SEARCH:   Advanced

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Rights and Permissions Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Labrecque, J. Articles by Hoang, T. Search for Related Content PubMed PubMed Citation Articles by Labrecque, J. Articles by Hoang, T. Related Collections Neoplasia Social Bookmarking                   What's this?  Previous Article  |  Table of Contents  |  Next Article  Blood, Vol. 92 No. 2 (July 15), 1998: pp. 607-615 Impaired Granulocytic Differentiation In Vitro in Hematopoietic Cells Lacking Retinoic Acid Receptors 1 and   By Jean Labrecque, Deborah Allan, Pierre Chambon, Norman N. Iscove, David Lohnes, and Trang Hoang From the Clinical Research Institute of Montréal, Montréal, Québec, Canada; the Departments of Pharmacology, Molecular Biology, and Biochemistry, Université de Montréal, Montréal, Québec, Canada; the Laboratoire de Génétique Moléculaire des Eukaryotes du CNRS, Strasbourg, France; and the Ontario Cancer Institute, Toronto, Ontario, Canada.     ABSTRACT Abstract Introduction Methods Results Discussion References Transcripts for the retinoic acid receptors (RARs) 1, 2, 1, and 2 were found in the granulocytic lineage (Gr-1+ cells) through semiquantitative polymerase chain reaction (PCR) analysis. The screening of single cell cDNA libraries derived from hematopoietic progenitors also showed the presence of RAR and, to a lesser extent, RAR transcripts in committed granulocyte (colony-forming unit-granulocyte [CFU-G]) or granulocyte-macrophage (CFU-GM) colony-forming cells. The contribution of RAR1 and to hematopoietic cell differentiation was therefore investigated in mice bearing targeted disruption of either one or both of these loci. Because RAR and RAR1 compound null mutants die shortly after birth, bone marrow cells were collected from fetuses at 18.5 days postcoitum (dpc) and evaluated for growth and differentiation in culture in the presence of Steel factor (SF), interleukin-3 (IL-3), and erythropoietin (Epo). The frequency of colony-forming cells from bone marrow populations derived from RAR1/ double null mice was not significantly different from that of RAR or RAR1 single nulls or from wild-type controls. In addition, the distribution of erythroid, granulocyte, and macrophage colonies was comparable between hematopoietic cells from all groups, suggesting that lineage commitment was not affected by the lack of RAR1 and/or RAR. Colony cells were then harvested individually and evaluated by morphologic criteria. While terminal granulocyte differentiation was evident in wild-type cells and colonies from either single null mutant, colonies derived from RAR1// bone marrow populations were blocked at the myelocyte and, to a lesser extent, at the metamyelocyte stages, whereas erythroid and macrophage differentiation was not affected. Together, these results indicate that both RAR1 and  are required for terminal maturation in the granulocytic lineage in vitro, but appear to be dispensable for the early stages of hematopoietic cell development. Our results raise the possibility that in acute promyelocytic leukemia (APL), the different RAR fusion proteins cause differentiation arrest at a stage when further maturation requires not only RAR, but also RAR. Finally, bone marrow cells appear to differentiate normally in vivo, suggesting an effective compensation mechanism in the RAR1/ double null mice.     INTRODUCTION Abstract Introduction Methods Results Discussion References THE GENERATION OF hematopoietic cells proceeds through complex yet discrete differentiation events that include an irreversible commitment step from a multipotent precursor, followed by terminal maturation events resulting in functional end cells (ie, granulocytes, monocytes, erythrocytes, platelets, and lymphocytes). There is increasing evidence that differentiation along a given pathway is driven by lineage-restricted transcription factors that act cell autonomously to activate a defined set of target genes, thus specifying cell types in normal hematopoiesis (reviewed by Orkin1). Leukemic cells, however, are arrested at specific stages of differentiation and leukemias have thus been classified into distinct subtypes according to their morphologic appearance. Several of the French-American-British (FAB) classification subtypes correlate with consistent chromosomal translocations, which frequently involve loci encoding transcription factors. Not surprisingly, these transcription factors are also often crucial for normal hematopoiesis (reviewed by Wolff2). Retinoids are essential regulators of complex differentiation processes (reviewed by Lohnes et al3). The retinoid signal is transduced by two families of nuclear receptors, the retinoic acid (RA) receptors (RAR, , and  and their isoforms) and the retinoid X receptors (RXR, , and ) (reviewed by Kastner4). RARs function as ligand-inducible transcription regulators by binding, together with an RXR partner,5 to specific cis-acting sequences (RA response elements; RAREs). RARs can be activated by both all-trans and 9-cis RA, whereas RXRs are activated only by 9-cis RA. RXRs are also essential heterodimeric partners for a number of other nuclear receptor signalling pathways.6,7 Targeted gene disruption has been used to evaluate the function of RAR types and isoforms in vivo. Mice deficient for RAR1, the major RAR isoform, and RAR2 are apparently unaffected.3,8,9 However, ablation of all RAR or  isoforms results in a low frequency of skeletal malformations, as well as a subset of defects related to postpartum vitamin A deficiency.3,8 In contrast to the relatively minor consequence of disruption of a single receptor, defects evoked by loss of various combinations of RARs recapitulate essentially all of the pathologies associated with congenital vitamin A deficiency, together with the appearance of malformations not previously seen in such dietary manipulation studies.3,10,11 Thus, gene targeting suggests some degree of functional redundancy between RARs5,12,13 (reviewed