|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 92 No. 2 (July 15), 1998:
pp. 653-663
Full Activity From Human  -Globin Locus Control Region Transgenes
Requires 5 HS1, Distal -Globin Promoter, and 3
-Globin Sequences
By
Peter Pasceri,
Dylan Pannell,
Xiumei Wu, and
James Ellis
From the Developmental Biology Program, Cancer and Blood Program, and
Blood Gene Therapy Program, Hospital for Sick Children, Toronto,
Ontario, Canada, and the Department of Molecular and Medical Genetics,
University of Toronto, Toronto, Ontario, Canada.
 |
ABSTRACT |
The locus control region (LCR) activates high-level human  -globin
transgene expression. LCR cassettes composed of 5 HS2-4 linked to
the 815 bp -globin proximal promoter do not express fully. Here, we
show that LCR (5HS2-4) -globin transgenes that also
contain either 5HS1 or the distal promoter fail to express fully in single- and low-copy transgenic mice. In contrast, full expression is obtained in the presence of both 5HS1 and the
distal promoter. Nine factor binding sites were identified in
5HS1, using in vitro DNaseI footprint and gel retardation
assays, and these include a strong Sp1/Sp3 site, four GATA-1 sites, and
two sites that encompass an ACTAAC motif. LCR (5HS1-4)
-globin transgene constructs with the distal promoter deleted or
replaced by spacer DNA show that specific distal promoter sequences are
required for full expression. An LCR (5HS1-4) transgene
construct with truncated downstream -globin gene sequences indicates
that 3 sequences also play an important role. These results show
that full expression of the -globin gene directed by the LCR
requires 5HS1, the distal -globin promoter, and 3
sequences, and has implications for gene therapy construct design and
models of LCR activation.
| |
INTRODUCTION |
EXPRESSION OF THE HUMAN -globin locus
is regulated by an array of cis-acting DNA elements including: five
DNaseI hypersensitive sites (HS) in the locus control region (LCR);
five promoters that incorporate certain silencer elements for
individual genes in the cluster; and at least three enhancers in the
introns or 3 of some of the genes.1 These elements
have several functional roles. The first step in transcriptional
activation is to open chromatin throughout the locus, which has been
viewed as being accomplished solely by, and established at, the
LCR.2 This chromatin opening event leaves the five genes of
the cluster poised to express in a developmentally restricted pattern
that is governed by the binding of specific factors to gene proximal
promoter, silencer, and enhancer elements.1
The activity of each individual HS has been extensively studied.
Transient transfection experiments show that only 5HS2 has a
strong classical enhancer activity.3 However, 5HS2-4
all enhance transcription in stably transfected cells and direct copy number-dependent expression in multicopy -globin transgenic
mice.4-9 Only 5HS3 can reproducibly activate
single-copy transgene expression, suggesting that it contains a
chromatin opening activity when linked to the -globin
gene.10,11 5HS1 has no significant activity in
transfection and transgenic assays,12-14 but appears to
have some important undefined function because full expression in
transgenic mice is only obtained in the presence of all four HS.11,12 5HS5 has an insulator
activity15 but is not required for full expression in
transgenic mice. Therefore, it is clear that the HS
have several different functions but interact in some way with each
other to activate full expression.
The -globin gene promoter and enhancers are also well
characterized.16-19 The minimal -globin promoter maps to
a 103 bp fragment that is inducible by the LCR in stable transfection
studies20; but in single-copy transgenic mice, the 815 bp
promoter is more active than the 265 bp promoter commonly used in gene
therapy vectors.21 LCR activation of  -globin transgenes
has also been shown to be dependent on the length of the -globin
promoter,22 but similar experiments have not been performed
on the -globin promoter.
Two enhancers are localized in the second intron and 3 of the
-globin gene.16,18,19 These enhancers have no role in LCR-mediated induction of the promoter in stable transfection studies14,20 and were therefore omitted from -globin
gene therapy vectors.23-25 However, deletion of the
3 enhancer in yeast artificial chromosome (YAC) transgenic mice
causes a reduction in -globin gene expression indicating that the
3 enhancer influences globin switching.26 In
addition, the human LCR does not reproducibly activate -globin
transgene promoters unless a fragment containing the 3
-globin enhancer27 or the entire -globin gene is
included.28,29 Hence, more recently developed
adeno-associated virus (AAV) vectors that transfer the
A -globin gene include the 3 enhancer.30
These results suggest that promoters and 3 enhancers are
involved in chromatin opening activity mediated by the human -globin LCR. Similar conclusions were reported for chicken -globin and lysozyme transgenes assayed in mice, which require the enhancer activities of their LCRs and linked promoters to open
chromatin.31-33 Taken together, the above work gathered by
many groups strongly suggests that HS elements of the LCR not only
interact with each other, but also indicates that sequences 5 to
minimal globin promoters and in 3 enhancers have important
functions that cannot be supplied by the LCR alone at ectopic transgene
sites.
We are particularly interested in defining the minimal combination of
cis-acting regulatory elements that direct full and reproducible
expression of the -globin gene in single-copy transgenic mice.21 The purpose of the present study is to identify
functional interactions between the LCR and -globin gene regulatory
elements and to create an optimal transgene construct for gene therapy of -thalassemia or sickle cell anemia. Our findings show that reproducible full expression of transgenes regulated by the LCR requires the simultaneous presence of 5HS1, the distal portion of the 1555 bp -globin promoter, and a large fragment that includes the 3 enhancer. These data have implications for the design of gene therapy constructs for treatment of -thalassemia, and can be
incorporated into models of LCR activation.
| |
MATERIALS AND METHODS |
Plasmid construction.
