|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 92 No. 3 (August 1), 1998:
pp. 877-887
Overexpression of HOX11 Leads to the Immortalization of Embryonic
Precursors With Both Primitive and Definitive Hematopoietic Potential
By
Gordon Keller,
Charles Wall,
Andrew Z.C. Fong,
Teresa S. Hawley, and
Robert G. Hawley
From the National Jewish Medical and Research Center, Denver; the
Department of Immunology, University of Colorado Health Sciences
Center, Denver, CO; and the Oncology Gene Therapy Program, The Toronto
Hospital and Department of Medical Biophysics, University of Toronto,
Toronto, Ontario, Canada.
 |
ABSTRACT |
Primitive and definitive erythropoiesis represent distinct
hematopoietic programs that differ with respect to stage of
development, transcriptional control, and growth regulation. Although
these differences have been recognized for some time, the relationship of the two erythroid lineages to each other is not well established. We
have used a model system based on the hematopoietic development of
embryonic stem (ES) cells in culture to investigate the origins of the
earliest hematopoietic populations. Using ES cells transduced with a
retrovirus that overexpresses the HOX11 gene, we have
established factor-dependent hematopoietic cell lines that represent
novel stages of embryonic hematopoiesis. Analysis of three of these cell lines indicates that they differ with respect to cytokine responsiveness, cell surface markers, and developmental potential. Two
of the cell lines, EBHX1 and EBHX11, display the unique capacity to
generate both primitive and definitive erythroid progeny as defined by
morphology and expression of  H1 and major globin. The third line,
EBHX14, has definitive erythroid and myeloid potential, but is unable
to generate cells of the primitive erythroid lineage. Analysis of the
cytokine responsiveness of the two lines with primitive erythroid
potential has indicated that exposure to leukemia inhibitory factor
(LIF) results in the upregulation of H1 and a change in
cellular morphology to that of primitive erythrocytes. These findings
are the first demonstration of a clonal cell line with primitive and
definitive hematopoietic potential and support the interpretation that
these lineages may arise from a common precursor in embryonic life. In
addition, they suggest that LIF could play a role in the regulation of
primitive erythropoiesis.
© 1998 by The American Society of Hematology.
| |
INTRODUCTION |
THE MURINE EMBRYONIC hematopoietic system
undergoes rapid and dynamic changes in both the lineages produced and
the sites of production.1,2 The earliest stage of
hematopoietic development, known as primitive hematopoiesis, occurs in
the yolk sac blood islands and is restricted primarily to the
generation of a unique population of erythroid cells, commonly referred
to as embryonic or primitive erythrocytes.2-4 These
primitive erythrocytes are large, nucleated and produce the embryonic
forms of globin.3,4 Three to 4 days after the initiation of
yolk sac hematopoiesis, intraembryonic hematopoiesis is established,
initially in the region destined to form the aorta-gonad-mesonephros
and shortly thereafter in the fetal liver.2,5-7 The onset
of fetal liver hematopoiesis marks the switch from the primitive to the
definitive hematopoietic program, which is characterized by the
production of a broad spectrum of lineages including adult type
erythrocytes. These cells differ from their embryonic counterparts in
that they are smaller, enucleate, and produce adult
globins.3,4 With the establishment of the definitive
hematopoietic program, yolk sac hematopoiesis declines and primitive
erythrocytes are no longer produced.
Although these developmental changes within the hematopoietic system
have been well established for many years, the relationship of the
primitive and definitive lineages to one another and the mechanisms
regulating them remain poorly defined. Recent gene targeting studies,
as well as naturally occurring mutations in mice, have provided some
insights into the molecular events involved in the establishment of
primitive and definitive hematopoiesis and have documented clear
differences in the transcriptional regulation and growth control of
these populations. For instance, transcription factors such as
myb8 and acute myeloid leukemia-1 (AML-l;
core-binding factor [CBF] 2)9,10 are
essential for the establishment of definitive hematopoiesis, but appear
to be dispensable for primitive erythropoiesis. The c-kit receptor
tyrosine kinase and its ligand, kit ligand (KL), are essential for
progression into the definitive program, but are not required for the
establishment of primitive erythropoiesis in the yolk
sac.1,11 Similarly, erythropoietin is essential for
maturation of the definitive erythroid lineage, but not for primitive
erythropoiesis.12,13 Together these studies suggest that
primitive and definitive hematopoiesis represent separate developmental
programs that are regulated by different molecular mechanisms and
display different growth requirements.
Further understanding of the relationship between primitive and
definitive hematopoiesis, including the mechanisms involved in the
establishment of the two systems, will require access to early
precursor populations as they develop. Whereas definitive precursors
are present in the liver throughout most of fetal life and in the bone
marrow for all of adult life, the generation of primitive erythroid
precursors is restricted to a narrow window of embryonic development
that precedes the establishment of the yolk sac blood
islands.14 This limited time of development at a stage when
the embryo is extremely small and not readily accessible has made the
isolation and characterization of this population difficult, if not
impossible. To overcome the problem of accessibility of embryonic
hematopoietic precursors, a number of groups have used an in vitro
model system based on the capacity of embryonic stem (ES) cells to
generate hematopoietic precursors in culture.15-17 Analysis
of embryoid bodies (EBs) from the differentiating ES cells has shown
that hematopoietic differentiation in these cultures recapitulates many
aspects of the onset of hematopoietic development in utero, including
the switch from the primitive to the definitive program.18,19
The establishment of hematopoiesis in culture from ES cells not only
provides access to rare, early developing populations, but also
provides a unique system for addressing questions related to the
effects of altered gene expression on hematopoietic precursor development, growth, and differentiation. The outstanding advantage of
this approach is that genes can be introduced at the level of the
starting ES population and subsequently be expressed as the primitive
hematopoietic precursors develop from prehematopoietic mesoderm. In
addition to providing new insights into gene function, overexpression
of genes, particularly those with transforming and/or
immortalizing potential, provides a unique opportunity to establish
cell lines representing various stages of embryonic hematopoietic
development.
Within this context, members of the HOX gene family are of interest, as
recent studies have shown that overexpression of these genes can lead
to selective expansion and in some instances, immortalization of
different hematopoietic precursor populations.20-23 At
least two different HOX genes have been shown to have potent
immortalizing capacity in primary hematopoietic cells. The first,
Hox-2.4 (Hoxb8), whose expression is upregulated in
WEHI-3B tumor cells, is able to immortalize bone marrow-derived
hematopoietic precursors when transduced and expressed in these cells
in the context of a retroviral vector.21 The second,
HOX11, originally identified from translocations in certain
T-cell acute lymphoblastic leukemias, also displays strong
immortalizing potential when transduced into primary mouse bone
marrow-derived precursors.20 Given this capacity to
immortalize adult marrow precursor populations, we were interested in
determining if this class of genes would exhibit similar properties
when overexpressed in embryonic hematopoietic precursors. In this
report, we show that immortalized hematopoietic cell lines can be
generated from ES cell-derived EBs that overexpress the HOX11
gene. The lines generated from these EBs are factor-dependent and
display unique developmental potentials including the capacity to
generate both primitive and definitive erythroid cells. Using these
cell lines, we have identified leukemia inhibitory factor (LIF) as a
potential novel regulator of the primitive erythroid lineage.
| |
MATERIALS AND METHODS |
Retroviral-mediated transfer of the HOX11 gene to ES cells.