by Perlmann and Evans14). A role for RAR in hematopoiesis was first suggested by its locating at the breakpoint of several chromosomal translocations associated with acute promyelocytic leukemia (APL; M3 in the FAB classification). The predominant t(15;17) translocation and the variant t(11;17) and t(5;17) translocations result in the creation of PML-RAR, PLZF-RAR, and NPM-RAR chimeras, respectively.15-20 In APL, granulocytic differentiation is blocked at the promyelocyte stage. RA treatment in vivo relieves this block and favors terminal granulocyte differentiation in patients with the t(15;17) translocation,21-24 albeit resulting in the appearance of polymorphonuclear cells with abnormal granulations.25 Together, these observations indicate an important role for RAR in terminal granulocyte differentiation. Both PML-RAR and PLZF-RAR inhibit RA-dependent transactivation of wild-type RARs.26-28 Moreover, a dominant negative C-terminal truncated RAR (RAR 403) can also elicit differentiation arrest in the granulocytic lineage at the promyelocyte stage.29 These observations further suggest that attenuation of RAR signaling plays an important role in the pathogenesis of APL. Dominant negative mutants, however, can interfere with the function of all RAR types, and could conceivably affect other RXR-dependent pathways, such that the contribution of each RAR to hematopoiesis has not been clearly established. To directly address the role of RAR1 and RAR in hematopoietic cell differentiation, we evaluated the growth and differentiation potential of bone marrow cells from mice in which either one or both loci were inactivated.     MATERIALS AND METHODS Abstract Introduction Methods Results Discussion References Generation of RAR mutants.   The RAR1, RAR, and RAR1/ knockout animals used in these studies have been described previously.8-10 To generate wild-type and RAR null fetuses, the appropriate matings were established and females surveyed daily for a vaginal plug; noon of the day of plug was considered 0.5 dpc. Females were killed at 18.5 dpc, fetuses obtained by caesarean section, and genotype assigned by polymerase chain reaction (PCR) using placental DNA as previously described.30 Isolation of bone marrow cells and methylcellulose cultures.   Long bones and the sternum were freed of surrounding tissues and cut into small pieces. Bone marrow cells were isolated by repeated aspiration through a Pasteur pipette and bone particles eliminated through differential deposition in Iscove's medium (IMDM; GIBCO, Grand Island, NJ) supplemented with 10% fetal calf serum (FCS). Bone marrow cells were counted and either cytosmeared for evaluation by morphologic criteria or cultured in methylcellulose, as previously described.31-33 For methylcellulose cultures, 5 × 104 mononuclear cells were plated in 1 mL of IMDM supplemented with 10 % FCS, bovine serum albumin (20 mg/mL; Sigma, St Louis, MO), iron saturated transferrin (160 µg/mL; Sigma), recombinant murine SF, WEHI-3 conditioned medium (2.5%, as a source of IL-3) and recombinant human erythropoietin (hu Epo; 1 U/mL), and viscified with 1% methylcellulose (Fluka, Rokonka, NY). Colonies were scored on day 7 of culture with an inverted microscope as described.31 After counting, colonies were harvested individually and cells evaluated by morphologic criteria using Giemsa-stained cytosmears. Isolation of Gr-1+ cells.   Gr-1+ and Gr-1 cells were purified from wild-type adult mouse bone marrow by immunomagnetic selection. Briefly, after erythrocyte lysis by osmotic shock, nucleated bone marrow cells were depleted of B cells through incubation with magnetic beads coupled to a polyclonal goat antimouse antibody at a bead to cell ratio of 8. Negative cells were coated with human Ig (Sigma) in ice cold IMDM/10% FCS for 30 minutes to block Fc binding. The cells (5 × 106) were then labeled with purified Gr-1 (1 µg/100 µL) for 30 minutes, washed, followed by a second labeling with MAR18.5 (specific for rat  chains). After washing, the cells were resuspended in medium containing goat antimouse coupled magnetic beads as above. Both positive and negative cells were resorted twice to eliminate nonspecific cosedimenting cells and cell pellets (5 × 106) frozen for RNA extraction. Semiquantitative reverse transcription-PCR (RT-PCR) analysis.   RNA was purified from approximately 5 × 106 Gr-1+ or Gr-1 cells or from 100 µg of newborn mouse skin by Trizol extraction (GIBCO-BRL). Approximately 2 µg of RNA was reverse transcribed with 300 U of Moloney murine leukemia virus (MMLV) reverse transcriptase (GIBCO-BRL) using hexanucleotide primers under standard reaction conditions. One tenth (2 µL) of the first strand cDNA was then used as substrate for PCR amplification using primers specific for the transcripts of interest. Amplification reactions were terminated every second cycle from 25 to 35 cycles or after 50 cycles. Reaction products were resolved on a 1.5% agarose gel, transferred to Gene Screen plus membranes (DuPont) according to the manufacture's instructions, and hybridized with end-labeled oligonucleotides corresponding to internal sequences specific to each predicted PCR product. Oligonucleotides used for PCR were as follows; for amplification of RAR isoforms, the primer CCGGATGATTTGTCTTGACA was used in combination with either GTTGGGCTGACCACCCAACC or AGTGACCTGCAGACTTAGGC for amplification of RAR1 or RAR2, respectively; RAR transcripts (all isoforms) were amplified using the oligonucleotides ACATGAACCCTTGACCCCAAG and TTTAAACTAGATTCTGGTGG; RAR isoforms were amplified using the primer CTTCACAGGAGCTGACCCCAT and either AGCCTGGCCCAGTATGTAGG or ATCCCTTACCCCCCATGC for RAR1 or RAR2, respectively; -actin was amplified using the primers GAGGGCATACCCCTCGTAGAT and CAGAAGGATTCCTATGTGGGC. End-labeled oligonucleotides used for Southern blot analysis to confirm the fidelity of amplification were as follows; RAR isoforms, ATCGAGACCCAGAGCAGCAG; RAR isoforms, CCATCGAGACACAGA; RAR isoforms, CAGAGCACCAGCTCGGAGGA; -actin, AGAGAGGTATCCTGACC. Analysis of single cell cDNA.   3 murine RAR or  cDNA probes corresponding to sequences immediately upstream of the polyadenylation signal was generated by 3 rapid amplification of cDNA ends (RACE) using TTGGACACTCTAAGCGGA and TTGAGGACGACTCCTCGA as 5 primers for RAR and , respectively. The identity of the amplified product was confirmed by restriction analysis and by specific hybridization to internal oligonucleotides. Southern blots of single cell cDNA libraries identified to specific progenitors by sib analysis as detailed previously,34,35 were hybridized to the probes, exposed to a PhosphorImager screen, and quantitated.     