Transgene constructs were derived from the plasmids pGSE1359 and
pBGT14. pGSE1359 contains a 6.5 kb LCR cassette and the 4.8 kb
BglII-EcoRV -globin gene fragment regulated by the
1555 bp promoter.34 pBGT14 contains a 3.0 kb LCR cassette
and the 4.2 kb Hpa1-EcoRV -globin gene fragment
regulated by the 815 bp promoter.21 The 6.5 kb LCR cassette
includes 5HS1-4 as described previously.34 The 3.0 kb LCR contains the 1.15 kb Stu1-Spe1 fragment of
5HS4, the 0.85 kb Sac1-PvuII fragment of
5HS3, and the 0.95 kb Sma1-Stu1 fragment of
5HS2.
In short, BGT22 was constructed by linking the 6.5 kb LCR from GSE1359
to the 4.2 kb -globin gene from BGT14, using the Sal1 linker
present in both plasmids between the LCR and the promoter. BGT23 was
made by linking the 3.0 kb LCR from BGT14 to the 4.8 kb -globin gene
from GSE1359, using the same Sal1 linker site. BGT33 was made
by inserting a 2.6 kb Snab1 fragment from pGSE1359 (containing
the 0.3 kb Snab1-BglII fragment of the 3 part of 5HS2, the 1.0 kb Sac1-HindIII fragment of
5HS1, and the 1.3 kb BglII-Snab1 fragment of the
promoter) into the Snab1 sites in 5HS2 and the promoter
of BGT23. This manipulation left a Sal1 site in the polylinker
between the LCR and the promoter, and linked a 4.0 kb LCR (composed of
5HS1-4) to the 4.8 kb -globin gene fragment including a
reconstructed 1555 bp promoter. BGT41 was cloned by deleting the 741 bp
BglII-Hpa1 distal promoter fragment from BGT33 via
digestion at the Sal1 site in the polylinker and the
Hpa1 site in the promoter and religation with a Sal1
linker. This resulted in the 4.0 kb LCR of BGT33 linked by a
Sal1 site to the 4.2 kb -globin gene fragment. The spacer
element of BGT40 was cloned by insertion of the 717 bp
Xho1-Hpa1 A -globin intron 2 fragment (provided by
S.Philipsen) between the Sal1 polylinker site and the
Hpa1 site in the promoter of BGT33. This destroyed the
Sal1 site and recreated the Hpa1 site. Finally, the
BGT46 construct bears a truncation of sequences downstream of the
BspH1 site located 267 bp 3 of the end of exon 3 in the
-globin gene. This was accomplished by cloning the 4.0 kb LCR from
BGT41 linked via the Sal1 site to a 3.15 kb -globin gene
fragment from BGT33 in which the downstream BspH1 site was
destroyed and replaced by an Nhe1 linker. Therefore, BGT46 is
regulated by the 1555 bp promoter but lacks extensive 3
sequences.
pGEM-HS1 was cloned by polymerase chain reaction (PCR) amplification of
the -globin 5HS1 core using the 5HS1 and 3HS1 oligonucleotides as primers and the plasmid BGT22 as a template. Cycling conditions for PCR with Taq polymerase (Gibco BRL,
Gaithersburg, MD) were: 94°C, 3 minutes, (1 cycle);
94°C, 1 minute, 58°C, 1 minute, 72°C, 2 minutes (30 cycles); 72°C, 5 minutes (1 cycle). The PCR product was gel
purified and inserted into the plasmid pGEM-T (Promega, Madison,
WI) using the 3 thymidine overhangs. Sequence of
the cloned insert was verified by dideoxy sequencing using Sequenase
version 2 (Amersham, Oakville, Ontario, Canada)) and
the primers 5HS1, 3HS1, and HS1FpGa.
Generation of transgenic mice.
Transgene DNA was prepared using Plasmid Maxi Kits (Qiagen, Santa
Clara, CA). Transgene fragments were liberated from
their plasmid backbones by digestion with EcoRV that cleaves in
the polylinker 5 of the LCR cassettes and at the 3 end of
the -globin gene, with the exception of BGT46, which lacks the
3 EcoRV site and was double digested with EcoRV
and Nhe1. DNA fragments were recovered from 0.7%
TAE agarose gel slices using GeneClean II or GeneClean
Spin Column Kits (Bio101) and Elutip-d columns
(Schleicher and Schuell, Mississauga, Ontario, Canada), and resuspended
in injection buffer (10 mmol/L Tris-HCl, pH 7.5; 0.2 mmol/L EDTA). DNA
concentration was determined by comparison with DNA standards run on
agarose gels, and the injection fragment was diluted to 0.5-1 ng/µL
in injection buffer. The diluted DNA was prespun for 20 minutes and
aliquots removed for microinjection into fertilized FVB mouse eggs.