The construction of the MSCV-HOX11 and MSCV-NEO (MSCVv2.1) retroviral
vectors and the generation of the corresponding helper-free ecotropic
retroviral vector producer lines GP+E-86/MSCV-HOX11 and
GP+E-86/MSCVv2.1, respectively, have been reported.20,24,25 Virus producer lines were maintained in Dulbecco's modified Eagle medium (DMEM) with 4.5 g/L glucose (Life Technologies, Gaithersburg, MD) supplemented with 10% calf serum (Hyclone Laboratories, Logan, UT)
in a humidified atmosphere containing 5% CO2/95% air at
37°C. Supernatants were collected from subconfluent cultures 24 hours after the medium was changed to DMEM supplemented with 1.5 × 10 4 mol/L monothioglycerol and 15% fetal
calf serum (FCS), filtered through 0.45-mm filters and used immediately
to transduce ES cells. Virus titers were in the range of 4 to 8 × 106 colony-forming units/mL when assayed on NIH3T3
fibroblasts in the presence of 400 µg/mL G418.
ES cell transductions were performed essentially as described for
embryonal carcinoma cells.26 Briefly, 1-mL aliquots of vector supernatants were added to 4 × 105 ES cells
per 60-mm tissue culture dish and the cultures were incubated in the
presence of 4 µg/mL polybrene (hexadimethrine bromide; Sigma, St
Louis, MO) at 37°C for 2 hours. ES cell culture medium (see below)
was added (4 mL) and the incubations were continued at 37°C for 24 hours. This procedure was repeated, and 24 hours later the cell
monolayers were trypsinized into single cell suspensions and
transferred to 100-mm tissue culture dishes. Transduced cells were
selected in 400 µg/mL G418 and the developing colonies were pooled on
day 7 and used in the EB differentiation experiments.
Growth and differentiation of ES cells.
Wild-type CCE ES cells, as well as those transduced with MSCV-HOX11 and
MSCV-NEO retroviral vectors, were maintained on gelatinized flasks in
DMEM supplemented with 15% FCS (Hyclone), penicillin, streptomycin,
1.5 × 104 mol/L monothioglycerol (MTG; Sigma)
and saturating amounts of a Chinese hamster ovary (CHO)
LIF-containing supernatant (1% conditioned medium; CM). Two days
before the initiation of differentiation, cells were transferred to
Iscove's modified Dulbecco's medium (IMDM) containing the above
components. After 2 days of growth in IMDM, ES cells were trypsinized
into a single-cell suspension and plated into differentiation medium
containing 1% methyl cellulose in IMDM supplemented with 15% FCS, 2 mmol/L glutamine (Life Technologies), and 4.5 × 104 mol/L MTG. The differentiation cultures were
performed in Petri grade dishes and maintained in a humidified chamber
in a 5% CO2/air mixture at 37°C for 7 days.
Establishment and maintenance of the EBHX cell lines.
Day 7 EBs generated from ES cells transduced with either the MSCV-HOX11
or the MSCV-NEO virus were dissociated by trypsinization and the cells
cultured in liquid for 2 months. These liquid cultures were performed
in 100-mm Petri grade dishes in IMDM supplemented with 5% FCS,
1.5 × 104 mol/L MTG and either KL
(1% CM) and erythropoietin (Epo) (2 U/mL) or
interleukin-3 (IL-3) (1% CM) and Epo. Duplicate cultures seeded at a
density of 5 × 105 cells/mL were maintained with and
without G418 for each population of cells. Vigorously growing cultures
were either passaged to new dishes or depleted of cells as deemed
necessary to maintain appropriate cell densities. Cells from both the
MSCV-HOX11 and MSCV-NEO containing EBs grew in the presence of G418.
Four and 8 weeks after the initiation of the liquid cultures,
G418R cells from each set of conditions were cultured in
methylcellulose in the presence of appropriate cytokines. Seven to 10 days later, individual colonies from the methylcellulose cultures were
transferred to microtiter wells containing the above described medium.
Rapidly growing populations were passaged to larger cultures and
established as immortalized cell lines. The immortalized lines could be
maintained indefinitely in the presence IMDM, 5% FCS, 1.5 × 104 mol/L MTG and the appropriate cytokines (line
maintenance conditions). Subclones of the EBHX11 line were generated by
single cell micromanipulation, whereas those of EBHX1 were obtained
from colonies generated in methylcellulose under sparse conditions.
These subclones were maintained in the same conditions as the parental
populations.
Differentiation cultures for globin expression analysis.
For analysis of globin expression in colonies, EBHX cells were cultured
in methylcellulose in IMDM supplemented with 5% plasma-derived serum
(PDS; Antech, Tyler, TX), 5% protein-free medium (PFMHII; Life Technologies), glutamine (2 mmol/L), ascorbic acid (50 µg/mL), and appropriate cytokines. Liquid differentiation cultures consisted of
the same components with the exception of the methylcellulose.
Polymerase chain reaction (PCR) globin analysis.
Globin expression patterns in the cell lines were determined using the
global amplification strategy of Brady et al.27 Either individual colonies or small numbers (<1,000) of cells from liquid cultures were lysed in 4 µL of first strand buffer. Reverse
transcription, tailing, and PCR procedures were performed as previously
described,27 with the exception that the (dT)-x
oligonucleotide was shortened to CATCTCGAGCGGCCGC(T)24.
Amplified products from the PCR reaction were separated on an agarose
gel and transferred to a Z-probe GT membrane (Bio-Rad, Richmond,
CA). For analysis of major globin and L32 expression,
the resulting blots were hybridized with 32P randomly
primed cDNA probes corresponding to the 3 region of these genes.
To analyze H1 expression, a probe was prepared by annealing two
oligonucleotides, (5TGGAGTCAAAGAGGGCATCATAGACACATGGG3, 5CAGTACACTGGCAATCCCATGTG3), which share an 8 base
homology at their 3 termini. This H1 specific oligonucleotide
was labeled with 32P using a Klenow fill-in reaction.
Hybridizations were performed using the method of Church and
Gilbert.28 major and L32 cDNA probes were hybridized and
washed at 65°C, while the H1 oligonucleotide probe was
hybridized and washed at 42°C.
RNA preparation and Northern blot analysis.
