-1 and/or IL-7, respectively
(Fig 2). In contrast, hybridization to cDNA
samples from adult macrophages, shown previously to be highly positive
for c-fms and lysozyme,34 was not observed. In this sample
set, the cDNA libraries obtained from maturing granulocytes were not
sufficiently representative34 for accurate assessment of
RAR expression. Strikingly, both RAR and RAR transcripts in
hematopoietic progenitors were mostly confined to committed CFU-G and
CFU-GM. This pattern of expression is in marked contrast to that
previously reported for the hematopoietic transcription factors, SCL
and GATA-1, which are coexpressed in multipotent progenitors and
committed erythroid progenitors.35 Consistent with RT-PCR
analysis, hybridization signals for RAR were much stronger than for
RAR , again suggesting that RAR is the major RAR transcript in
hematopoietic progenitors. RAR expression was not analyzed.

View larger version (26K):
[in this window]
[in a new window]

View larger version (24K):
[in this window]
[in a new window]
| Fig 2.
Quantitation of relative RAR and RAR transcript
levels in cDNA samples from diverse differentiation stages of the
hematopoietic hierarchy. Southern blots of cDNA samples from the
different cell types as shown were sequentially hybridized with probes
for RAR and , and exposed to a PhosphorImage screen for
quantitation.
|
|
Given the above patterns of expression for RAR and RAR messages,
we analyzed the role of RAR 1 and RAR in hematopoietic cell
differentiation through the study of the corresponding single or double
knockout mice. Because bone marrow cells may be affected by
developmental deficiencies in the bone mass itself, we compared the
carcasses from RAR null mutants, heterozygote littermates, or wild-type
controls. There was no significant difference in bone weight or in the
number of bone marrow cells recovered, indicating that hematopoietic
cell development within the bone marrow is not grossly affected (data
not shown). Similarly, there was no detectable difference in cell type
or lineage distribution in bone marrow populations elicited by receptor
knockout, as judged by analysis of cytospins from either wild-type,
RAR 1, and/or RAR null mice (data not shown).
Consistent with the normal distribution of bone marrow cell
populations, quantitative assessment by methylcellulose culture indicated that the frequency of colony-forming cells from bone marrow
isolates did not differ significantly between wild-type controls and
RAR 1, RAR , or RAR 1/ null mutants or heterozygous littermates (Fig 3, right panel). Moreover,
the distribution of multilineage and unilineage colony-forming cells
was comparable between all genotypes (Fig 3, left panel, data shown for
wild-type and compound null mutants). Together, these observations
suggest that the lack of either or both RAR 1 and RAR does not
affect the generation of committed precursors per se, which may be
taken as an indication of lineage commitment in vivo.

View larger version (16K):
[in this window]
[in a new window]
| Fig 3.
Distribution of the different types of colonies in
methylcellulose cultures of bone marrow cells from compound
RAR 1 /  / null mice and
littermate or wild-type controls. Colonies were scored on day 7 and the
results expressed as percent total colony count (left panel). Total
number of nucleated bone marrow cells recovered from the long bones of
RAR 1 /  / mice and wild-type
controls or heterozygous littermates. There was no significant
difference among the four groups (right panel).
|
|
Maturation along the granulocytic and monocytic lineages was further
examined in cytospins from individual colonies isolated from
methylcellulose cultures. Terminal maturation into bands or
polymorphonuclear granulocytes was evident in wild-type colonies (Fig 4). Similarly, terminal granulocyte
differentiation, as judged by nuclear segmentation, was normal in
RAR / or RAR 1 /
cells. In contrast, granulocyte differentiation was largely arrested at
the myelocyte stage in
RAR 1 /  / cells.
When the proportion of differentiated granulocytes (metamyelocytes, bands, and PMN) was compiled as percent total cells in the granulocytic lineage, including myeloblasts and promyelocytes, a significant difference between the
RAR 1 /  / group
and wild-type controls was observed (P < .05)
(Fig 5). In contrast,
RAR 1 / or
RAR 1 / +/-
littermates were not significantly different from wild-types. The
phenotype of RAR / isolates, although not
statistically different from wild-type, exhibited a higher degree of
variability with some highly differentiated and some less
differentiated colonies. In contrast to the maturation arrest in the
granulotype lineage, the proportion of macrophages per colony was
comparable between all genotypes (Fig 6).
Finally, there was no correlation between the percentage of
monocytes/macrophages and the degree of granulocytic
differentiation observed. Together, our observations suggest that the
lack of RAR 1 and RAR significantly impaired granulocytic
differentiation in vitro without affecting macrophage or erythroid
differentiation.