Injected eggs were transferred into recipient CD1 female animals. Fetal
mice were dissected and DNA extracted from head tissue, at 15.5 days
postinjection, whereas the fetal livers were saved frozen in two halves
for future analysis. Head DNA was extracted by Proteinase K digestion
overnight, a single phenol/chloroform extraction and isopropanol
precipitation. Transient transgenic fetuses were identified by
slot-blot hybridization with the ivs2 probe using standard
procedures.
DNA analysis.
Southern transfer and hybridization were by standard procedures.
Copy-number determination was performed using a Molecular Dynamics
PhosphorImager (Sunnyvale, CA). Single-copy animals
showed a single random-sized end-fragment in BamH1 and
EcoR1 digests hybridized with the ivs2 probe. With multicopy
animals, the intensity of the end-fragment was defined as one transgene
copy, and was used to calculate the copy number of the multicopy
junction-fragment in the same lane. Mosaicism in the fetal liver of
founder 15.5 day transgenic mice was calculated by quantifying the
intensity of bands on a Molecular Dynamics PhosphorImager and using the following formula: (Tg H / Tg mThy-1) / (B26 H x Tg copy number /
B26 mThy-1). Tg, transgenic; H, human -globin; mThy-1, mouse Thy-1; B26, 1 copy bred line B26.
RNA analysis.
Fetal liver (embryonic day 15.5) RNA was extracted using Trizol Reagent
(Gibco BRL), 1 µg was hybridized to kinased double-stranded DNA
probes, digested with 75 U S1 nuclease (Boehringer Mannheim, Laval,
Quebec, Canada),), and run on a 6% sequencing gel as
described.18 Probe excess was shown by including a sample
containing 3 µg fetal liver RNA. Specific activities of human
-globin (H) relative to the mouse major (maj) probe were
2:1 unless otherwise noted. The protected 160 nt H and 95 nt maj
bands were quantified on a Molecular Dynamics PhosphorImager and the % expression levels calculated according to the formula (H / 2maj)
×100 to account for the specific activity differences. Percent
expression per copy was calculated as (2maj genes / number H
transgenes) × (% expression / % mosaicism) × 100.
Nuclear extract preparation.
Nuclear extracts were performed essentially as described.35
In brief, 5 × 108 murine erythroleukemia
(MEL) C88 (provided by L. Wall) or Jurkat cells
(obtained from American Type Culture Collection [ATCC]) were grown in
alpha MEM or RPMI 1640 media, respectively, supplemented with 10%
fetal bovine solution, (FBS; Gibco BRL). MEL C88 cells were induced for
4 days with 2% dimethyl sulfoxide (DMSO; Sigma, St Louis, MO). Cells
were washed in phosphate buffered saline (PBS), washed in cold
Hypotonic Solution, and resuspended on ice in 2.5 mL cold Hypotonic
solution for 10 minutes. Nuclei were released using 20 strokes of a
cold Dounce Homogenizer, pelleted, and resuspended in a cold microfuge
tube in 0.25 mL cold low-salt buffer; 0.75 mL cold high-salt buffer was
added, chromatin was precipitated on ice for 30 minutes and pelleted in
a refrigerated Sorval (Newtown, CT) RMC 14 microfuge
at 14.5 Krpm for 30 minutes at 4°C. The supernatant was then
dialysed for 45 minutes at 4°C in a Slide-a-Lyser cassette (Pierce,
Rockford, IL) against dialysis buffer before
centrifugation in the refrigerated microfuge for 20 minutes at 14.5 Krpm. Protein concentration was determined with the Bradford Assay Kit
(Bio-Rad Laboratories, Mississauga, Ontario, Canada), and the nuclear
extract frozen in small aliquots for later use.
In vitro DNaseI footprint assay.
In vitro footprint reactions were performed essentially as
described.35 The pGEM-HS1 probes were prepared by digestion
with either Nco I, which cuts in the 5 polylinker, or
Spe I which cuts the 3 end of 5HS1. The DNA ends
were labelled with [ -32P] dCTP using Klenow enzyme
(Boehringer Mannheim), and the labelled DNA cut with the second enzyme.
The 556 bp Spe I-Nco I fragments labelled at either the
5 or 3 ends were isolated by excision of the band from a
preparative gel and purified by centrifugation through siliconized
glass wool to remove agarose and subsequent ethanol precipitation. As a
marker lane, G-sequence ladders of the same probe DNA were prepared
using the Maxam-Gilbert Sequencing kit (Sigma). Approximately 5000 cpm
of the probe was treated with dimethyl sulphate followed by alkali
hydrolysis with piperidine at 90°C.
Each 25 µL footprinting assay including extract contained
approximately 5000 dpm of labeled probe DNA, 2 µg poly(dI):poly(dC) (Pharmacia, Uppsala, Sweden), and 3 to 18 µg protein extract in 20 mmol/L HEPES-KOH (pH 7.9), 8% glycerol (vol/vol), 100 mmol/L KCl, 0.25 mmol/L phenylmethylsulfonyl fluoride (PMSF), 1.25 mmol/L dithiothreitol (DTT), 0.1 mmol/L EDTA, and 2.0 mmol/L MgCl2. These reactions were incubated at room
temperature for 30 minutes, followed by a 3-minute incubation on ice
before addition of 0.18 µg of DNaseI (Sigma) on ice for 120 seconds.