Poly(A)+ RNA was isolated from the EBHX cell lines using an
oligo(dT)-cellulose column. For expression analysis, 3 to 5 µg of
poly(A)+ RNA from each sample was run in a 1.0% agarose-formaldehyde gel and subsequently transferred to Z-probe GT membrane (Bio-Rad). The
membranes were hybridized with appropriate 32P-labeled cDNA
probes or with the H1 specific oligonucleotide.
Growth factors.
IL-11, IL-6, macrophage colony-stimulating (M-CSF),
granulocyte-macrophage colony-stimulating factor (GM-CSF), and vascular endothelial growth factor (VEGF) were purchased from R & D Systems, Minneapolis, MN. LIF and c-kit ligand were
derived from medium conditioned by CHO cells transfected with LIF and
KL expression vectors (kindly provided by Genetics Institute,
Cambridge, MA). For some experiments, recombinant LIF and
KL (R & D Systems) were used in place of the conditioned medium. IL-3
was obtained from medium conditioned by X63 AG8-653 myeloma cells
transfected with a vector expressing IL-329 or purchased
from R & D Systems.
Fluorescence-activated cell sorting (FACS) analysis.
Immunofluorescence flow cytometric analysis was performed essentially
as described20,30 with saturating concentrations of
affinity-purified rat monoclonal antibodies recognizing murine hematopoietic cell-surface antigens. Fluorescein
isothiocyanate-conjugated reagents included: M1/70HL, anti-CD11b/Mac-1
(Boehringer Mannheim, Laval, Quebec); C71/16, anti-CD18/CD11abc
(PharMingen, San Diego, CA); 2.4G2, anti-CD32/CD16(Fc RII/RIII)
(PharMingen); IM7.8.1, anti-CD44/Ly-24 (obtained from the American Type
Culture Collection, Rockville, MD); 30-F11.1, anti-CD45/Ly-5 (ATCC);
RA3-6B2, anti-CD45R/B220 (PharMingen); 30-H12, anti-CD90.2/Thy-1.2
(PharMingen); and R6B-8C5, anti-Ly-6G/Gr-1 (PharMingen). Biotinylated
reagents included: anti-AA4.1 (generously provided by John McKearn,
Searle Research and Development, Monsanto Co, St Louis, MO);
M1/69.16.11.HL, anti-CD24/HSA (ATCC); PS/2, anti-CD49d/VLA-4
4 (kindly supplied by Paul Kincade, Oklahoma Medical
Research Foundation, Oklahoma City, OK); and E13-161-7,
anti-Sca-1/Ly-6A (a generous gift from Dr Irving Weissman, Stanford
University, Stanford, CA). To prevent nonspecific Fc receptor binding,
cells (106) were first incubated with 1 mL of culture
supernatant from the 2.4G2 anti-CD32/CD16(FcRII/RIII) hybridoma
(ATCC). Biotinylated monoclonal antibodies were developed with
R-phycoerythrin streptavidin (Molecular Probes, Eugene, OR) as a second
step. Viable cells were gated by a combination of forward and
orthogonal light scatter and were analyzed on an Epics Elite flow
cytometer (Coulter Corp, Miami, FL).
Radioimmunoprecipitation analysis of HOX11.
Radiolabeling of proteins and immunoprecipitations were performed
essentially as described.20,30 Briefly, cells (2 × 107) were labeled for 6 hours at 37°C with 300 µCi
[35S]methionine (Amersham Canada Ltd, Oakville, Ontario)
in 1 mL of methionine-deficient DMEM (ICN Biomedicals, Costa Mesa, CA) supplemented with 5% FCS and the appropriate cytokines. Cells were
washed with cold phosphate-buffered saline and lysed in 1 mL of
RIPA buffer (50 mmol/L Tris pH 7.5, 150 mmol/L NaCl, 1% Nonidet P-40, 1% deoxycholate, 0.1% sodium dodecyl sulfate (SDS), 2 mmol/L phenylmethylsulfonyl fluoride) for 30 minutes on ice. The cell
extract was clarified by centrifugation and the lysate was precleared
by incubation with 40 µg of whole mouse IgG (Jackson ImmunoResearch
Laboratories, West Grove, PA) at 4°C overnight and addition of 100 µL formalin-treated S aureus cells (Pansorbin, Calbiochem-Novabiochem Corp, San Diego, CA). The HOX11 proteins were
precipitated with 5 µL rabbit HOX11 antiserum (kindly
provided by Ming Lu, University of California, San Diego, CA) for 1 hour at 4°C and the immune complexes were collected with 75 µL of
100 mg/mL protein A sepharose CL-4B (Pharmacia Biotech, Baie
D'Urfé, Quebec) in phosphate-buffered saline. The
immunoprecipitates were washed four times (once in RIPA buffer, once in
RIPA buffer containing 0.5 mol/L NaCl, followed by two additional
washes in RIPA buffer alone) and resuspended in 30 µL of Laemmli
sample buffer (2% SDS, 10% glycerol, 60 mmol/L Tris pH 6.8, 0.001%
bromphenol blue) containing 100 mmol/L dithiothreitol. Samples were
boiled for 3 minutes and electrophoresed through 12%
SDS-polyacrylamide gels. Dried gels were exposed to Kodak XAR-5 film
(Eastman Kodak company, Rochester, NY).
| |
RESULTS |
Establishment of EBHX cell lines.
To overexpress HOX11 in early embryonic hematopoietic populations, ES
cells were transduced with the MSCV-HOX11 retrovirus, which expresses
the HOX11 gene from the LTR promoter and the selectable neo gene from a downstream internal pgk
promoter.20,24 Transduced ES cells were selected in G418
for 7 days and then used for the generation of EBs as outlined in
Fig 1A. Control ES cells were transduced
with MSCV-NEO expressing only the neo gene. Analysis of EBs
generated from MSCV-HOX11-transduced ES cells demonstrated the presence
of HOX11 mRNA and protein, as well as neo transcripts (Fig 1B and C),
indicating that the vector maintained expression of both the
HOX11 and neo genes throughout the ES differentiation period.
View larger version (40K):
[in this window]
[in a new window]
| Fig 1.