RESULTS Abstract Introduction Methods Results Discussion References Gr-1 is a cell surface marker of the Ly-6 family of adhesion molecules and its expression is restricted to more differentiated granulocytes,36 whereas granulocyte precursors (colony-forming unit-granulocyte [CFU-G]) and other hematopoietic lineage precursors are Gr-1.37 Because of differentiation arrest at the promyelocyte stage in APL and its association with expression of dominant negative RAR chimeras, we chose to study RAR gene expression in bone marrow populations separated on the basis of Gr-1 expression. After cell sorting, the purity of the Gr-1+ population was confirmed through morphologic examination of cytosmears and was found to consist of 97% differentiated granulocytes (metamyelocytes, bands and polymorphonuclear [PMN]) and 1.5% myelocytes. Myeloblasts and promyelocytes were found in the Gr-1 population, together with cells of all other lineages. RT-PCR analysis of Gr-1+ and Gr-1 cells indicated that the RAR1 message was present in both cell populations, although Gr-1 cells appeared to express much less of this transcript compared with the Gr-1+ pool (Fig 1). In contrast, RAR2 transcripts were undetectable in Gr-1 cells under conditions where it was readily observed in Gr-1+ isolates. Transcripts encoding RAR isoforms were undetectable after 35 cycles of PCR, irrespective of Gr-1 status. However, RAR2 transcripts were detected in Gr-1+, and to a lesser extent in Gr-1, cells after 50 cycles of amplification. RAR1 transcripts were barely detectable in the former cell population and were undetectable in Gr-1 cells. RAR transcripts were not detectable in either cell population despite extensive PCR amplification (data not shown). Thus, RAR1 appears to be the major RAR transcript in Gr-1+ cells, while RAR2, RAR1 and RAR2 are much less abundant. In contrast, only RAR1 and 2 were detected at low levels in GR-1 cells. Similar results were observed with cells that were sorted by flow cytometry, suggesting that these low levels of RAR1 and RAR2 in GR-1 cells were not due to contaminating Gr-1+ cells (data not shown). View larger version (29K): [in this window] [in a new window]   Fig 1. Semiquantitative PCR analysis of RAR expression in differentiated granulocytes (Gr-1+) and other cell types (Gr-1). Cells were separated as described in Materials and Methods. The PCR reaction was performed for 25 to 35 cycles for RAR1 and RAR2 and 50 cycles for RAR and RAR. Shown is a Southern blot analysis of the PCR product hybridized with an internal oligonucleotide probe specific for each amplification product, as described in Materials and Methods. To further address the possibility of RAR expression in a rare subpopulation of GR-1cells, we derived probes from the 3untranslated region (UTR) of RAR and RAR cDNAs for the screening of single cell cDNAs from hematopoietic precursors that were identified through sib analysis as detailed previously.34 Previous studies have validated these sample sets through hybrization with a ribosomal L32 probe, which showed a uniform level in all cDNA libraries.34 In contrast, RAR and RAR expression was observed mainly in myeloid cells, with highest levels in maturing cell populations, specifically in all macrophage populations from fetal liver and in two of five B-cell populations from fetal liver grown in the presence of colony-stimulating factor (CSF)-1 and/or IL-7, respectively (Fig 2). In contrast, hybridization to cDNA samples from adult macrophages, shown previously to be highly positive for c-fms and lysozyme,34 was not observed. In this sample set, the cDNA libraries obtained from maturing granulocytes were not sufficiently representative34 for accurate assessment of RAR expression. Strikingly, both RAR and RAR transcripts in hematopoietic progenitors were mostly confined to committed CFU-G and CFU-GM. This pattern of expression is in marked contrast to that previously reported for the hematopoietic transcription factors, SCL and GATA-1, which are coexpressed in multipotent progenitors and committed erythroid progenitors.35 Consistent with RT-PCR analysis, hybridization signals for RAR were much stronger than for RAR, again suggesting that RAR is the major RAR transcript in hematopoietic progenitors. RAR expression was not analyzed. View larger version (26K): [in this window] [in a new window]   View larger version (24K): [in this window] [in a new window]   Fig 2. Quantitation of relative RAR and RAR transcript levels in cDNA samples from diverse differentiation stages of the hematopoietic hierarchy. Southern blots of cDNA samples from the different cell types as shown were sequentially hybridized with probes for RAR and , and exposed to a PhosphorImage screen for quantitation. Given the above patterns of expression for RAR and RAR messages, we analyzed the role of RAR1 and RAR in hematopoietic cell differentiation through the study of the corresponding single or double knockout mice. Because bone marrow cells may be affected by developmental deficiencies in the bone mass itself, we compared the carcasses from RAR null mutants, heterozygote littermates, or wild-type controls. There was no significant difference in bone weight or in the number of bone marrow cells recovered, indicating that hematopoietic cell development within the bone marrow is not grossly affected (data not shown). Similarly, there was no