The assay was stopped with an equal amount of 1.2 mol/L NaCl containing
0.4% sodium dodecyl sulfate (SDS), 20 mmol/L EDTA,
and 200 µg/ml tRNA. After phenol/chloroform extraction and ethanol
precipitation, the samples were run in loading dye on 6% sequencing
gels and exposed to XAR-5 film (Kodak, Rochester, NY)
for 3 days.
Gel retardation assay.
Gel retardation assays were performed as described.16 Fifty
ng of synthetic single-strand sense oligonucleotide was labeled with T4
polynucleotide kinase (Boehringer Mannheim) and [-32P]
adenosine triphosphate (ATP) and annealed to 250 ng of antisense strand
to a final double-strand concentration of 1 ng/µL. Competitor oligonucleotides were annealed in equal amounts of both strands to a
total DNA concentration of 50 ng/µL. Each 10 µL reaction contained
1 ng of labeled double-stranded oligonucleotide probe, 2 ng of
poly(dI):poly(dC) (Pharmacia), 3 to 6 µg of nuclear extract protein
in 2 µL of buffer D, and 1 µL of Binding Buffer. In competition experiments, 50 ng of unlabeled double-stranded oligonucleotide (50 times molar excess) was added to the reaction mixture. For supershift
assays, 1 µL of antibody was added. Antibodies (Santa Cruz, Santa
Cruz, CA)) used for this purpose were: GATA-1 (N6) rat
monoclonal IgG2a, Sp1 (1C6) mouse monoclonal
IgG1, Sp3 (D20) rabbit polyclonal IgG. For supershift
experiments, the reactions were incubated overnight at 4°C before
addition of probe and a further 20-minute incubation, 1 µL loading
dye was added and the reactions were run on 4% acrylamide gels for 4 hours at constant 13 mA in 1 × TBE at 4°C.
Oligonucleotide primers and probes.
Oligonucleotide Primers and Probes are as follows: 3HS1,
CTCAAGCCTCATTCAGACACTAG; 5HS1, TTTCCTGGTATCCTAGGACCTGC; HS1FpAs, TCACGTTTTGATGATAATCACATATTTGTAAACACA; HS1FpAa,
TGTGTTTACAAATATGTGATTATCATCAAAACGTGA; HS1FpCs,
CATATTTATCGGGCATTTCTGAG; HS1FpCa, CTCAGAAATGCCCGATAAATATG; HS1FpEs, TAGCTAGGCCCCTCCCTCATCACAGCT; HS1FpEa,
AGCTGTGATGAGGGAGGGGCCTAGCTA; HS1FpFs, CGAGCTCTTATCTATATCCACACA;
HS1FpFa, TGTGTGGATATAGATAAGAGCTCG; HS1FpGs,
GCCCAGCTATCACCATCCCAAGTC; HS1FpGa, GACTTGGGATGGTGATAGCTGGGC; GATA-Cruz-s, CACTTGATAACAGAAAGTGATAACTCT; GATA-Cruz-a,
AGAGTTATCACTTTCTGTTATCAAGTG; Sp1-Cruz-s, ATTCGATCGGGGCGGGGCGAGC;
Sp1-Cruz-a, GCTCGCCCCGCCCCGATCGAAT; 46int1, GCAAAGAATTCACCCCACCAG;
and 46int2, ATGCACTGACCTCCCACATTC.
| |
RESULTS |
We previously established that the 6.5 kb microlocus LCR cassette
composed of 5HS1-4 linked to the 1555 bp -globin promoter and
gene sequences, including both enhancers expresses at 100% levels in
single-copy transgenic mice.11 In addition, the BGT14 construct composed of a 3.0 kb LCR cassette containing 5HS2-4 linked to the 815 bp promoter and both enhancers directs reproducible expression of 45% at single copy.21 Expression levels from
BGT14 therefore are reduced by about twofold in comparison with the microlocus. To identify the minimal combination of cis-acting DNA
elements capable of directing full expression from single- and low-copy
transgenes, we created several transgene constructs (Fig 1). Initially, we wished to determine
the relative importance of the distal promoter, 5HS1, and
auxiliary sequences in transgene expression. For this purpose, the
BGT22 transgene combines the 6.5 kb LCR with the 815 bp promoter to
test the importance of the distal promoter sequences. The BGT23
transgene links the 3.0 kb LCR to the 1555 bp promoter to examine the
role of 5HS1 and auxiliary sequences near 5HS2-4, and the
BGT33 transgene was designed to determine whether 5HS1 and the
distal promoter functionally interact.
View larger version (36K):
[in this window]
[in a new window]
| Fig 1.
Map of the human -globin LCR transgene constructs
designed to determine the importance of 5HS1, distal -globin
promoter, and 3 sequences in directing full transgene expression
levels in single-copy transgenic mice. The activity of the microlocus and BGT14 constructs has been previously described,11,21
and the specific sequences used in each construct are outlined in Materials and Methods. The black boxes in each HS correspond to the
known core elements, and the black boxes in the -globin gene correspond to the three exons. The length of each promoter (Pr) is
given below the line, and the enhancers (En) located in the second
intron and 3 of the gene are indicated. A, Acc1; B,
BamH1; E, EcoR1; N, Nco1.
|
|
Generation of transgenic mice.
These DNA constructs were purified as linear fragments and
microinjected into fertilized FVB mouse eggs to create transgenic mice.