View larger version (74K):
[in this window]
[in a new window]
| Fig 4.
Light microscopic photographs of colony cells harvested
from individual granulocyte macrophage colonies. Colony cells were cytosmeared and stained with Wright-Giemsa. Genotypes are shown underneath.
|
|

View larger version (12K):
[in this window]
[in a new window]
| Fig 5.
Granulocyte differentiation in methylcellulose culture.
GM colonies were harvested individually and stained as in Fig 4.
Results are shown as percent differentiated granulocytes
(metamyelocytes, bands, and PMN) within the granulocytic lineage. The
difference between wild-type controls and
RAR 1 /  / was significantly
different (P < .05), whereas the difference with other groups
was not significant.
|
|

View larger version (11K):
[in this window]
[in a new window]
| Fig 6.
Macrophage differentiation in methylcellulose culture.
The macrophage content of each GM colony is shown as a percentage of total cells. There was no significant difference among the various groups.
|
|
To determine whether the in vitro differentiation block could be
relieved by excess retinoids, bone marrow cells from
RAR 1 /  / mice
were plated in the presence of RA at two different concentrations (Fig 7). Analysis of individual granulocyte
macrophage colonies indicate that pharmacologic concentrations of RA
overcame the maturation block imposed by the lack of RAR 1 and .

View larger version (30K):
[in this window]
[in a new window]
| Fig 7.
Pharmacologic doses of RA overcome the maturation block
in granulopoietic cells lacking RAR 1 and RAR . Bone marrow cells from RAR 1 /  / mice were plated
in methycellulose cultures in the presence or in the absence of RA at
the indicated concentrations. GM colonies were harvested individually
and stained as in Fig 4. Results shown are the average of differential
counts of 30 independent colonies in the control group, three colonies
for the lower concentration of RA (10 8 mol/L) and 15 colonies for the higher concentration of RA (10 7 mol/L)
and are expressed as percent total cells within the granulocytic lineage.
|
|
 |
DISCUSSION |
Results from semiquantitative PCR and expression analysis of
representative cDNAs from clonal hematopoietic isolates are consistent with our finding of a role for RAR 1, together with RAR , in
terminal maturation along the granulocyte pathway. Both RAR 1 and
RAR 2 isoforms were detected in Gr-1+ cell populations
with the former appearing more abundant. Likewise, transcripts for both
RAR isoforms were also detected in differentiated granulocytes,
although only after extensive amplification. Although it remains to be
seen whether message abundance correlates directly with protein
levels,38 the functional assays described here are direct
indicators of the importance of RARs in hematopoietic cell
differentiation. Our data clearly show that, despite its low apparent
abundance, RAR must play a role in granulocyte differentiation, as
disruption of this gene, in combination with RAR 1 knockout, was
required to affect cell differentiation in vitro. However, analysis of
RAR 2 null mice, or studies of the impact of other RAR knockouts on
hematopoiesis, have not been reported. We cannot, therefore, exclude a
role for RAR 2 alone or in combination with other receptors, in this
process.
Tissue culture models and the phenotype of RAR single versus double
null mutants indicate specific, as well as overlapping, functions for
the RARs.3,39,40 In the present study, it would appear that
RAR 1 and RAR play redundant roles in granulocyte differentiation.
However, as discussed previously,12,13,39 we cannot exclude
that gene disruption itself evokes functional redundancy, which does
not ordinarily exist, and that granulopoiesis normally operates under
the control of a specific RAR type. Consistent with a degree of
functional specificity, we found that the differentiation block could
be relieved by RA, albeit at pharmacologic concentrations. This
suggests that RAR 2 can fulfill the role(s) of the disrupted receptors, but only in a situation of retinoid excess. It may be
possible to further address this possibility through the use of RAR
type-specific agonists or antagonists.12
In vivo, disruption of RAR 1 and/or RAR appeared to have
no observable consequence regarding granulocyte differentiation. One
possible mechanism to explain this observation is that granulocyte differentiation proceeds via non-cell autonomous cues that are supported by the intact RARs in nongranulocytic cells, which promote normal granulocyte differentiation. Once removed from this environment (in isolated culture conditions), this essential factor(s) is not
sufficiently expressed in the knockout granulocyte precursors, resulting in the observed differentiation block in vitro.