(A) Protocol used to generate EBHX cell lines. (B)
Immunodetection of HOX11 protein (37 kD, arrow) in EBHX cell lines by
immunoprecipitation of radiolabeled proteins with HOX11-specific
antiserum. PGMD1, an IL-3-dependent myeloid progenitor line used as
negative control; HX3, a bone marrow-derived HOX11-immortalized line
used as positive control; EBHX, day 6 EBs generated from MSCV-HOX11
transduced ES cells; EBHX1, EBHX4, EBHX11, three EB-derived
HOX11-immortalized cell lines. (C) Northern blot analysis with a neo
probe demonstrating LTR-directed (4.0 kb) HOX11 mRNA (which contains
downstream neo sequences) and pgk-directed (1.3 kb) neo mRNA in EBHX
cell lines. CCE ES, wild-type ES cells; ES/HOX11, MSCV-HOX11 transduced
ES cells; 3T3/HOX11, NIH3T3 fibroblasts transduced with the MSCV-HOX11 vector.
|
|
Seven days after the initiation of ES differentiation, the developing
EBs were dissociated and the cells cultured in liquid, either in the
presence of IL-3 and Epo or in the presence of KL and Epo. Precursor
analysis did not show any significant difference in the hematopoietic
potential of the HOX11 expressing and control EBs at this stage of
development. Four and 8 weeks later, cells from both sets of conditions
were assayed in methylcellulose in the presence of the same cytokines
used in the liquid cultures. At both time points, there were clear
differences in the types of colonies that grew from the HOX11
expressing cells compared with the NEO control cells. All colonies in
the control cultures had similar morphologies and were found to contain
only mast cells. In contrast, HOX11-expressing cells generated colonies
that displayed significant heterogeneity with respect to cell size and
the degree of disperseness of the cells within the colonies. In
addition, a significant number of the colonies in these cultures
developed hemoglobinized erythroid cells. Many of the colonies derived
from the HOX11 expressing EBs consisted of a mixture of maturing
hematopoietic cells together with cells with an immature morphology.
Individual colonies from cultures at both time points were transferred
to microtiter wells in their respective conditions (IL-3/Epo or KL/Epo) in the presence of G418. At this stage, immortalized cell lines could
be established from approximately 10% of these colonies. Medium to
large colonies with an obvious undifferentiated component were most
efficient at generating cell lines. A total of 16 embryoid body-derived
HOX11 (EBHX) lines were established in the initial experiment, 10 from
the IL-3/Epo cultures and 6 from the KL/Epo cultures.
Based on differences in cell morphology, 3 lines were selected for
further characterization. These included EBHX11 isolated at 8 weeks
from the KL/Epo cultures and EBHX14 and EBHX1 isolated at 4 and 8 weeks, respectively, from the IL-3/Epo cultures. Two additional lines,
EBHX15 and EBHX4, established from the IL-3/Epo cultures at 4 and 8 weeks, as well as subclones of EBHX1 (EBHX1-C7) and EBHX11 (EBHX11-15),
were included in some of the analyses. To determine if HOX11 was
involved in the immortalization event, three of the lines were analyzed
for the presence of HOX11 protein. As shown in Fig 1B, HOX11 protein
was detected in EBHX1, EBHX4, and EBHX11. In addition, all three lines
also expressed neo mRNA (Fig 1C). These findings demonstrate that the
MSCV retroviral vector is able to maintain expression of both
transduced genes in the EB-derived cell lines and is consistent with
the interpretation that HOX11 is essential for their generation.
EBHX1, EBHX11, and EBHX14 cells display strikingly different
morphologies. EBHX1 consists of two cell types, medium to small cells
with erythroid characteristics and large megakaryocyte-like cells
(Fig 2A). EBHX11 cells are relatively
homogeneous in size and have an erythroblastic morphology (Fig 2B),
whereas EBHX14 cells show signs of both erythroid and myeloid
differentiation potential (Fig 2C). EBHX4 cells were almost identical
to those of the EBHX1 line, whereas EBHX15 cells display erythroid and myeloid morphology, similar to EBHX14 cells (not shown).
View larger version (52K):
[in this window]
[in a new window]
| Fig 2.
Morphology of cells in three different EBHX cell lines.
EBHX1 (A), EBHX11 (B), and EBHX14 (C). Cells were stained with
May-Grünwald and Giemsa. Original magnification × 1,000.
|
|
Growth factor responsiveness of EBHX cell lines.
To further define the developmental potential of the EBHX lines, their
growth responsiveness to different cytokines in methylcellulose cultures was next analyzed. The cytokines tested included IL-2, IL-3,
IL-4, IL-6, IL-7, IL-11, Epo, thrombopoietin (TPO), KL, G-CSF, GM-CSF, M-CSF, LIF, insulin-like growth factor-1
(IGF-1), VEGF, and basic fibroblast growth factor
(FGF). Only data for cytokines found to have a growth
promoting activity are shown (Fig 3). None
of the lines generated colonies in the absence of growth factors,
demonstrating a strict dependence on cytokines for growth in
methylcellulose. Of the three lines analyzed, EBHX1 cells responded to
the broadest spectrum of cytokines, showing the highest response to
IL-3. These cells also responded to Epo, LIF, IL-4, TPO, and IL-6.
EBHX11 cells responded best to LIF, but did show significant responses
to Epo and IL-3. Although the EBHX11 line was generated in the presence
of KL and Epo, the cells showed no significant growth response to KL,
either alone or together with Epo. Nevertheless, the cells are
routinely maintained in KL and Epo, as they do express the c-kit
encoded receptor (see below) and the interaction with KL may be
important to preserve the potential of the line. EBHX14 cells respond
to IL-3 and GM-CSF, consistent with the interpretation that they have
myeloid potential. Colony growth by this line was somewhat cell
density-dependent and was best at concentrations of 1 × 104 to 5 × 104 cells per mL. None of the
lines showed a significant growth response to M-CSF, G-CSF, IL-2, IL-7,
IL-11, KL, VEGF, basic FGF, or IGF-1. Combinations of factors were not
extensively tested, with the exception of the large mixture used to
measure the maximal growth response and the combination of IL-3/Epo or
KL/Epo used for cell line maintenance. The cytokine responsiveness of
the subclones, EBHX1-C7 and EBHX1-15, was identical to that of the
parental lines (not shown).
View larger version (23K):
[in this window]
[in a new window]
| Fig 3.
Growth factor responsiveness of EBHX cell lines. EBHX
cells were cultured in methylcellulose in the presence of the indicated cytokines and the developing colonies scored 7 to 8 days later. EBHX1
cells were cultured at 1 × 104 to 5 × 104
cells/mL, EBHX11 at 250 to 750 cells/mL, and EBHX 14 at 1 × 104 to 5 × 104 cells/mL. Maximum response was
determined by the number of colonies that grew in response to a broad
mixture of cytokines, which included IL-3, IL-6, IL-11, Epo, KL, LIF,
GM-CSF, G-CSF, and M-CSF. Colony-forming cell frequencies in this
mixture were approximately 14% for EBHX1, 50% for EBHX11, and 20%
for EBHX14. Cytokines were used at the following concentrations: IL-2,
1% conditioned medium; IL-3, 1 ng/mL; IL-6, 5 ng/mL; IL-7, 16 ng/mL;
IL-11, 25 ng/mL; Epo, 2 U/mL; KL, 100 ng/mL; LIF, 1 ng/mL; IL-4, 1% conditioned medium; TPO, 5 ng/mL; G-CSF, 30 ng/mL;
GM-CSF, 15 ng/mL; M-CSF, 5 ng/mL; IGF-1, 5 ng/mL; and basic FGF, 10 ng/mL. Bars represent standard error of the mean (SEM) from three
independent experiments.