The fetuses derived from these eggs were dissected at embryonic day
15.5 and genomic DNA extracted from head tissue, whereas the fetal
livers were frozen in two halves for future analyses. Positive transient transgenic founder (F0) animals were identified
by slot-blot hybridization with the ivs2 probe, and transgene copy
number subsequently deduced by genomic Southern blots after digestion with EcoR1 and BamH1, which we have previously shown
can unambiguously identify junction fragments that define single-copy
transgenic mice.21 A representative Southern analysis for
the BGT33 construct is shown in Fig 2A. All
founder animals were characterized to determine whether they harbored
intact transgenes by Southern blot analyses with multiple diagnostic
restriction enzymes and ivs2 or 5HS3 probes (data not shown).
Finally, the level of transgene mosaicism was determined by Southern
blots of DNA derived from one half of the frozen fetal livers after
digestion with Acc1, an enzyme which releases a 1.9 kb fragment
detected by the ivs2 probe regardless of the integration
site.21 A representative mosaic analysis for BGT33 is shown
in Fig 2B. By comparison of the intensity of the transgene signal with
that from the single-copy bred B26 line that by definition is 100%
transgenic, it is possible to calculate the degree of transgenesis in
the fetal liver for each founder animal. Nonintact and highly mosaic
animals were excluded from this study. Identical screening procedures
were performed on the BGT22 and BGT23 transgenic animals (data not shown).
View larger version (67K):
[in this window]
[in a new window]
| Fig 2.
Determination of transgene copy number and mosaicism in
embryonic day 15.5 F0 transgenic mice containing the BGT33
construct. (A) Copy numbers of BGT33 transgenic mice determined by
Southern blot analysis of F0 fetal head DNA digested with
BamH1 and hybridized with the ivs2 probe. (B) Transgene
mosaicism levels determined by Southern blot analysis of Acc1
digested DNA extracted from BGT33 fetal livers and hybridized with the
ivs2 (H) and mouse Thy-1 (mThy-1) probes. The percentage of
transgenic cells was calculated by comparison of the H band
intensity of each BGT33 transgenic mouse with the one copy-bred line
(B26), taking into account copy number and the mThy-1 loading control
(see Materials and Methods).
|
|
Requirement for 5HS1 and distal promoter sequences.
To determine the effect of these transgene constructs on expression
levels, RNA was extracted from the other half of the frozen transgenic
fetal livers for S1 nuclease protection assays using human -globin
and mouse major probes (Fig 3).
Expression from the BGT22 construct ranged from 13% to 889% in
single-copy animals and remained variable even at low-copy numbers of 2 to 10 (Fig 3A). These data suggest that the distal promoter is
important for obtaining reproducible full levels of expression directed by the LCR. Expression from the BGT23 construct ranged from 33% to
384% in single-copy animals, and a two-copy animal failed to express
(Fig 3B). These data indicate that the distal promoter is not
sufficient to maintain reproducible levels of expression, and that
other sequences may also be required. By adding back both 5HS1
and the distal promoter in the BGT33 construct, reproducible 87% to
136% expression levels were obtained from the single-copy transgenic
animals, and the multicopy animals also express to the same magnitude
(Fig 3C). Such consistent expression was only obtained in the construct
that contains both 5HS1 and the distal promoter. We therefore
suggest that 5HS1 has an important role in mediating the
interaction between the LCR and the -globin proximal promoter. The
distal promoter sequences may specifically participate in this
functional interaction with 5HS1, or may act as a passive spacer
element.
View larger version (76K):
[in this window]
[in a new window]
View larger version (84K):
[in this window]
[in a new window]
View larger version (66K):
[in this window]
[in a new window]
| Fig 3.
Expression of globin mRNA in transgenic mice containing
5HS1 and/or -globin distal promoter constructs. (A)
S1 nuclease analysis of fetal liver RNA of 15.5 day F0
BGT22 transgenic mice showing that the range of expression from
single-copy transgenes is 13% to 889% per copy and indicating that
the distal promoter is important for reproducible expression levels.
(B) S1 nuclease analysis of fetal liver RNA of 15.5 day F0
BGT23 transgenic mice showing that the range of expression from
single-copy transgenes is 33% to 384% per copy and indicating that
5HS1 is important for reproducible expression levels. (C) S1
nuclease analysis of fetal liver RNA of 15.5 day F0 BGT33
transgenic mice showing that the range of expression from single-copy
transgenes is 87% to 136% per copy and showing that both 5HS1
and the distal promoter are required to obtain reproducible full
expression levels. H, human -globin protected probe fragment;
maj, mouse major protected probe fragment; Ntg, nontransgenic;
µD, one copy µD14 microlocus line; 3X, probe excess control.
{/ANNT;4224n;;left;71808n}C
{/ANNT;4224n;;0n;0n}A {/ANNT;4224n;;84480n;0n}B
|
|
Molecular analysis of 5HS1.
The role of 5HS1 in activating expression from the -globin
proximal promoter is likely to be mediated by trans-acting factors. As
the cis-acting binding sites in 5HS1 have not been extensively characterized, we chose to identify them by employing in vitro DNaseI
footprint analyses. The core fragment of 5HS1 was cloned by PCR
to facilitate these experiments. PCR primers were synthesized that
flank the minimal HS site (Fig 4) and that
incorporate all the phylogenetically conserved 5HS1 sequences
described in the globin server (http://globin.cse. psu.edu). The
sequence of the resulting pGEM-HS1 plasmid was confirmed, although the
expected (CA)12(TA)6 tract at the 5
junction of footprint B was altered to
(CA)10(TA)8 (Fig 4). The latter sequence was
also present in the pBGT22 plasmid used as a template in the PCR
reactions and is presumably a polymorphism (data not shown).