Alternatively, it is conceivable that the RAR chimeras associated
with APL may exert effects in addition to attenuation of retinoid
signaling, and that both mechanisms are required to elicit a
differentiaiton block in vivo. In support of the first possibility, we
provide evidence that high doses of RA in vitro overcome the maturation block in
RAR 1 /  / cells,
suggesting that granulocytic differentiation in the compound null mice
occurs in vivo through a compensation mechanism, which is non-cell
autonomous. These observations, however, do not rule out the
possibility that maturation arrest in APL may also be due to
contributions that are specific to the different RAR fusion partners.41-46
The lack of RAR 1 and RAR did not affect the distribution of the
different types of colonies (ie, multilineage and committed unilineage
colonies) despite the presence of both transcripts in committed
granulocyte and macrophage precursors. Because the distribution of
colony types is believed to reflect the process of lineage commitment
in vivo, it is most likely that RAR 1 and RAR do not drive early
decisional events in multipotent stem cells. In contrast, both genes
are essential for terminal granulocyte maturation in vitro, consistent
with their pattern of expression in Gr-1+ populations. Our
observations therefore suggest that in APL, the various translocations
involving RAR and the resulting dominant negative RAR mutants cause
differentiation arrest at the promyelocyte stage, when further
maturation and nuclear segmentation require signaling via both RAR 1
and .
An outstanding question remains the nature of retinoid target genes
that are important for terminal granulocyte maturation. A cell surface
marker, RIG-E, was recently identified as a downstream RAR target
through differential display analysis of RA-treated NB4 cells, a
promyelocytic leukemic cell line.47 RIG-E is a member of
the Ly-6 family of adhesion molecules that include Gr-136
and may be involved in neutrophil function. It is not presently clear,
however, whether RIG-E (or Gr-1) is a direct target of RAR function.
Recently, homeobox (hox) gene products have been implicated in several
hematopoietic differentiation pathways.48-50 Several
members of this gene family are direct RA targets40 and, in
some cases, exhibit RAR type-specific regulation in cell culture
models.13,39,40,51,52 Moreover, the skeletal defects inherent to the RAR and RAR 1/ knockout mice phenocopy certain of the defects seen in some Hox null mice10 (and references therein), further supporting a direct relationship. It is therefore possible that normal granulocyte differentiation occurs, in part, through retinoid-dependent regulation of certain Hox genes, a possibility we are currently addressing.
 |
FOOTNOTES |
Submitted December 22, 1997;
accepted March 13, 1998.
Supported by funds from the Cancer Research Society Inc (Montreal,
Quebec, Canada), the National Cancer Institute with funds from the
National Cancer Society of Canada, and a fellowship from the Leukemia
Research Fund (Toronto, Ontario, Canada; to J.L.). D.L. is a scholar of
the Medical Research Council of Canada and T.H. a senior scientist of
the Fonds de la Recherche en Santé du Québec.
Address reprint requests to Trang Hoang, PhD, Director, Laboratory of
Hemopoiesis and Leukemia, Clinical Research Institute of
Montréal, 110 Pine Ave West, Montréal, Quebec, Canada H2W 1R7.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.
 |
REFERENCES |
1.
Orkin SH:
Transcription factors and hematopoietic development.
J Biol Chem
270:4955,
1995[Free Full Text]
2.
Wolff L:
Contribution of oncogenes and tumor suppressor genes to myeloid leukemia.
Biochim Biophys Acta
1332:F67,
1997[Medline]
[Order article via Infotrieve]
3.
Lohnes D,
Mark M,
Mendelsohn C,
Dolle P,
Decimo D,
LeMeur M,
Dierich A,
Gorry P,
Chambon P:
Developmental roles of the retinoic acid receptors.
J Steroid Biochem Mol Biol
53:475,
1995[Medline]
[Order article via Infotrieve]
4.
Kastner P,
Mark M,
Chambon P:
Nonsteroid nuclear receptors: What are genetic studies telling us about their role in real life?
Cell
83:859,
1995[Medline]
[Order article via Infotrieve]
5.
Kastner P,
Mark M,
Ghyselinck N,
Krezel W,
Dupe V,
Grondona JM,
Chambon P:
Genetic evidence that the retinoid signal is transduced by heterodimeric RXR/RAR functional units during mouse development.
Development
124:313,
1997[Abstract]
6.
Mangelsdorf DJ,
Evans RM:
The RXR heterodimers and orphan receptors.
Cell
83:841,
1995[Medline]
[Order article via Infotrieve]
7.