detectable difference in cell type or lineage distribution in bone marrow populations elicited by receptor knockout, as judged by analysis of cytospins from either wild-type, RAR1, and/or RAR null mice (data not shown). Consistent with the normal distribution of bone marrow cell populations, quantitative assessment by methylcellulose culture indicated that the frequency of colony-forming cells from bone marrow isolates did not differ significantly between wild-type controls and RAR1, RAR, or RAR1/ null mutants or heterozygous littermates (Fig 3, right panel). Moreover, the distribution of multilineage and unilineage colony-forming cells was comparable between all genotypes (Fig 3, left panel, data shown for wild-type and compound null mutants). Together, these observations suggest that the lack of either or both RAR1 and RAR does not affect the generation of committed precursors per se, which may be taken as an indication of lineage commitment in vivo. View larger version (16K): [in this window] [in a new window]   Fig 3. Distribution of the different types of colonies in methylcellulose cultures of bone marrow cells from compound RAR1// null mice and littermate or wild-type controls. Colonies were scored on day 7 and the results expressed as percent total colony count (left panel). Total number of nucleated bone marrow cells recovered from the long bones of RAR1// mice and wild-type controls or heterozygous littermates. There was no significant difference among the four groups (right panel). Maturation along the granulocytic and monocytic lineages was further examined in cytospins from individual colonies isolated from methylcellulose cultures. Terminal maturation into bands or polymorphonuclear granulocytes was evident in wild-type colonies (Fig 4). Similarly, terminal granulocyte differentiation, as judged by nuclear segmentation, was normal in RAR/ or RAR1/ cells. In contrast, granulocyte differentiation was largely arrested at the myelocyte stage in RAR1// cells. When the proportion of differentiated granulocytes (metamyelocytes, bands, and PMN) was compiled as percent total cells in the granulocytic lineage, including myeloblasts and promyelocytes, a significant difference between the RAR1// group and wild-type controls was observed (P < .05) (Fig 5). In contrast, RAR1/ or RAR1/+/- littermates were not significantly different from wild-types. The phenotype of RAR/ isolates, although not statistically different from wild-type, exhibited a higher degree of variability with some highly differentiated and some less differentiated colonies. In contrast to the maturation arrest in the granulotype lineage, the proportion of macrophages per colony was comparable between all genotypes (Fig 6). Finally, there was no correlation between the percentage of monocytes/macrophages and the degree of granulocytic differentiation observed. Together, our observations suggest that the lack of RAR1 and RAR significantly impaired granulocytic differentiation in vitro without affecting macrophage or erythroid differentiation. View larger version (74K): [in this window] [in a new window]   Fig 4. Light microscopic photographs of colony cells harvested from individual granulocyte macrophage colonies. Colony cells were cytosmeared and stained with Wright-Giemsa. Genotypes are shown underneath. View larger version (12K): [in this window] [in a new window]   Fig 5. Granulocyte differentiation in methylcellulose culture. GM colonies were harvested individually and stained as in Fig 4. Results are shown as percent differentiated granulocytes (metamyelocytes, bands, and PMN) within the granulocytic lineage. The difference between wild-type controls and RAR1// was significantly different (P < .05), whereas the difference with other groups was not significant. View larger version (11K): [in this window] [in a new window]   Fig 6. Macrophage differentiation in methylcellulose culture. The macrophage content of each GM colony is shown as a percentage of total cells. There was no significant difference among the various groups. To determine whether the in vitro differentiation block could be relieved by excess retinoids, bone marrow cells from RAR1// mice were plated in the presence of RA at two different concentrations (Fig 7). Analysis of individual granulocyte macrophage colonies indicate that pharmacologic concentrations of RA overcame the maturation block imposed by the lack of RAR1 and . View larger version (30K): [in this window] [in a new window]   Fig 7. Pharmacologic doses of RA overcome the maturation block in granulopoietic cells lacking RAR1 and RAR. Bone marrow cells from RAR1// mice were plated in methycellulose cultures in the presence or in the absence of RA at the indicated concentrations. GM colonies were harvested individually and stained as in Fig 4. Results shown are the average of differential counts of 30 independent colonies in the control group, three colonies for the lower concentration of RA (108 mol/L) and 15 colonies for the higher concentration of RA (107 mol/L) and are expressed as percent total cells within the granulocytic lineage.     DISCUSSION Abstract Introduction Methods Results Discussion References Results from semiquantitative PCR and expression analysis of representative cDNAs from clonal hematopoietic isolates are consistent with our finding of a role for RAR1, together with RAR, in terminal maturation along the granulocyte pathway. Both RAR1 and RAR2 isoforms were detected in Gr-1+ cell populations with the former appearing more abundant. Likewise, transcripts for both RAR isoforms were also detected in differentiated granulocytes, although only after extensive amplification. Although it remains to be seen whether message abundance correlates directly with protein levels,38 the functional assays described here are direct indicators of the importance of RARs in hematopoietic cell differentiation. Our data clearly show that, despite its low apparent abundance, RAR must play a role in granulocyte differentiation, as disruption of