View larger version (40K):
[in this window]
[in a new window]
| Fig 4.
Human 5HS1 core sequence and nine in vitro DNaseI
footprints detected using MEL cell nuclear extracts. Footprints are
boxed and labelled (A-C, D1-D3, and E-G). Consensus binding sites are underlined for Sp1 (footprint E), GATA-1 (footprints A, C, F, G), and
the ACTAAC motif (footprints D1, D2). Hypersensitive bases are
indicated by vertical arrows, horizontal arrows correspond to primers
used for cloning 5HS1 by PCR, dashed line represents the
polylinker of the pGEM-T vector.
|
|
To obtain a probe for in vitro DNaseI footprint analyses, the 3
end of the pGEM-HS1 sense strand was end-labelled at the Spe1
site, and the 3 end of the antisense strand was end labelled at
the Nco1 site. These two probe fragments were incubated with increasing amounts of induced MEL or Jurkat T cell nuclear extracts before DNaseI digestion, and run in parallel to lanes incubated without
extracts (Fig 5). G ladders of the same
probes serve as sequence markers. The DNase1 digestion ladders of the
two probe fragments shown in Fig 5A-C are protected by MEL extracts at
nine footprints labelled A-C, D1-D3, and E-G. Many of these footprints correspond to the DNA-binding sites of known trans-acting factors (Fig
4). For example, the strongest footprint E (Fig 5A) contains a
consensus site for Sp1 factor, and footprints A, C, F, and G appear to
be good candidates for GATA-factor-binding sites (Fig 4). The weak
footprints B and D1-D3 do not exhibit any characterized binding sites,
but footprints D1 and D2 share a centrally located ACTAAC motif of
unknown importance (Fig 4). In vitro DNaseI footprint analyses using
nonerythroid Jurkat T-cell nuclear extracts bound to the antisense
probe (Fig 5B-C), detect the footprints A to E but not F and G. These
results support the conclusion that F and G are bound by an
erythroid-specific factor, and that footprints A to E can be bound by
factors that are ubiquitous or at least present in hematopoietic cells
of nonerythroid origin.
View larger version (59K):
[in this window]
[in a new window]
View larger version (120K):
[in this window]
[in a new window]
View larger version (134K):
[in this window]
[in a new window]
| Fig 5.
In vitro DNaseI footprint analysis of the 5HS1
core element. (A) Footprint of the 5HS1 sense strand probe
showing footprints A-C, D1-D3, and E-G. Hypersensitive bases indicated
by arrows. (B-C). Footprint of 5HS1 antisense strand probe
protected by the indicated MEL or Jurkat cell nuclear extract. G,
chemical sequencing G ladder of the same probe; N, no extract.
{/ANNT;;4224n;36608n;0n}B {/ANNT;4224n;;103488n;0n}C
{/ANNT;4224n;;0n;0n}A
|
|
To better characterize the factors responsible for generating the
footprints that do contain consensus sites, we performed gel
retardation assays. An oligonucleotide probe for the strong footprint E
is bound by factors in induced MEL extracts and these complexes are
competed by an excess of wild-type Sp1 (4.0) but not mutant Sp1 (4.4)
binding sites (Fig 6A). All the complexes are also present in Jurkat extracts, and the upper complex in the
Jurkat extracts is blocked by Sp1 antibody but not by GATA-1 antibody
(Fig 6A). The lower two complexes migrate at the approximate position
of Sp3 and are supershifted by Sp3 antibody (Fig 6A). The
erythroid-specific factor EKLF and the widely
expressed factor BKLF can recognize some Sp1 consensus
sites,36 but we have been unable to show EKLF binding to
footprint E probes using our MEL extracts with EKLF or BKLF antibodies,
or with GST-EKLF fusion proteins (data not shown). These data show that
footprint E is bound by Sp1 and Sp3 factors.
View larger version (71K):
[in this window]
[in a new window]
View larger version (115K):
[in this window]
[in a new window]
View larger version (14K):
[in this window]
[in a new window]
| Fig 6.
Gel retardation assays of the strong in vitro DNaseI
footprinted regions in 5HS1. (A) Gel retardation assay on
Sp1/Sp3 factors bound to the E probe corresponding to the strongest
footprint E. Competitors: E, self-competition with HS1FpE site; 4.0, wild-type Sp1 site from 5HS2; 4.4, mutant Sp1 site from
5HS2. Antibodies: G, Gata-1. B. Gel retardation assay on the
GATA factors bound to the A, C, F, and G footprints. Competitors: Sp1,
Sp1-Cruz consensus site; G, GATA-Cruz dimer GATA-1 site; F,
self-competition with HS1FpF site. C. Summary of factors bound to each
footprint as deduced by gel retardation assays and in vitro DNaseI
footprinting. Filled circles, erythroid-specific factors; open circles,
ubiquitous factors.