Leid M,
Kastner P,
Durand B,
Krust A,
Leroy P,
Lyons R,
Mendelsohn C,
Nagpal S,
Nakshatri H,
Reibel C,
Saunders M,
Chambon P:
Retinoic acid signal transduction pathways.
Ann N Y Acad Sci
684:19,
1993[Medline]
[Order article via Infotrieve]
8.
Lufkin T,
Lohnes D,
Mark M,
Dierich A,
Gorry P,
Gaub MP,
LeMeur M,
Chambon P:
High postnatal lethality and testis degeneration in retinoic acid receptor alpha mutant mice.
Proc Natl Acad Sci USA
90:7225,
1993[Abstract/Free Full Text]
9.
Lohnes D,
Kastner P,
Dierich A,
Mark M,
LeMeur M,
Chambon P:
Function of retinoic acid receptor gamma in the mouse.
Cell
73:643,
1993[Medline]
[Order article via Infotrieve]
10.
Mendelsohn C,
Lohnes D,
Decimo D,
Lufkin T,
LeMeur M,
Chambon P,
Mark M:
Function of the retinoic acid receptors (RARs) during development (II). Multiple abnormalities at various stages of organogenesis in RAR double mutants.
Development
120:2749,
1994[Abstract]
11.
Lohnes D,
Mark M,
Mendelsohn C,
Dolle P,
Dierich A,
Gorry P,
Gansmuller A,
Chambon P:
Function of the retinoic acid receptors (RARs) during development (I). Craniofacial and skeletal abnormalities in RAR double mutants.
Development
120:2723,
1994[Abstract]
12.
Roy B,
Taneja R,
Chambon P:
Synergistic activation of retinoic acid (RA)-responsive genes and induction of embryonal carcinoma cell differentiation by an RA receptor alpha (RAR alpha)-, RAR beta-, or RAR gamma-selective ligand in combination with a retinoid X receptor-specific ligand.
Mol Cell Biol
15:6481,
1995[Abstract]
13.
Taneja R,
Roy B,
Plassat JL,
Zusi CF,
Ostrowski J,
Reczek PR,
Chambon P:
Cell-type and promoter-context dependent retinoic acid receptor (RAR) redundancies for RAR beta 2 and Hoxa-1 activation in F9 and P19 cells can be artefactually generated by gene knockouts.
Proc Natl Acad Sci USA
93:6197,
1996[Abstract/Free Full Text]
14.
Perlmann T,
Evans RM:
Nuclear receptors in Sicily: All in the famiglia.
Cell
90:391,
1997[Medline]
[Order article via Infotrieve]
15.
de The H,
Chomienne C,
Lanotte M,
Degos L,
Dejean A:
The t(15;17) translocation of acute promyelocytic leukaemia fuses the retinoic acid receptor alpha gene to a novel transcribed locus.
Nature
347:558,
1990[Medline]
[Order article via Infotrieve]
16.
Kakizuka A,
Miller WH Jr,
Umesono K,
Warrell RP Jr,
Frankel SR,
Murty VV,
Dmitrovsky E,
Evans RM:
Chromosomal translocation t(15;17) in human acute promyelocytic leukemia fuses RAR alpha with a novel putative transcription factor, PML.
Cell
66:663,
1991[Medline]
[Order article via Infotrieve]
17.
Alcalay M,
Zangrilli D,
Fagioli M,
Pandolfi PP,
Mencarelli A,
Lo Coco F,
Biondi A,
Grignani F,
Pelicci PG:
Expression pattern of the RAR alpha-PML fusion gene in acute promyelocytic leukemia.
Proc Natl Acad Sci USA
89:4840,
1992[Abstract/Free Full Text]
18.
Chen Z,
Chen SJ,
Tong JH,
Zhu YJ,
Huang ME,
Wang WC,
Wu Y,
Sun GL,
Wang ZY,
Larsen CJ,
Berger R:
The retinoic acid alpha receptor gene is frequently disrupted in its 5' part in Chinese patients with acute promyelocytic leukemia.
Leukemia
5:288,
1991[Medline]
[Order article via Infotrieve]
19.
Chen Z,
Brand NJ,
Chen A,
Chen SJ,
Tong JH,
Wang ZY,
Waxman S,
Zelent A:
Fusion between a novel Kruppel-like zinc finger gene and the retinoic acid receptor-alpha locus due to a variant t(11;17) translocation associated with acute promyelocytic leukaemia.
EMBO J
12:1161,
1993[Medline]
[Order article via Infotrieve]
20.