|
|
The strong response of EBHX11 cells to LIF and Epo suggested that
cytokines other than the combination of KL/Epo might be able to support
their growth for an extended period of time. To address this question,
EBHX11 cells were passaged from KL/Epo to cultures containing either
LIF or only Epo. In both conditions, the cells survived, grew, and
could be easily maintained over a 6-month period without any apparent
signs of senescence. Although there were no obvious significant
differences in the growth rate of these populations, the cells
maintained in LIF, EBHX11L, were more adhesive than the parental cells
and tended to grow in clusters, particularly at high cell density. The
cells grown in Epo, EBHX11E, were similar to those maintained in
KL/Epo. In addition to these adhesive differences, EBHX11L cells
showed different patterns of globin gene expression compared to
EBHX11 and EBHX11E cells (see below).
Surface phenotype of EBHX cell lines.
To better define the lineage relationship of the EBHX lines, their
cell-surface phenotype was determined by immunofluorescence flow
cytometric analysis using a panel of monoclonal antibodies directed
against hematopoietic cell surface antigens. A summary of the analysis
of five different lines is presented in
Table 1. EBHX1 and EBHX4 exhibited similar
expression patterns that included low levels of Thy-1 and high levels
of the low-affinity Fc receptor, FcRII/III, found on myeloid,
B-cell, T-cell, and natural killer cell precursors.31,32 In
addition, cells from these two lines expressed the hyaluronan receptor
CD44 found on most hematopoietic precursors,33 the integrin
very late antigen (VLA)-4 present on precursors and
differentiated myeloid and lymphoid cells,34 and lymphocyte
function-associated antigen (LFA)-1/CD18 found on most
leukocytes.35 A subpopulation of EBHX1, but not of EBHX4,
also expressed TER-119, an erythroid lineage-restricted antigen.36 The cells from these two lines did not express
AA4.1, a marker found on fetal liver stem cells and
precursors,37 Sca-1 (Ly-6A) found on fetal liver and adult
marrow stem cells,38-40 heat stable antigen (HSA), and the
panleukocyte antigen CD45, markers found on most hematopoietic
precursors,35 Gr-1, a marker of the granulocyte
lineage,41 Mac-1, a myeloid differentiation antigen,35 and B220, a marker of the B-cell
lineage.42 EBHX14 and EBHX15 also showed similar expression
patterns and displayed the broadest spectrum of surface markers of all
lines tested. Both lines contain subpopulations of cells that expressed
AA4.1, TER-119, Mac-1, and Gr-1. In addition, these lines also
expressed Thy-1, FcRII/III, CD44, VLA-4, and CD18. The expression
pattern of these two lines did differ in that EBHX15 expressed CD45,
intercellular adhesion molecule (ICAM)-1, HSA, and no
detectable Sca-1, whereas EBHX14 expressed very low levels of CD45 and
HSA and no detectable ICAM-1. In addition, a small subpopulation of
EBHX14 did express Sca-1. EBHX11 cells showed the most restricted
pattern of the lines tested and were found to express only CD44, VLA-4,
HSA, and ICAM. The results from the surface marker analysis further documents differences between these lines and suggest that EBHX14 and
EBHX15 contain the most immature cell types, as defined by AA4.1
expression, EBHX-1 and EBHX4 represent intermediate stage cells, and
EBHX11 represents a relatively late stage population.
Gene expression analysis of EBHX cell lines.
Given these observed differences in the lines, we were next interested
in determining their patterns of specific receptor, transcription
factor, and globin gene expression. Included in this analysis were
EBHX1, EBHX11, and EBHX14, as well as the subpopulations of EBHX11 that
were maintained in either LIF (EBHX11L) or Epo (EBHX11E). All of the
lines, which responded to LIF, expressed two isoforms of the LIF
receptor gene,43 a large message of approximately 10 kb and
a smaller message of approximately 4.5 kb
(Fig 4). Similarly, all of the lines that
showed a response to Epo alone expressed the Epo receptor. c-Kit mRNA
was detected in all of the lines consistent with the interpretation
that they represent early hematopoietic precursor populations. EBHX1
was the only cell line that expressed flk-1, suggesting that it
could represent an early stage of embryonic hematopoietic development, a stage characterized by expression of this receptor.19
With respect to transcription factors, all lines expressed tal-1/SCL a
member of the helix-loop-helix family of factors that is found in early
hematopoietic cells and required for the establishment of the embryonic
hematopoietic system.44-46 In addition, all of the lines
expressed GATA-1, a transcription factor normally found in cells of the
erythroid, mast cell, and megakaryocytic lineages.47 However, in this case, EBHX1 and EBHX11, which contain Epo-responsive erythroid precursors, showed higher levels of GATA-1 expression than
EBHX14, which contains less mature precursors that require both IL-3
and Epo for growth.
View larger version (66K):
[in this window]
[in a new window]
| Fig 4.
Expression analysis of EBHX cell lines. (A) Northern blot
analysis of receptor and transcription factor gene expression. (B) Northern blot analysis of globin gene expression. The relative amounts
of RNA loaded are indicated by hybridization to the probe specific for
glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Cells
from day 4.5 EBs were included as a control (C).
|
|
In contrast to the above expression patterns, the globin analysis
showed some unexpected and important differences among the lines.
EBHX11, EBHX11L, and EBHX11E all expressed major globin, consistent
with the interpretation that they represent erythroid precursors at a
late stage of maturation. EBHX1 and EBHX14 did not express detectable
amounts of major globin, suggesting that the erythroid precursors in
these lines represent an intermediate stage of development. Although
EBHX11, EBHX11L, and EBHX11E expressed comparable levels of adult
goblin, they displayed striking differences in the levels of H1
expression. The parental line grown in the presence of KL/Epo showed
little H1 expression, whereas the subpopulation maintained in LIF
expressed significant levels of this embryonic globin. The line
maintained in Epo showed low, but detectable, levels of H1. In
addition to EBHX11L, EBHX1 also expressed some H1. H1 expression
was not detected in EBHX14 cells. The presence of cells that express
H1 suggests that lines EBHX1 and EBHX11 have the potential to
generate cells of the primitive erythroid lineage. Furthermore, the
high levels of H1 in EBHX11L cells indicates that LIF could be an
important mediator in the upregulation of this embryonic globin and
possibly in establishing the primitive erythroid program.
Primitive and definitive erythroid potential of the EBHX cell lines.