{/ANNT;4224n;;0n;0n}A
{/ANNT;4224n;;84480n;0n}B
{/ANNT;4224n;;0n;103488n}C
|
|
Oligonucleotide probes to footprints A, C, F, and G all bind complexes
that migrate at the approximate size of GATA-1 in induced MEL extracts
(Fig 6B). A consensus GATA-1 dimer site is bound by two complexes that
can be supershifted with GATA-1 antibody. Complexes bound to each of
the A, C, F, and G probes comigrate with either the upper or lower
GATA-1 complex or with both, and these complexes supershift with GATA-1
antibody. In addition, footprint F contains a non-GATA-1 complex that
is competed with F oligonucleotides but not by GATA-1 sites, and is not
supershifted by GATA-1 antibodies. These data show that GATA-1 binds to
footprints A, C, F, and G, but that an additional factor (F-BF) also
binds to footprint F. The finding that Jurkat extracts protect sites A
and C, as shown by the in vitro DNaseI footprints (Fig 5B), may be
explained by complexes observed with Jurkat extracts in gel retardation
assays (data not shown), perhaps due to binding by a GATA-related
factor such as GATA-3 that is present in T cells. In summary, the
footprint and gel retardation assays are consistent with the assignment
of binding sites shown in Fig 6C, and these factors may participate in
a functional interaction between 5HS1 and the other HS of the
LCR and/or the distal promoter.
Distal promoter is not a spacer element.
The distal promoter is required together with 5HS1 in the BGT33
construct to direct full and reproducible transgene expression. This
finding could be explained by either a requirement for specific sequences in the distal promoter to mediate this effect; or a passive
spacer effect that merely distances the proximal promoter from the
5HS1 element. To distinguish these possibilities we tested two
new constructs in transient transgenic mice. The BGT41 construct
contains a 5HS1-4 cassette linked to the 815 bp -globin promoter and serves as a baseline to assess the effect of distal promoter deletion within the context of the 4.0 kb LCR (Fig 1). The
BGT40 construct essentially adds back neutral DNA into the BGT41
transgene to examine the role of spacing (Fig 1). If specific sequences
within the distal promoter are required to obtain full expression
levels and spacing has no effect, then expression levels of BGT41 and
BGT40 should be roughly equivalent. In contrast, if spacing alone can
account for the distal promoter effect then the BGT40 construct should
express to reproducible and full levels equivalent to those previously
determined for BGT33. As a neutral spacer for the BGT40 construct, we
chose to employ the 717 bp Xba1-Hpa1 fragment
containing the human A -globin intron 2 because: it does not contain
any known regulatory elements unlike the -globin intron 2; its
endogenous location is between the LCR and the -globin promoter,
implying that these spacer sequences will not interfere with LCR
activation; it is roughly the same size and has compatible ends for
replacement of the distal -globin promoter; and other mammalian or
prokaroyotic DNA fragments may contain undescribed sequences that
interfere with LCR function.
BGT40 and BGT41 transient transgenic mice were created and DNA analyses
for copy number, intactness, and mosaicism were determined as before
(data not shown). The RNA analysis shown in
Fig 7 shows that expression from the BGT41
construct in which the distal promoter has been deleted is reduced to a
range of 26% to 79% at single copy. Clearly, deletion of the distal
promoter in the context of the 4.0 kb LCR reduces the average
expression level. Likewise, the BGT40 construct that contains the
spacer element instead of the distal promoter expresses to a similar
level as BGT41, with a range of 13% to 74% in single-copy animals and
levels approaching 100% in most of the higher-copy animals. The
similarly reduced levels of expression in animals bearing these two
constructs supports the conclusion that specific sequences are required
in the distal promoter to direct 100% expression at single copy.
View larger version (49K):
[in this window]
[in a new window]
| Fig 7.
Expression of globin mRNA in transgenic mice containing
the -globin distal promoter deletion construct (BGT41), distal
promoter spacer construct (BGT40), and the 3 truncation
construct (BGT46). (A) S1 nuclease analysis of fetal liver RNA of 15.5 day F0 BGT41 transgenic mice showing that the range of
expression from single-copy transgenes is 26% to 79% per copy and
indicating that the distal promoter is important for full expression
levels within the context of the 4.0 kb LCR. (B) S1 nuclease analysis
of fetal liver RNA of 15.5 day F0 BGT40 transgenic mice
showing that the range of expression from single-copy transgenes is
13% to 74% per copy and indicating that a spacer element combined
with the 815 bp promoter is not sufficient to reconstitute full
expression levels equivalent to those directed by the 1555 bp promoter
(BGT33). (C) S1 nuclease analysis of fetal liver RNA of 15.5 day
F0 BGT46 transgenic mice showing that the range of
expression from single-copy transgenes is 0% to 66% per copy and
showing that 3 sequences are required to obtain reproducible
full expression levels from the 4.0 kb LCR combined with the 1555 bp
promoter. H, human -globin protected probe fragment; maj,
mouse major protected probe fragment; Ntg, nontransgenic; µD, one
copy µD14 microlocus line. {/ANNT;4224n;;35904n;0n}A
{/ANNT;4224n;;76032n;0n}B
{/ANNT;4224n;;133056n;0n}C
|
|
-Globin 3 sequences are crucial for LCR function.