Redner RL,
Rush EA,
Faas S,
Rudert WA,
Corey SJ:
The t(5;17) variant of acute promyelocytic leukemia expresses a nucleophosmin-retinoic acid receptor fusion.
Blood
87:882,
1996[Abstract/Free Full Text]
21.
Huang ME,
Ye YC,
Chen SR,
Chai JR,
Lu JX,
Zhoa L,
Gu LJ,
Wang ZY:
Use of all-trans retinoic acid in the treatment of acute promyelocytic leukemia.
Blood
72:567,
1988[Abstract/Free Full Text]
22.
Warrell RP Jr,
Frankel SR,
Miller WH Jr,
Scheinberg DA,
Itri LM,
Hittelman WN,
Vyas R,
Andreeff M,
Tafuri A,
Jakubowski A,
Gabrilove J,
Gordon MS,
Dmitrovsky E:
Differentiation therapy of acute promyelocytic leukemia with tretinoin (all-trans-retinoic acid).
N Engl J Med
324:1385,
1991[Abstract]
23.
Castaigne S,
Chomienne C,
Daniel MT,
Ballerini P,
Berger R,
Fenaux P,
Degos L:
All-trans retinoic acid as a differentiation therapy for acute promyelocytic leukemia. I. Clinical results.
Blood
76:1704,
1990[Abstract/Free Full Text]
24.
Warrell RP Jr,
de The H,
Wang ZY,
Degos L:
Acute promyelocytic leukemia.
N Engl J Med
329:177,
1993[Free Full Text]
25.
Miyauchi J,
Ohyashiki K,
Inatomi Y,
Toyama K:
Neutrophil secondary-granule deficiency as a hallmark of all-trans retinoic acid-induced differentiation of acute promyelocytic leukemia cells.
Blood
90:803,
1997[Abstract/Free Full Text]
26.
de The H,
Lavau C,
Marchio A,
Chomienne C,
Degos L,
Dejean A:
The PML-RAR alpha fusion mRNA generated by the t(15;17) translocation in acute promyelocytic leukemia encodes a functionally altered RAR.
Cell
66:675,
1991[Medline]
[Order article via Infotrieve]
27.
Perez A,
Kastner P,
Sethi S,
Lutz Y,
Reibel C,
Chambon P:
PMLRAR homodimers: Distinct DNA binding properties and heteromeric interactions with RXR.
EMBO J
12:3171,
1993[Medline]
[Order article via Infotrieve]
28.
Chen Z,
Guidez F,
Rousselot P,
Agadir A,
Chen SJ,
Wang ZY,
Degos L,
Zelent A,
Waxman S,
Chomienne C:
PLZF-RAR alpha fusion proteins generated from the variant t(11; 17)(q23;q21) translocation in acute promyelocytic leukemia inhibit ligand-dependent transactivation of wild-type retinoic acid receptors.
Proc Natl Acad Sci USA
91:1178,
1994[Abstract/Free Full Text]
29.
Tsai S,
Collins SJ:
A dominant negative retinoic acid receptor blocks neutrophil differentiation at the promyelocyte stage.
Proc Natl Acad Sci USA
90:7153,
1993[Abstract/Free Full Text]
30.
Iulianella A,
Lohnes D:
Contribution of retinoic acid receptor gamma to retinoid-induced craniofacial and axial defects.
Dev Dyn
209:92,
1997[Medline]
[Order article via Infotrieve]
31.
Hoang T,
Iscove NN,
Odartchenko N:
Macromolecules stimulating human granulocytic colony-forming cells, precursors of these cells, and primitive erythroid progenitors: Some apparent nonidentities.
Blood
61:960,
1983[Abstract/Free Full Text]
32.
Hoang T,
Nara N,
Wong G,
Clark S,
Minden MD,
McCulloch EA:
Effects of recombinant GM-CSF on the blast cells of acute myeloblastic leukemia.
Blood
68:313,
1986[Abstract/Free Full Text]
33.
Hoang T,
Haman A,
Goncalves O,
Letendre F,
Mathieu M,
Wong GG,
Clark SC:
Interleukin 1 enhances growth factor-dependent proliferation of the clonogenic cells in acute myeloblastic leukemia and of normal human primitive hemopoietic precursors.
J Exp Med
168:463,
1988[Abstract/Free Full Text]
34.
Brady G,
Billia F,
Knox J,
Hoang T,
Kirsch IR,
Voura EB,
Hawley RG,
Cumming R,
Buchwald M,
Siminovitch K,
Miyamoto N,
Boehmelt G,
Iscove NN:
Analysis of gene expression in a complex differentiation hierarchy by global amplification of cDNA from single cells.