To further explore the primitive and definitive potential of these
lines, EBHX11 cells were cultured in methylcellulose in the presence of
LIF or Epo and the cells analyzed for globin expression patterns and
morphologic characteristics of these lineages. Epo was used in place of
KL/Epo, as studies subsequent to the Northern blot analysis indicated
that EBHX11 cells do not express significant levels of H1 when
cultured in the presence of this cytokine. Colonies generated in both
sets of conditions showed visible signs of hemoglobinization
(Fig 5A and C), but did display distinct differences in morphology. In the presence of LIF, the colonies had a
tighter, more compact appearance than those generated in response to
Epo. More than 50% of the cells within the LIF-stimulated colonies
were large and displayed characteristics of primitive erythrocytes (Fig
5B). The remainder of these colonies typically consisted of
undifferentiated cells and cells with a definitive erythroid
morphology. In contrast, the majority of the cells in the
Epo-stimulated colonies were significantly smaller than those in the
LIF-stimulated colonies and had the morphology of cells of the
definitive erythroid lineage (Fig 5D). The Epo-stimulated colonies also
contained some cells with an undifferentiated morphology. Similar
differences were observed in colonies generated from the EBHX11-15
subclone and from EBHX1 cells in these two sets of conditions (not
shown).
View larger version (99K):
[in this window]
[in a new window]
| Fig 5.
EBHX11-derived colonies and cells. (A) Colonies grown in
the presence of LIF for 7 days. (B) Cells from LIF-stimulated colonies. (C) Colony grown in the presence of Epo for 7 days. (D) Cells from
Epo-stimulated colonies. Original magnification for (A and C), ×200
and for (B and D), ×1,000.
|
|
Globin analysis of the colony-derived cells from these two conditions
confirmed the morphologic differences. Colonies generated from EBHX11,
EBHX11-15, or EBHX1 in the presence of LIF or LIF/Epo expressed readily
detectable levels of H1 (Fig 6). In
contrast, those generated in the presence of Epo, KL/Epo, or IL-3/Epo
showed little, if any, embryonic globin expression. The lack of
significant H1 expression in EBHX11-derived colonies generated in
the presence of Epo or in EBHX1-derived colonies grown in the presence
of IL-3 and Epo differs from the previous Northern blot analysis, which demonstrated low levels of embryonic globin in these populations. These
differences could reflect differences in the culture conditions used
for cell line maintenance compared with those used for differentiation (see Materials and Methods). major was expressed in colonies generated in all conditions, although in many experiments EBHX11 colonies or cells grown in the presence of LIF expressed lower levels
of the adult globin than those grown in the presence of Epo or KL/Epo
(see also Fig 7). Erythroid colonies
generated from EBHX14 cells in the presence of IL-3/Epo or in the
presence of IL-3/LIF/Epo did not express detectable levels of H1.
Together, these findings strongly suggest that lines EBHX11, the
subclone EBHX11-15 and EBHX1, have the potential to generate cells of
the primitive and definitive erythroid lineages and that LIF is an important regulator of the primitive erythroid program.
View larger version (91K):
[in this window]
[in a new window]
| Fig 6.
Globin expression analysis of EBHX-derived colonies.
Colonies were grown in the indicated cytokines for 7 days and then
picked and analyzed for H1 and major expression by Poly(A) PCR.
The analysis of three individual colonies is shown for each set of conditions. EBHX11-15 is a subclone of EBHX11. Control Ep
represents primitive erythroid colonies grown from day 6 EB precursors, control Ed are definitive erythroid colonies generated from
fetal liver precursors, and control M are macrophage colonies grown
from day 6 EB-derived precursors. N represents PCR reagents with no
cells added. Expression of the ribosomal L32 gene was used as an
indication of the amount of material in each lane. Cytokines were used
at the concentrations indicated in the legend to Fig 3.
|
|
View larger version (44K):
[in this window]
[in a new window]
| Fig 7.
Globin expression analysis of EBHX11 and EBHX11L cells
grown under different conditions. Cells were seeded into microtiter wells at a concentration of 30 or 100 cells per well, maintained in the
indicated cytokines for 7 days, and then analyzed for H1 and
major expression by Poly(A) PCR. Three samples from each set of
conditions are shown. T0 represents the starting
populations. Controls are the same as those in Fig 6. Expression of the
ribosomal L32 gene was used as an indication of the amount of material
in each lane.
|
|
The previous data indicated that switching EBHX11 cells from KL/Epo to
LIF results in the onset of a primitive erythroid program characterized
by the generation of large cells with the morphology of primitive
erythrocytes, which express H1 globin. We were next interested in
determining if EBHX cells exposed to LIF were still able to generate
cells with a definitive phenotype when removed from LIF and cultured in
KL/Epo. To address this question, EBHX11L cells that were maintained in
LIF for 6 months were cultured in microtiter wells in the presence of
LIF, KL/Epo, or Epo. As a control, parental EBHX11 cells were cultured
under identical conditions. After 7 days of culture, both lines showed
similar changes in goblin gene expression in response to the different
cytokines (Fig 7). In the presence of LIF, both EBHX11L and EBHX11
cells expressed readily detectable levels of H1 as expected.
However, when cultured in KL/Epo or Epo alone, EBHX11L cells
downregulated H1 expression, indicating that the line maintained in
LIF retained the capacity to generate cells with a definitive erythroid
phenotype.
| |
DISCUSSION |
In this report we describe the generation and characterization of novel
hematopoietic cell lines from EBs that were genetically modified to
overexpress the HOX11 gene. All of the established EBHX lines
analyzed expressed the HOX11 gene originally transduced into
the starting ES population, all retained factor dependency, and all
showed some capacity to differentiate. Several features of these cell
lines distinguish them from virtually all other hematopoietic cell
lines established to date. First, they were generated from day-7 EBs, a
population representative of the embryonic or yolk sac phase of
hematopoiesis.18,19 Most other hematopoietic cell lines
have been derived from fetal or adult precursors. Second, at least two
of the cell lines display the unique capacity to generate both
primitive and definitive erythroid progeny. To our knowledge, this is
the first demonstration of a clonal cell line with both primitive and
definitive hematopoietic potential.
The developmental potential of the EBHX cell lines, summarized in
Fig 8, raises some important questions with
respect to the origin of the primitive and definitive erythroid
lineages. Studies in both the avian and murine systems have provided
evidence that primitive erythropoiesis and definitive hematopoiesis
arise at distinct times and sites during embryogenesis and as such
suggest that these populations derive from separate
precursors.48-50 Further support for this concept was
provided by findings, which demonstrated that the primitive and
definitive erythroid lineages can arise from separate precursors in
developing EBs.51 While these observations are consistent
with the interpretation that these lineages have separate origins,
several studies have challenged this notion and provided evidence
indicating they arise from a common precursor early in
development.52,53 The restricted potential of EBHX11 and
its subclone, EBHX11-15, further supports the concept of a common
ancestor for primitive and definitive hematopoiesis and suggests that,
at early stages of development, the primitive and definitive
erythroid lineages develop from an erythroid committed precursor. One
concern with these interpretations is that they are based on the
potential of immortalized cell lines, which may not accurately reflect
potential of normal embryonic precursors. Our current studies are
focused on the identification of comparable precursor populations in
EBs and developing embryos.