this gene, in combination with RAR1 knockout, was required to affect cell differentiation in vitro. However, analysis of RAR2 null mice, or studies of the impact of other RAR knockouts on hematopoiesis, have not been reported. We cannot, therefore, exclude a role for RAR2 alone or in combination with other receptors, in this process. Tissue culture models and the phenotype of RAR single versus double null mutants indicate specific, as well as overlapping, functions for the RARs.3,39,40 In the present study, it would appear that RAR1 and RAR play redundant roles in granulocyte differentiation. However, as discussed previously,12,13,39 we cannot exclude that gene disruption itself evokes functional redundancy, which does not ordinarily exist, and that granulopoiesis normally operates under the control of a specific RAR type. Consistent with a degree of functional specificity, we found that the differentiation block could be relieved by RA, albeit at pharmacologic concentrations. This suggests that RAR2 can fulfill the role(s) of the disrupted receptors, but only in a situation of retinoid excess. It may be possible to further address this possibility through the use of RAR type-specific agonists or antagonists.12 In vivo, disruption of RAR1 and/or RAR appeared to have no observable consequence regarding granulocyte differentiation. One possible mechanism to explain this observation is that granulocyte differentiation proceeds via non-cell autonomous cues that are supported by the intact RARs in nongranulocytic cells, which promote normal granulocyte differentiation. Once removed from this environment (in isolated culture conditions), this essential factor(s) is not sufficiently expressed in the knockout granulocyte precursors, resulting in the observed differentiation block in vitro. Alternatively, it is conceivable that the RAR chimeras associated with APL may exert effects in addition to attenuation of retinoid signaling, and that both mechanisms are required to elicit a differentiaiton block in vivo. In support of the first possibility, we provide evidence that high doses of RA in vitro overcome the maturation block in RAR1// cells, suggesting that granulocytic differentiation in the compound null mice occurs in vivo through a compensation mechanism, which is non-cell autonomous. These observations, however, do not rule out the possibility that maturation arrest in APL may also be due to contributions that are specific to the different RAR fusion partners.41-46 The lack of RAR1 and RAR did not affect the distribution of the different types of colonies (ie, multilineage and committed unilineage colonies) despite the presence of both transcripts in committed granulocyte and macrophage precursors. Because the distribution of colony types is believed to reflect the process of lineage commitment in vivo, it is most likely that RAR1 and RAR do not drive early decisional events in multipotent stem cells. In contrast, both genes are essential for terminal granulocyte maturation in vitro, consistent with their pattern of expression in Gr-1+ populations. Our observations therefore suggest that in APL, the various translocations involving RAR and the resulting dominant negative RAR mutants cause differentiation arrest at the promyelocyte stage, when further maturation and nuclear segmentation require signaling via both RAR1 and . An outstanding question remains the nature of retinoid target genes that are important for terminal granulocyte maturation. A cell surface marker, RIG-E, was recently identified as a downstream RAR target through differential display analysis of RA-treated NB4 cells, a promyelocytic leukemic cell line.47 RIG-E is a member of the Ly-6 family of adhesion molecules that include Gr-136 and may be involved in neutrophil function. It is not presently clear, however, whether RIG-E (or Gr-1) is a direct target of RAR function. Recently, homeobox (hox) gene products have been implicated in several hematopoietic differentiation pathways.48-50 Several members of this gene family are direct RA targets40 and, in some cases, exhibit RAR type-specific regulation in cell culture models.13,39,40,51,52 Moreover, the skeletal defects inherent to the RAR and RAR1/ knockout mice phenocopy certain of the defects seen in some Hox null mice10 (and references therein), further supporting a direct relationship. It is therefore possible that normal granulocyte differentiation occurs, in part, through retinoid-dependent regulation of certain Hox genes, a possibility we are currently addressing.     FOOTNOTES    Submitted December 22, 1997; accepted March 13, 1998.    Supported by funds from the Cancer Research Society Inc (Montreal, Quebec, Canada), the National Cancer Institute with funds from the National Cancer Society of Canada, and a fellowship from the Leukemia Research Fund (Toronto, Ontario, Canada; to J.L.). D.L. is a scholar of the Medical Research Council of Canada and T.H. a senior scientist of the Fonds de la Recherche en Santé du Québec.    Address reprint requests to Trang Hoang, PhD, Director, Laboratory of Hemopoiesis and Leukemia, Clinical Research Institute of Montréal, 110 Pine Ave West, Montréal, Quebec, Canada H2W 1R7.    The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.     