Curr Biol
5:909,
1995[Medline]
[Order article via Infotrieve]
35.
Hoang T,
Paradis E,
Brady G,
Billia F,
Nakahara K,
Iscove NN,
Kirsch IR:
Opposing effects of the basic helix-loop-helix transcription factor SCL on erythroid and monocytic differentiation.
Blood
87:102,
1996[Abstract/Free Full Text]
36.
Fleming TJ,
Fleming ML,
Malek TR:
Selective expression of Ly-6G on myeloid lineage cells in mouse bone marrow. RB6-8C5 mAb to granulocyte-differentiation antigen (Gr-1) detects members of the Ly-6 family.
J Immunol
151:2399,
1993[Abstract]
37.
Hestdal K,
Ruscetti FW,
Ihle JN,
Jacobsen SE,
Dubois CM,
Kopp WC,
Longo DL,
Keller JR:
Characterization and regulation of RB6-8C5 antigen expression on murine bone marrow cells.
J Immunol
147:22,
1991[Abstract]
38.
Zimmer A,
Zimmer AM,
Reynolds K:
Tissue specific expression of the retinoic acid receptor-beta 2: Regulation by short open reading frames in the 5'-noncoding region.
J Cell Biol
127:1111,
1994[Abstract/Free Full Text]
39.
Taneja R,
Bouillet P,
Boylan JF,
Gaub MP,
Roy B,
Gudas LJ,
Chambon P:
Reexpression of retinoic acid receptor (RAR) gamma or overexpression of RAR alpha or RAR beta in RAR gamma-null F9 cells reveals a partial functional redundancy between the three RAR types.
Proc Natl Acad Sci USA
92:7854,
1995[Abstract/Free Full Text]
40.
Boylan JF,
Lufkin T,
Achkar CC,
Taneja R,
Chambon P,
Gudas LJ:
Targeted disruption of retinoic acid receptor alpha (RAR alpha) and RAR gamma results in receptor-specific alterations in retinoic acid-mediated differentiation and retinoic acid metabolism.
Mol Cell Biol
15:843,
1995[Abstract]
41.
Ruthardt M,
Testa U,
Nervi C,
Ferrucci PF,
Grignani F,
Puccetti E,
Peschle C,
Pelicci PG:
Opposite effects of the acute promyelocytic leukemia PML-retinoic acid receptor alpha (RAR alpha) and PLZF-RAR alpha fusion proteins on retinoic acid signalling.
Mol Cell Biol
17:4859,
1997[Abstract]
42.
Dong S,
Zhu J,
Reid A,
Strutt P,
Guidez F,
Zhong HJ,
Wang ZY,
Licht J,
Waxman S,
Chomienne C,
:
Amino-terminal protein-protein interaction motif (POZ-domain) is responsible for activities of the promyelocytic leukemia zinc finger-retinoic acid receptor-alpha fusion protein.
Proc Natl Acad Sci USA
93:3624,
1996[Abstract/Free Full Text]
43.
Hong SH,
David G,
Wong CW,
Dejean A,
Privalsky ML:
SMRT corepressor interacts with PLZF and with the PML-retinoic acid receptor alpha (RARalpha) and PLZF-RARalpha oncoproteins associated with acute promyelocytic leukemia.
Proc Natl Acad Sci USA
94:9028,
1997[Abstract/Free Full Text]
44.
Koken MH,
Reid A,
Quignon F,
Chelbi-Alix MK,
Davies JM,
Kabarowski JH,
Zhu J,
Dong S,
Chen S,
Chen Z,
Tan CC,
Licht J,
Waxman S,
de The H,
Zelent A:
Leukemia-associated retinoic acid receptor alpha fusion partners, PML and PLZF, heterodimerize and colocalize to nuclear bodies.
Proc Natl Acad Sci USA
94:10255,
1997[Abstract/Free Full Text]
45.
Sitterlin D,
Tiollais P,
Transy C:
The RAR alpha-PLZF chimera associated with acute promyelocytic leukemia has retained a sequence-specific DNA-binding domain.
Oncogene
14:1067,
1997[Medline]
[Order article via Infotrieve]
46.
Li JY,
English MA,
Ball HJ,
Yeyati PL,
Waxman S,
Licht JD:
Sequence-specific DNA binding and transcriptional regulation by the promyelocytic leukemia zinc finger protein.