View larger version (13K):
[in this window]
[in a new window]
| Fig 8.
Summary of the developmental potential of three EBHX cell
lines. Meg, megakaryocyte; Eryp, primitive erythroid;
Eryd, definitive erythroid.
|
|
The capacity to respond to LIF defines two separate populations of
erythroid precursors represented by the different EBHX lines.
LIF-responsive cells found in the EBHX11 line have both primitive and
definitive erythroid potential and may be representative of precursors
found in the yolk sac blood islands. The LIF nonresponsive population
present in the EBHX14 line is unable to generate primitive erythroid
progeny and could be the equivalent of the earliest definitive
precursors found in the fetal liver. The correlation of LIF
responsiveness with primitive erythroid potential suggests that this
molecule could be a regulator of yolk sac erythropoiesis. This is an
important observation as regulation of the growth and maturation of
this early erythroid lineage is not well defined. The only known
cytokine that stimulates primitive erythroid precursors in culture is
Epo and, as with the definitive erythroid lineage, it appears to act at
the equivalent of the CFU-E stage of development.15 Although Epo can stimulate these precursors in culture, studies on Epo
and Epo receptor knockout mice demonstrate that this cytokine is not
essential for development of the lineage in vivo and suggest that other
growth regulators are involved.12,13
Although our data implicate LIF as a possible regulator of primitive
erythropoiesis, analysis of knockout mice indicates that this factor is
not essential for development of this lineage in the embryonic yolk
sac. Mice lacking LIF or gp130, the signaling component of the LIF
receptor, survive through embryonic development, suggesting that
neither the ligand nor the normal receptor complex is absolutely
required for primitive erythropoiesis.54-56 However, as the
early erythroid population in these animals was not characterized, it
is not known if this lineage was negatively affected by these mutations. The fact that the LIF receptor is expressed in the EBHX
lines would suggest that LIF or a LIF-like molecule that can bind this
receptor does play some role in the regulation of the primitive
erythroid lineage. Preliminary studies indicate that other cytokines
that signal through gp130 including IL-6, IL-11, and oncostatin M are
unable to mediate the switch to the primitive phenotype, suggesting
that the effect could be specific to LIF (unpublished observation,
1997). Future studies will determine whether other
molecules, either known or novel, have effects similar to those of LIF.
Immortalization of EB-derived embryonic precursors by HOX11 confirms
and extends our earlier findings that constitutive expression of HOX11
immortalized bone marrow-derived precursors,20,30 and
further demonstrates the potential of this class of genes to
dramatically alter growth regulation within the hematopoietic system.
In particular, our current studies document that HOX11 can affect the
growth and development of embryonic hematopoietic precursors. In an
earlier study, Helgason et al23 showed that deregulated
expression of HOXB4 resulted in an expansion of the multipotential and
erythroid precursor pool in EBs. However, overexpression of this
particular HOX gene did not lead to the immortalization of these
precursors. The strong immortalizing potential of HOX11 in the
different hematopoietic populations raises important questions as to
mechanisms of action. A recent study suggests that HOX11 can disrupt
cell cycle checkpoints through interaction with specific protein
phosphatases.57 Whether or not this is its primary mode of
action in the EBHX lines remains to be determined.
In summary, we have shown that ectopic HOX11 expression in EBs leads to
the immortalization of embryonic hematopoietic precursors. The EBHX
cell lines derived from these precursors are representative of
different stages of embryonic hematopoietic development and are the
first to demonstrate both primitive and definitive potential. Using
these lines, we have obtained evidence suggesting that LIF could play a
role in the regulation of the primitive erythroid program. The
availability of these lines provides a unique opportunity to further
characterize the growth regulation of the primitive erythroid lineage,
as well as to define the molecular events involved in its
establishment.
| |
FOOTNOTES |
Submitted January 14, 1998;
accepted March 27, 1998.
Supported in part by Grant No. R01 HL48834A from the National
Institutes of Health, Bethesda, MD, and by the National
Cancer Institute of Canada, Toronto, Canada, (8398) with funds from the Canadian Cancer Society (to R.G.H.).
Address reprint requests to Gordon Keller, PhD, National
Jewish Medical and Research Center, 1400 Jackson St, Denver, CO 80206; e-mail: kellerg{at}njc.org.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.
| |
ACKNOWLEDGMENT |
We thank Ming Lu for the HOX11 antiserum, Scott Robertson, Georges
Lacaud, Mitch Weiss, and Suzanne Kirby for critically reading the
manuscript, and Leigh Landskroner for expert assistance with graphics
and photography.
| |
REFERENCES |
1.
Russell E:
Heriditary anemias of the mouse: A review for geneticists.
Adv Genet
20:357,
1979[Medline]
[Order article via Infotrieve]
2.
Moore M,
Metcalf D:
Ontogeny of the hematopoietic system: Yolk sac origin of in vivo and in vitro colony forming cells in the developing mouse embryo.
Br J Haematol
18:279,
1970[Medline]
[Order article via Infotrieve]
3.
Barker J:
Development of the mouse hematopoietic system I. Types of hemoglobin produced in embryonic yolk sac and liver.
Dev Biol
18:14,
1968[Medline]
[Order article via Infotrieve]
4.
Brotherton T,
Chui D,
Gauldie J,
Patterson M:
Hemoglobin ontogeny during normal mouse fetal development.
Proc Natl Acad Sci USA
76:2853,
1979[Abstract/Free Full Text]
5.
Johnson G,
Barker D:
Erythroid progenitor cells and stimulating factors during murine embryonic and fetal development.
Exp Hematol
13:200,
1985[Medline]
[Order article via Infotrieve]
6.
Godin I,
Dieterlen-Lievre F,
Cumano A:
Emergence of multipotent hemopoietic cells in the yolk sac and paraaortic splanchnopleura in mouse embryos, beginning at 8.5 days postcoitus.
Proc Natl Acad Sci USA
92:773,
1995[Abstract/Free Full Text]
7.
Muller AM,
Medvinsky A,
Strouboulis J,
Grosveld F,
Dzierzak E:
Development of hematopoietic stem cell activity in the mouse embryo.
Immunity
1:291,
1994[Medline]
[Order article via Infotrieve]
8.
Mucenski M,
McLain K,
Kier A,
Swerdlow S,
Schreiner C,
Miller T,
Pietryga D,
Scott JW,
Potter S:
A functional c-myb gene is required for normal murine fetal hepatic hematopoiesis.