REFERENCES Abstract Introduction Methods Results Discussion References 1. Orkin SH: Transcription factors and hematopoietic development. J Biol Chem 270:4955, 1995[Free Full Text] 2. Wolff L: Contribution of oncogenes and tumor suppressor genes to myeloid leukemia. Biochim Biophys Acta 1332:F67, 1997[Medline] [Order article via Infotrieve] 3. Lohnes D, Mark M, Mendelsohn C, Dolle P, Decimo D, LeMeur M, Dierich A, Gorry P, Chambon P: Developmental roles of the retinoic acid receptors. J Steroid Biochem Mol Biol 53:475, 1995[Medline] [Order article via Infotrieve] 4. Kastner P, Mark M, Chambon P: Nonsteroid nuclear receptors: What are genetic studies telling us about their role in real life? Cell 83:859, 1995[Medline] [Order article via Infotrieve] 5. Kastner P, Mark M, Ghyselinck N, Krezel W, Dupe V, Grondona JM, Chambon P: Genetic evidence that the retinoid signal is transduced by heterodimeric RXR/RAR functional units during mouse development. Development 124:313, 1997[Abstract] 6. Mangelsdorf DJ, Evans RM: The RXR heterodimers and orphan receptors. Cell 83:841, 1995[Medline] [Order article via Infotrieve] 7. Leid M, Kastner P, Durand B, Krust A, Leroy P, Lyons R, Mendelsohn C, Nagpal S, Nakshatri H, Reibel C, Saunders M, Chambon P: Retinoic acid signal transduction pathways. Ann N Y Acad Sci 684:19, 1993[Medline] [Order article via Infotrieve] 8. Lufkin T, Lohnes D, Mark M, Dierich A, Gorry P, Gaub MP, LeMeur M, Chambon P: High postnatal lethality and testis degeneration in retinoic acid receptor alpha mutant mice. Proc Natl Acad Sci USA 90:7225, 1993[Abstract/Free Full Text] 9. Lohnes D, Kastner P, Dierich A, Mark M, LeMeur M, Chambon P: Function of retinoic acid receptor gamma in the mouse. Cell 73:643, 1993[Medline] [Order article via Infotrieve] 10. Mendelsohn C, Lohnes D, Decimo D, Lufkin T, LeMeur M, Chambon P, Mark M: Function of the retinoic acid receptors (RARs) during development (II). Multiple abnormalities at various stages of organogenesis in RAR double mutants. Development 120:2749, 1994[Abstract] 11. Lohnes D, Mark M, Mendelsohn C, Dolle P, Dierich A, Gorry P, Gansmuller A, Chambon P: Function of the retinoic acid receptors (RARs) during development (I). Craniofacial and skeletal abnormalities in RAR double mutants. Development 120:2723, 1994[Abstract] 12. Roy B, Taneja R, Chambon P: Synergistic activation of retinoic acid (RA)-responsive genes and induction of embryonal carcinoma cell differentiation by an RA receptor alpha (RAR alpha)-, RAR beta-, or RAR gamma-selective ligand in combination with a retinoid X receptor-specific ligand. Mol Cell Biol 15:6481, 1995[Abstract] 13. Taneja R, Roy B, Plassat JL, Zusi CF, Ostrowski J, Reczek PR, Chambon P: Cell-type and promoter-context dependent retinoic acid receptor (RAR) redundancies for RAR beta 2 and Hoxa-1 activation in F9 and P19 cells can be artefactually generated by gene knockouts. Proc Natl Acad Sci USA 93:6197, 1996[Abstract/Free Full Text] 14. Perlmann T, Evans RM: Nuclear receptors in Sicily: All in the famiglia. Cell 90:391, 1997[Medline] [Order article via Infotrieve] 15. de The H, Chomienne C, Lanotte M, Degos L, Dejean A: The t(15;17) translocation of acute promyelocytic leukaemia fuses the retinoic acid receptor alpha gene to a novel transcribed locus. Nature 347:558, 1990[Medline] [Order article via Infotrieve] 16. Kakizuka A, Miller WH Jr, Umesono K, Warrell RP Jr, Frankel SR, Murty VV, Dmitrovsky E, Evans RM: Chromosomal translocation t(15;17) in human acute promyelocytic leukemia fuses RAR alpha with a novel putative transcription factor, PML. Cell 66:663, 1991[Medline] [Order article via Infotrieve] 17. Alcalay M, Zangrilli D, Fagioli M, Pandolfi PP, Mencarelli A, Lo Coco F, Biondi A, Grignani F, Pelicci PG: Expression pattern of the RAR alpha-PML fusion gene in acute promyelocytic leukemia. Proc Natl Acad Sci USA 89:4840, 1992[Abstract/Free Full Text] 18. Chen Z, Chen SJ, Tong JH, Zhu YJ, Huang ME, Wang WC, Wu Y, Sun GL, Wang ZY, Larsen CJ, Berger R: The retinoic acid alpha receptor gene is frequently disrupted in its 5' part in Chinese patients with acute promyelocytic leukemia. Leukemia 5:288, 1991[Medline] [Order article via Infotrieve] 19. Chen Z, Brand NJ, Chen A, Chen SJ, Tong JH, Wang ZY, Waxman S, Zelent A: Fusion between a novel Kruppel-like zinc finger gene and the retinoic acid receptor-alpha locus due to a variant t(11;17) translocation associated with acute promyelocytic leukaemia. EMBO J 12:1161, 1993[Medline] [Order article via Infotrieve] 20. Redner RL, Rush EA, Faas S, Rudert WA, Corey SJ: The t(5;17) variant of acute promyelocytic leukemia expresses a nucleophosmin-retinoic acid receptor fusion. Blood 87:882, 1996[Abstract/Free Full Text] 21. Huang ME, Ye YC, Chen SR, Chai JR, Lu JX, Zhoa L, Gu LJ, Wang ZY: Use of all-trans retinoic acid in the treatment of acute promyelocytic leukemia. Blood 72:567, 1988[Abstract/Free Full Text] 22. Warrell RP Jr, Frankel SR, Miller WH Jr, Scheinberg DA, Itri LM, Hittelman WN, Vyas R, Andreeff M, Tafuri A, Jakubowski A, Gabrilove J, Gordon MS, Dmitrovsky E: Differentiation therapy of acute promyelocytic leukemia with tretinoin (all-trans-retinoic acid). N Engl J Med 324:1385, 1991[Abstract] 23. Castaigne S, Chomienne C, Daniel MT, Ballerini P, Berger R, Fenaux P, Degos L: All-trans retinoic acid as a differentiation therapy for acute promyelocytic leukemia. I. Clinical results. Blood 76:1704, 1990[Abstract/Free Full Text] 24. Warrell RP Jr, de The H, Wang ZY, Degos L: Acute promyelocytic leukemia. N Engl J Med 329:177, 1993[Free Full Text] 25. Miyauchi J, Ohyashiki K, Inatomi Y, Toyama K: Neutrophil secondary-granule deficiency as a hallmark of all-trans retinoic acid-induced differentiation of acute promyelocytic leukemia cells. Blood 90:803, 1997[Abstract/Free Full Text] 26. de The H, Lavau C, Marchio A, Chomienne C, Degos L, Dejean A: The PML-RAR alpha fusion mRNA generated by the t(15;17) translocation in acute promyelocytic leukemia encodes a functionally altered RAR. Cell 66:675, 1991[Medline] [Order article via Infotrieve] 27. Perez A, Kastner P, Sethi S, Lutz Y, Reibel C, Chambon P: PMLRAR homodimers: Distinct DNA binding properties and heteromeric interactions with RXR. EMBO J 12:3171, 1993[Medline] [Order article via Infotrieve] 28. Chen Z, Guidez F, Rousselot P, Agadir A, Chen SJ, Wang ZY, Degos L, Zelent A, Waxman S, Chomienne C: PLZF-RAR alpha fusion proteins generated from the variant t(11; 17)(q23;q21) translocation in acute promyelocytic leukemia inhibit ligand-dependent transactivation of wild-type retinoic acid receptors. Proc Natl Acad Sci USA 91:1178, 1994[Abstract/Free Full Text] 29. Tsai S, Collins SJ: A dominant negative retinoic acid receptor blocks neutrophil differentiation at the promyelocyte stage. Proc Natl Acad