J Biol Chem
272:22447,
1997[Abstract/Free Full Text]
47.
Mao M,
Yu M,
Tong JH,
Ye J,
Zhu J,
Huang QH,
Fu G,
Yu L,
Zhao SY,
Waxman S,
Lanotte M,
Wang ZY,
Tan JZ,
Chan SJ,
Chen Z:
RIG-E, a human homolog of the murine Ly-6 family, is induced by retinoic acid during the differentiation of acute promyelocytic leukemia cell.
Proc Natl Acad Sci USA
93:5910,
1996[Abstract/Free Full Text]
48.
Sauvageau G,
Thorsteinsdottir U,
Eaves CJ,
Lawrence HJ,
Largman C,
Lansdorp PM,
Humphries RK:
Overexpression of HOXB4 in hematopoietic cells causes the selective expansion of more primitive populations in vitro and in vivo.
Genes Dev
9:1753,
1995[Abstract/Free Full Text]
49.
Thorsteinsdottir U,
Sauvageau G,
Hough MR,
Dragowska W,
Lansdorp PM,
Lawrence HJ,
Largman C,
Humphries RK:
Overexpression of HOXA10 in murine hematopoietic cells perturbs both myeloid and lymphoid differentiation and leads to acute myeloid leukemia.
Mol Cell Biol
17:495,
1997[Abstract]
50.
Lawrence HJ,
Helgason CD,
Sauvageau G,
Fong S,
Izon DJ,
Humphries RK,
Largman C:
Mice bearing a targeted interruption of the homeobox gene HOXA9 have defects in myeloid, erythroid, and lymphoid hematopoiesis.
Blood
89:1922,
1997[Abstract/Free Full Text]
51.
Chiba H,
Clifford J,
Metzger D,
Chambon P:
Distinct retinoid X receptor-retinoic acid receptor heterodimers are differentially involved in the control of expression of retinoid target genes in F9 embryonal carcinoma cells.
Mol Cell Biol
17:3013,
1997[Abstract]
52.
Boylan JF,
Lohnes D,
Taneja R,
Chambon P,
Gudas LJ:
Loss of retinoic acid receptor gamma function in F9 cells by gene disruption results in aberrant Hoxa-1 expression and differentiation upon retinoic acid treatment.
Proc Natl Acad Sci USA
90:9601,
1993[Abstract/Free Full Text]

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
S. Ueki, G. Mahemuti, H. Oyamada, H. Kato, J. Kihara, M. Tanabe, W. Ito, T. Chiba, M. Takeda, H. Kayaba, et al.
Retinoic Acids Are Potent Inhibitors of Spontaneous Human Eosinophil Apoptosis
J. Immunol.,
December 1, 2008;
181(11):
7689 - 7698.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Kim, H. H. Kim, J. H. Kim, Y. H. Choi, Y. H. Kim, and J. Cheong
Chemokine stromal cell-derived factor-1 induction by C/EBP{beta} activation is associated with all-trans-retinoic acid-induced leukemic cell differentiation
J. Leukoc. Biol.,
November 1, 2007;
82(5):
1332 - 1339.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Luo, A. Wang, K. J. Payne, H. Peng, J.-g. Wang, Y. K. Parrish, J. W. Rogerio, T. J. Triche, Q. He, and L. Wu
Intrinsic Retinoic Acid Receptor {alpha}-Cyclin-Dependent Kinase-Activating Kinase Signaling Involves Coordination of the Restricted Proliferation and Granulocytic Differentiation of Human Hematopoietic Stem Cells
Stem Cells,
October 1, 2007;
25(10):
2628 - 2637.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Ricote, C. S. Snyder, H.-Y. Leung, J. Chen, K. R. Chien, and C. K. Glass
Normal hematopoiesis after conditional targeting of RXR{alpha} in murine hematopoietic stem/progenitor cells
J. Leukoc. Biol.,
October 1, 2006;
80(4):
850 - 861.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. E. Purton, S. Dworkin, G. H. Olsen, C. R. Walkley, S. A. Fabb, S. J. Collins, and P. Chambon
RAR{gamma} is critical for maintaining a balance between hematopoietic stem cell self-renewal and differentiation
J. Exp. Med.,
May 15, 2006;
203(5):
1283 - 1293.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Szanto and L. Nagy
Retinoids Potentiate Peroxisome Proliferator-Activated Receptor {gamma} Action in Differentiation, Gene Expression, and Lipid Metabolic Processes in Developing Myeloid Cells
Mol. Pharmacol.,
June 1, 2005;
67(6):
1935 - 1943.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Tsuzuki, K. Kitajima, T. Nakano, A. Glasow, A. Zelent, and T. Enver
Cross Talk between Retinoic Acid Signaling and Transcription Factor GATA-2
Mol. Cell. Biol.,