As a final investigation to identify the minimal combination of
regulatory elements required for full expression, we examined the role
of sequences downstream of the -globin gene. The BGT46 construct
resembles the fully functional BGT33 construct except for a 1.65 kb
truncation that includes the 3 enhancer (Fig 1). Expression
analysis of transient transgenic mice bearing the BGT46 transgene is
shown in Fig 7. Transgene copy number, intactness, and mosaicism levels
was determined as described earlier. Mosaicism was determined using
Nco1-EcoR1 digested fetal liver DNA compared with the
single-copy-bred line B26, and intactness examined with multiple
diagnostic restriction sites in addition to PCR (using the 46int1 and
46int2 primers) for the 3 transgene terminus (data not shown).
Expression of most of the transgenes is in the 29% to 66% range,
suggesting that 3 sequences are required to obtain full levels
of gene expression. More surprisingly, mouse 25 fails to express
significant levels of -globin mRNA, showing that at some single-copy
integration sites 3 sequences play an essential role in
controlling expression of the -globin promoter despite the presence
of the LCR.
| |
DISCUSSION |
Definition of the minimal combination of regulatory elements capable of
directing full expression of the human -globin gene in transgenic
mice serves the dual purpose of examining the functional and
cooperative interactions of these elements; as well as creating a
transgene cassette whose expression levels is well suited for gene
therapy purposes. Our results show that such full expression is only
obtained in the presence of 5HS1, the distal promoter, and a
3 fragment that includes a -globin enhancer.
Requirement for 5HS1 and distal promoter sequences.
We previously showed that truncation of the -globin promoter from
 815 bp to 265 bp compromised expression from single-copy transgenic mice.21 Here we refine those observations with
regard to the distal promoter sequences located from 1555 bp to
815 bp and to its potential interactions with 5HS1. The
BGT22 transgenes show that the complete 6.5 kb microlocus LCR is not
capable of reproducibly activating the 815 bp promoter, suggesting that
the distal promoter plays an important role in LCR activation. However, the BGT23 transgenes show that in the absence of 5HS1, the 1555 bp promoter is not sufficient to reproducibly activate full transgene expression directed by the 3.0 kb LCR. The range of expression for
single copy BGT22 (13% to 889%) and BGT23 transgenes (33% to 384%)
is surprising given that the highest level previously described for the
microlocus construct (linked to the 1555 bp promoter) is 188% from a
four-copy line.11,34 It is only the BGT33 transgene that is
fully activated at all single-copy integration sites (87% to 136%)
and that expresses to a range similar to that previously described for
the microlocus construct (86% to 188%). BGT33 and the microlocus
construct share the feature of containing both 5HS1 and the
distal promoter.
Further experiments were designed to determine whether the distal
promoter was a spacer element required for DNA looping by the putative
LCR holocomplex to the proximal promoter; or contained specific
sequences that were required for full expression. Linkage of the 815 bp
promoter to the 4.0 kb LCR in the BGT41 transgene led to a reduction in
expression, supporting the earlier results obtained with the 815 bp
promoter linked to the 3.0 kb LCR (BGT14). Finally, the BGT40
transgenes showed that neutral spacer DNA inserted upstream of the 815 bp promoter is not sufficient to reactivate full expression, and
indicates that specific sequences present in the distal promoter are
involved in LCR activation.
Taken together, these data are consistent with a cooperative effect
between specific sequences in 5HS1 and the distal promoter. The
importance of 5HS1 to LCR activity in vivo was also shown by
using linked-cosmid transgenic mice to show that 5HS1 deletion affects position independence directed by the entire human -globin locus.37 The importance of the distal promoter in the
context of the full LCR and the entire -globin locus is not known,
and requires additional mouse knockout or
linked-cosmid/YAC transgenic mouse experiments.
Cis-acting sites in 5HS1.
To complete the molecular characterization of the LCR HS cores, we
sought to identify trans-acting factor binding sites in 5HS1. In
vitro DNaseI footprint analyses show that 5HS1 contains nine
binding sites, and gel retardation assays showed that they include a
strong Sp1/Sp3 site and four GATA-1 sites. The B and D1 to D3
footprints bind factor(s) that are not erythroid-specific. These data
generally agree with the findings of in vivo footprint analyses of
5HS1 that detected protection of the Sp1 site at footprint E and
GATA-1 sites at footprint F and G,38 as well as two weak
AP-1 sites that might potentially bind the erythroid factor NF-E2. We
have been unable to confirm in vitro footprints at the latter weak AP-1
sites, although NF-E2 and AP-1 are present in our MEL nuclear extracts
(data not shown). These AP-1 sites are not phylogenetically conserved
in 5HS1, unlike the Sp1 and GATA-1 sites.39 We have
also been unable to detect YY-1 factor binding to 5HS1 (data not
shown).
In summary, we have extended the in vivo analyses by identifying the
specific factors that bind to sites in 5HS1 using competition and antibody supershift protocols on gel retardation assays, and by
identifying additional in vitro binding sites 5 of the region that was footprinted in vivo. The cis-acting features of 5HS1 differ from those found in 5HS2-4 by the absence of NF-E2 and YY-1 sites and the presence of the ACTAAC motif in footprints D1 and
D2, which is not found at any other location in the sequence of the
human -globin locus.
Cis-acting sites in the distal promoter.
The BGT40 spacer transgene construct indicates that specific sequences
in the distal promoter are required for full LCR activity and suggest a
functional interaction with 5HS1. Footprint analyses have been
performed on the minimal 265 bp human |
Abstract
Introduction
Abstract