Sci USA 90:7153, 1993[Abstract/Free Full Text] 30. Iulianella A, Lohnes D: Contribution of retinoic acid receptor gamma to retinoid-induced craniofacial and axial defects. Dev Dyn 209:92, 1997[Medline] [Order article via Infotrieve] 31. Hoang T, Iscove NN, Odartchenko N: Macromolecules stimulating human granulocytic colony-forming cells, precursors of these cells, and primitive erythroid progenitors: Some apparent nonidentities. Blood 61:960, 1983[Abstract/Free Full Text] 32. Hoang T, Nara N, Wong G, Clark S, Minden MD, McCulloch EA: Effects of recombinant GM-CSF on the blast cells of acute myeloblastic leukemia. Blood 68:313, 1986[Abstract/Free Full Text] 33. Hoang T, Haman A, Goncalves O, Letendre F, Mathieu M, Wong GG, Clark SC: Interleukin 1 enhances growth factor-dependent proliferation of the clonogenic cells in acute myeloblastic leukemia and of normal human primitive hemopoietic precursors. J Exp Med 168:463, 1988[Abstract/Free Full Text] 34. Brady G, Billia F, Knox J, Hoang T, Kirsch IR, Voura EB, Hawley RG, Cumming R, Buchwald M, Siminovitch K, Miyamoto N, Boehmelt G, Iscove NN: Analysis of gene expression in a complex differentiation hierarchy by global amplification of cDNA from single cells. Curr Biol 5:909, 1995[Medline] [Order article via Infotrieve] 35. Hoang T, Paradis E, Brady G, Billia F, Nakahara K, Iscove NN, Kirsch IR: Opposing effects of the basic helix-loop-helix transcription factor SCL on erythroid and monocytic differentiation. Blood 87:102, 1996[Abstract/Free Full Text] 36. Fleming TJ, Fleming ML, Malek TR: Selective expression of Ly-6G on myeloid lineage cells in mouse bone marrow. RB6-8C5 mAb to granulocyte-differentiation antigen (Gr-1) detects members of the Ly-6 family. J Immunol 151:2399, 1993[Abstract] 37. Hestdal K, Ruscetti FW, Ihle JN, Jacobsen SE, Dubois CM, Kopp WC, Longo DL, Keller JR: Characterization and regulation of RB6-8C5 antigen expression on murine bone marrow cells. J Immunol 147:22, 1991[Abstract] 38. Zimmer A, Zimmer AM, Reynolds K: Tissue specific expression of the retinoic acid receptor-beta 2: Regulation by short open reading frames in the 5'-noncoding region. J Cell Biol 127:1111, 1994[Abstract/Free Full Text] 39. Taneja R, Bouillet P, Boylan JF, Gaub MP, Roy B, Gudas LJ, Chambon P: Reexpression of retinoic acid receptor (RAR) gamma or overexpression of RAR alpha or RAR beta in RAR gamma-null F9 cells reveals a partial functional redundancy between the three RAR types. Proc Natl Acad Sci USA 92:7854, 1995[Abstract/Free Full Text] 40. Boylan JF, Lufkin T, Achkar CC, Taneja R, Chambon P, Gudas LJ: Targeted disruption of retinoic acid receptor alpha (RAR alpha) and RAR gamma results in receptor-specific alterations in retinoic acid-mediated differentiation and retinoic acid metabolism. Mol Cell Biol 15:843, 1995[Abstract] 41. Ruthardt M, Testa U, Nervi C, Ferrucci PF, Grignani F, Puccetti E, Peschle C, Pelicci PG: Opposite effects of the acute promyelocytic leukemia PML-retinoic acid receptor alpha (RAR alpha) and PLZF-RAR alpha fusion proteins on retinoic acid signalling. Mol Cell Biol 17:4859, 1997[Abstract] 42. Dong S, Zhu J, Reid A, Strutt P, Guidez F, Zhong HJ, Wang ZY, Licht J, Waxman S, Chomienne C, : Amino-terminal protein-protein interaction motif (POZ-domain) is responsible for activities of the promyelocytic leukemia zinc finger-retinoic acid receptor-alpha fusion protein. Proc Natl Acad Sci USA 93:3624, 1996[Abstract/Free Full Text] 43. Hong SH, David G, Wong CW, Dejean A, Privalsky ML: SMRT corepressor interacts with PLZF and with the PML-retinoic acid receptor alpha (RARalpha) and PLZF-RARalpha oncoproteins associated with acute promyelocytic leukemia. Proc Natl Acad Sci USA 94:9028, 1997[Abstract/Free Full Text] 44. Koken MH, Reid A, Quignon F, Chelbi-Alix MK, Davies JM, Kabarowski JH, Zhu J, Dong S, Chen S, Chen Z, Tan CC, Licht J, Waxman S, de The H, Zelent A: Leukemia-associated retinoic acid receptor alpha fusion partners, PML and PLZF, heterodimerize and colocalize to nuclear bodies. Proc Natl Acad Sci USA 94:10255, 1997[Abstract/Free Full Text] 45. Sitterlin D, Tiollais P, Transy C: The RAR alpha-PLZF chimera associated with acute promyelocytic leukemia has retained a sequence-specific DNA-binding domain. Oncogene 14:1067, 1997[Medline] [Order article via Infotrieve] 46. Li JY, English MA, Ball HJ, Yeyati PL, Waxman S, Licht JD: Sequence-specific DNA binding and transcriptional regulation by the promyelocytic leukemia zinc finger protein. J Biol Chem 272:22447, 1997[Abstract/Free Full Text] 47. Mao M, Yu M, Tong JH, Ye J, Zhu J, Huang QH, Fu G, Yu L, Zhao SY, Waxman S, Lanotte M, Wang ZY, Tan JZ, Chan SJ, Chen Z: RIG-E, a human homolog of the murine Ly-6 family, is induced by retinoic acid during the differentiation of acute promyelocytic leukemia cell. Proc Natl Acad Sci USA 93:5910, 1996[Abstract/Free Full Text] 48. Sauvageau G, Thorsteinsdottir U, Eaves CJ, Lawrence HJ, Largman C, Lansdorp PM, Humphries RK: Overexpression of HOXB4 in hematopoietic cells causes the selective expansion of more primitive populations in vitro and in vivo. Genes Dev 9:1753, 1995[Abstract/Free Full Text] 49. Thorsteinsdottir U, Sauvageau G, Hough MR, Dragowska W, Lansdorp PM, Lawrence HJ, Largman C, Humphries RK: Overexpression of HOXA10 in murine hematopoietic cells perturbs both myeloid and lymphoid differentiation and leads to acute myeloid leukemia. Mol Cell Biol 17:495, 1997[Abstract] 50. Lawrence HJ, Helgason CD, Sauvageau G, Fong S, Izon DJ, Humphries RK, Largman C: Mice bearing a targeted interruption of the homeobox gene HOXA9 have defects in myeloid, erythroid, and lymphoid hematopoiesis. Blood 89:1922, 1997[Abstract/Free Full Text] 51. Chiba H, Clifford J, Metzger D, Chambon P: Distinct retinoid X receptor-retinoic acid receptor heterodimers are differentially involved in the control of expression of retinoid target genes in F9 embryonal carcinoma cells. Mol Cell Biol 17:3013, 1997[Abstract] 52. Boylan JF, Lohnes D, Taneja R, Chambon P, Gudas LJ: Loss of retinoic acid receptor gamma function in F9 cells by gene disruption results in aberrant Hoxa-1 expression and differentiation upon retinoic acid treatment. Proc Natl Acad Sci USA 90:9601, 1993[Abstract/Free Full Text] © 1998 by the American Society of Hematology.   