August 1, 2004;
24(15):
6824 - 6836.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. R. Walkley, L. E. Purton, H. J. Snelling, Y.-D. Yuan, H. Nakajima, P. Chambon, R. A. S. Chandraratna, and G. A. McArthur
Identification of the molecular requirements for an RAR{alpha}-mediated cell cycle arrest during granulocytic differentiation
Blood,
February 15, 2004;
103(4):
1286 - 1295.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. T. Phan, D. B. Shultz, B.-T. H. Truong, T. J. Blake, A. L. Brown, T. J. Gonda, M. M. Le Beau, and S. C. Kogan
Cooperation of Cytokine Signaling with Chimeric Transcription Factors in Leukemogenesis: PML-Retinoic Acid Receptor Alpha Blocks Growth Factor-Mediated Differentiation
Mol. Cell. Biol.,
July 1, 2003;
23(13):
4573 - 4585.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Si and S. J. Collins
IL-3-induced enhancement of retinoic acid receptor activity is mediated through Stat5, which physically associates with retinoic acid receptors in an IL-3-dependent manner
Blood,
December 15, 2002;
100(13):
4401 - 4409.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. S. Johnson, L. Mueller, J. Si, and S. J. Collins
The cytokines IL-3 and GM-CSF regulate the transcriptional activity of retinoic acid receptors in different in vitro models of myeloid differentiation
Blood,
February 1, 2002;
99(3):
746 - 753.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. J. Collins, J. Ulmer, L. E. Purton, and G. Darlington
Multipotent hematopoietic cell lines derived from C/EBP{alpha}({-}/{-}) knockout mice display granulocyte macrophage-colony-stimulating factor, granulocyte- colony-stimulating factor, and retinoic acid-induced granulocytic differentiation
Blood,
October 15, 2001;
98(8):
2382 - 2388.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Kastner, H. J. Lawrence, C. Waltzinger, N. B. Ghyselinck, P. Chambon, and S. Chan
Positive and negative regulation of granulopoiesis by endogenous RAR{alpha}
Blood,
March 1, 2001;
97(5):
1314 - 1320.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. F. Ferrara, F. Fazi, A. Bianchini, F. Padula, V. Gelmetti, S. Minucci, M. Mancini, P. G. Pelicci, F. L. Coco, and C. Nervi
Histone Deacetylase-targeted Treatment Restores Retinoic Acid Signaling and Differentiation in Acute Myeloid Leukemia
Cancer Res.,
January 1, 2001;
61(1):
2 - 7.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
D. Grimwade, A. Biondi, M.-J. Mozziconacci, A. Hagemeijer, R. Berger, M. Neat, K. Howe, N. Dastugue, J. Jansen, I. Radford-Weiss, et al.
Characterization of acute promyelocytic leukemia cases lacking the classic t(15;17): results of the European Working Party
Blood,
August 15, 2000;
96(4):
1297 - 1308.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Kuwata, I-M. Wang, T. Tamura, R. M. Ponnamperuma, R. Levine, K. L. Holmes, H. C. Morse III, L. M. De Luca, and K. Ozato
Vitamin A deficiency in mice causes a systemic expansion of myeloid cells
Blood,
June 1, 2000;
95(11):
3349 - 3356.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. C. Kogan, S.-h. Hong, D. B. Shultz, M. L. Privalsky, and J. M. Bishop
Leukemia initiated by PMLRARalpha : the PML domain plays a critical role while retinoic acid-mediated transactivation is dispensable
Blood,
March 1, 2000;
95(5):
1541 - 1550.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. E. Purton, I. D. Bernstein, and S. J. Collins
All-trans retinoic acid enhances the long-term repopulating activity of cultured hematopoietic stem cells
Blood,
January 15, 2000;
95(2):
470 - 477.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Lallemand-Breitenbach, M.-C. Guillemin, A. Janin, M.-T. Daniel, L. Degos, S. C. Kogan, J. Michael Bishop, and H. de The
Retinoic Acid and Arsenic Synergize to Eradicate Leukemic Cells in a Mouse Model of Acute Promyelocytic Leukemia
J. Exp. Med.,
April 5, 1999;
189(7):
1043 - 1052.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|