0006-4971/98/92-0008$3.00/0 CiteULike    Connotea    Del.icio.us    Digg    Reddit    Technorati    What's this? This article has been cited by other articles: S. Ueki, G. Mahemuti, H. Oyamada, H. Kato, J. Kihara, M. Tanabe, W. Ito, T. Chiba, M. Takeda, H. Kayaba, et al. Retinoic Acids Are Potent Inhibitors of Spontaneous Human Eosinophil Apoptosis J. Immunol., December 1, 2008; 181(11): 7689 - 7698. [Abstract] [Full Text] [PDF] K. Kim, H. H. Kim, J. H. Kim, Y. H. Choi, Y. H. Kim, and J. Cheong Chemokine stromal cell-derived factor-1 induction by C/EBP{beta} activation is associated with all-trans-retinoic acid-induced leukemic cell differentiation J. Leukoc. Biol., November 1, 2007; 82(5): 1332 - 1339. [Abstract] [Full Text] [PDF] M. Ricote, C. S. Snyder, H.-Y. Leung, J. Chen, K. R. Chien, and C. K. Glass Normal hematopoiesis after conditional targeting of RXR{alpha} in murine hematopoietic stem/progenitor cells J. Leukoc. Biol., October 1, 2006; 80(4): 850 - 861. [Abstract] [Full Text] [PDF] L. E. Purton, S. Dworkin, G. H. Olsen, C. R. Walkley, S. A. Fabb, S. J. Collins, and P. Chambon RAR{gamma} is critical for maintaining a balance between hematopoietic stem cell self-renewal and differentiation J. Exp. Med., May 15, 2006; 203(5): 1283 - 1293. [Abstract] [Full Text] [PDF] A. Szanto and L. Nagy Retinoids Potentiate Peroxisome Proliferator-Activated Receptor {gamma} Action in Differentiation, Gene Expression, and Lipid Metabolic Processes in Developing Myeloid Cells Mol. Pharmacol., June 1, 2005; 67(6): 1935 - 1943. [Abstract] [Full Text] [PDF] S. Tsuzuki, K. Kitajima, T. Nakano, A. Glasow, A. Zelent, and T. Enver Cross Talk between Retinoic Acid Signaling and Transcription Factor GATA-2 Mol. Cell. Biol., August 1, 2004; 24(15): 6824 - 6836. [Abstract] [Full Text] [PDF] C. R. Walkley, L. E. Purton, H. J. Snelling, Y.-D. Yuan, H. Nakajima, P. Chambon, R. A. S. Chandraratna, and G. A. McArthur Identification of the molecular requirements for an RAR{alpha}-mediated cell cycle arrest during granulocytic differentiation Blood, February 15, 2004; 103(4): 1286 - 1295. [Abstract] [Full Text] [PDF] V. T. Phan, D. B. Shultz, B.-T. H. Truong, T. J. Blake, A. L. Brown, T. J. Gonda, M. M. Le Beau, and S. C. Kogan Cooperation of Cytokine Signaling with Chimeric Transcription Factors in Leukemogenesis: PML-Retinoic Acid Receptor Alpha Blocks Growth Factor-Mediated Differentiation Mol. Cell. Biol., July 1, 2003; 23(13): 4573 - 4585. [Abstract] [Full Text] [PDF] J. Si and S. J. Collins IL-3-induced enhancement of retinoic acid receptor activity is mediated through Stat5, which physically associates with retinoic acid receptors in an IL-3-dependent manner Blood, December 15, 2002; 100(13): 4401 - 4409. [Abstract] [Full Text] [PDF] B. S. Johnson, L. Mueller, J. Si, and S. J. Collins The cytokines IL-3 and GM-CSF regulate the transcriptional activity of retinoic acid receptors in different in vitro models of myeloid differentiation Blood, February 1, 2002; 99(3): 746 - 753. [Abstract] [Full Text] [PDF] S. J. Collins, J. Ulmer, L. E. Purton, and G. Darlington Multipotent hematopoietic cell lines derived from C/EBP{alpha}({-}/{-}) knockout mice display granulocyte macrophage-colony-stimulating factor, granulocyte- colony-stimulating factor, and retinoic acid-induced granulocytic differentiation Blood, October 15, 2001; 98(8): 2382 - 2388. [Abstract] [Full Text] [PDF] P. Kastner, H. J. Lawrence, C. Waltzinger, N. B. Ghyselinck, P. Chambon, and S. Chan Positive and negative regulation of granulopoiesis by endogenous RAR{alpha} Blood, March 1, 2001; 97(5): 1314 - 1320. [Abstract] [Full Text] [PDF] F. F. Ferrara, F. Fazi, A. Bianchini, F. Padula, V. Gelmetti, S. Minucci, M. Mancini, P. G. Pelicci, F. L. Coco, and C. Nervi Histone Deacetylase-targeted Treatment Restores Retinoic Acid Signaling and Differentiation in Acute Myeloid Leukemia Cancer Res., January 1, 2001; 61(1): 2 - 7. [Abstract] [Full Text] D. Grimwade, A. Biondi, M.-J. Mozziconacci, A. Hagemeijer, R. Berger, M. Neat, K. Howe, N. Dastugue, J. Jansen, I. Radford-Weiss, et al. Characterization of acute promyelocytic leukemia cases lacking the classic t(15;17): results of the European Working Party Blood, August 15, 2000; 96(4): 1297 - 1308. [Abstract] [Full Text] [PDF] T. Kuwata, I-M. Wang, T. Tamura, R. M. Ponnamperuma, R. Levine, K. L. Holmes, H. C. Morse III, L. M. De Luca, and K. Ozato Vitamin A deficiency in mice causes a systemic expansion of myeloid cells Blood, June 1, 2000; 95(11): 3349 - 3356. [Abstract] [Full Text] [PDF] S. C. Kogan, S.-h. Hong, D. B. Shultz, M. L. Privalsky, and J. M. Bishop Leukemia initiated by PMLRARalpha : the PML domain plays a critical role while retinoic acid-mediated transactivation is dispensable Blood, March 1, 2000; 95(5): 1541 - 1550. [Abstract] [Full Text] [PDF] L. E. Purton, I. D. Bernstein, and S. J. Collins All-trans retinoic acid enhances the long-term repopulating activity of cultured hematopoietic stem cells Blood, January 15, 2000; 95(2): 470 - 477. [Abstract] [Full Text] [PDF] V. Lallemand-Breitenbach, M.-C. Guillemin, A. Janin, M.-T. Daniel, L. Degos, S. C. Kogan, J. Michael Bishop, and H. de The Retinoic Acid and Arsenic Synergize to Eradicate Leukemic Cells in a Mouse Model of Acute Promyelocytic Leukemia J. Exp. Med., April 5, 1999; 189(7): 1043 - 1052. [Abstract] [Full Text] [PDF] This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Rights and Permissions Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Labrecque, J. Articles by Hoang, T. Search for Related Content PubMed PubMed Citation Articles by Labrecque, J. Articles by Hoang, T. Related Collections Neoplasia Social Bookmarking                   What's this?

	Copyright © 1998 by American Society of Hematology         Online ISSN: 1528-0020