Cell
65:677,
1991[Medline]
[Order article via Infotrieve]
9.
Okuda T,
Van Deursen J,
Hiebert S,
Grosveld G,
Downing JR:
AML1, the target of multiple chromosomal translocations in human leukemia, is essential for normal fetal liver hematopoiesis.
Cell
84:321,
1996[Medline]
[Order article via Infotrieve]
10.
Wang Q,
Stacy T,
Binder M,
Marin-Padilla M,
Sharpe A,
Speck N:
Disruption of the Cbfa2 gene causes necrosis and hemorrhaging in the central nervous system and blocks definitive hematopoiesis.
Proc Natl Acad Sci USA
93:3444,
1996[Abstract/Free Full Text]
11.
Nocka K,
Majumder S,
Chabot B,
Ray P,
Cervone M,
Bernstein A,
Besmer P:
Expression of c-kit gene products in known cellular targets of W mutations in normal and W mutant mice-evidence for an impaired c-kit kinase in mutant mice.
Genes Dev
3:816,
1989[Abstract/Free Full Text]
12.
Wu H,
Liu X,
Jaenisch R,
Lodish H:
Generation of committed erythroid BFU-E and CFU-E progenitors does not require erythropoietin or the erythropoietin receptor.
Cell
83:59,
1995[Medline]
[Order article via Infotrieve]
13.
Lin C,
Lim S,
DAgati V,
Costantini F:
Differential effects of an erythropoietin receptor gene disruption on primitive and definitive erythropoiesis.
Genes Dev
10:154,
1996[Abstract/Free Full Text]
14.
Wong P,
Chung S,
Chui D,
Eaves C:
Properties of the earliest clonogenic hemopoietic precursor to appear in the developing murine yolk sac.
Proc Natl Acad Sci USA
83:3851,
1986[Abstract/Free Full Text]
15.
Keller G,
Kennedy M,
Papayannopoulou T,
Wiles M:
Hematopoietic commitment during embryonic stem cell differentiation in culture.
Mol Cell Biol
13:473,
1993[Abstract/Free Full Text]
16.
Schmitt R,
Bruyns E,
Snodgrass H:
Hematopoietic development of embryonic stem cells in vitro: Cytokine and receptor gene expression.
Genes Dev
5:728,
1991[Abstract/Free Full Text]
17.
Burkert U,
von Ruden T,
Wagner EF:
Early fetal hematopoietic development from in vitro differentiated embryonic stem cells.
New Biol
3:698,
1991[Medline]
[Order article via Infotrieve]
18.
Keller G:
In vitro differentiation of embryonic stem cells.
Curr Opin Cell Biol
7:862,
1995[Medline]
[Order article via Infotrieve]
19.
Kabrun N,
Buhring HJ,
Choi K,
Ullrich A,
Risau W,
Keller G:
Flk-1 expression defines a population of early embryonic hematopoietic precursors.
Development
124:2039,
1997[Abstract]
20.
Hawley RG,
Fong AZC,
Lu M,
Hawley TS:
The HOX11 homeobox-containing gene of human leukemia immortalizes murine hematopoietic precursors.
Oncogene
9:1,
1994[Medline]
[Order article via Infotrieve]
21.
Perkins AC,
Cory S:
Conditional immortalization of mouse myelomonocytic, megakaryocytic and mast cell progenitors by the Hox-2.4 homeobox gene.
EMBO J
12:3835,
1993[Medline]
[Order article via Infotrieve]
22.
Sauvageau G,
Thorsteinsdottir U,
Eaves C,
Lawrence HJ,
Largman C,
Lansdorp PM,
Humphries RK:
Overexpression of HOXB4 in hematopoietic cells causes the selective expansion of more primitive populations in vitro and in vivo.
Genes Dev
9:1753,
1995[Abstract/Free Full Text]
23.
Helgason CD,
Sauvageau G,
Lawrence HJ,
Largman C,
Humphries RK:
Overexpression of HOXB4 enhances the hematopoietic potential of embryonic stem cell differentiated in vitro.
Blood
87:2740,
1996[Abstract/Free Full Text]
24.
Hawley RG,
Lieu FHL,
Fong AZC,
Hawley TS:
Versatile retroviral vectors for potential use in gene therapy.
Gen Ther
1:136,
1994[Medline]
[Order article via Infotrieve]
25.
Hawley RG,
Hawley TS,
Fong AZC,
Quinto C,
Collins M,
Leonard JP,
Goldman SJ:
Thrombopoietic potential and serial repopulating ability of murine hematopoietic stem cells constitutively expressing interleukin-11.
Proc Natl Acad Sci USA
93:10297,
1996[Abstract/Free Full Text]
26.
Hawley TS,
Sabourin LA,
Hawley RG:
Comparative analysis of retroviral vector expression in mouse embyonal carcinoma cells.
Plasmid
22:120,
1989[Medline]
[Order article via Infotrieve]
27.
Brady G,
Barbara M,
Iscove N:
Representative in vitro cDNA amplification from individual hemopoietic cells and colonies.
Methods Mol Cell Biol
2:17,
1990
28.
Church GM,
Gilbert W:
Genomic sequencing.
Proc Natl Acad Sci USA
81:1991,
1984[Abstract/Free Full Text]
29.
Karasuyama H,
Melchers F:
Establishment of mouse cell lines which constitutively secrete large quantitites of interleukin 2, 3, 4, or 5 using modified cDNA expression vectors.
Eur J Immunol
18:97,
1988[Medline]
[Order article via Infotrieve]
30.
Hawley RG,
Fong AZC,
Reis MD,
Zhang N,
Lu M,
Hawley TS:
Transforming function of the HOX11/TCL3 homeobox gene.
Cancer Res
57:337,
1997[Abstract/Free Full Text]
31.
Rodewald H-R,
Moingeon P,
Lucich J,
Dosiou C,
Lopez P,
Reinherz E:
A population of early fetal thymocytes expressing FcRII/III contains precursors of T lymphocytes and natural killer cells.
Cell
69:139,
1992[Medline]
[Order article via Infotrieve]
32.
Carlsson L,
Candeias S,
Staerz U,
Keller G:
Expression of FcRIII defines distinct subpopulations of fetal liver B cell and myeloid precursors.
Eur J Immunol
25:2308,
1995[Medline]
[Order article via Infotrieve]
33.
Miyake K,
Medina KL,
Hayashi S,
Ono S,
Hamaoka T,
Kincade PW:
Monoclonal antibodies to Pgp-1/CD44 block lympho-hemopoiesis in long-term bone marrow cultures.
J Exp Med
171:477,
1990[Abstract/Free Full Text]
34.
Hemler ME:
VLA proteins in the integrin family: Structures, functions, and their role on leukocytes.
Annu Rev Immunol
8:365,
1990[Medline]
[Order article via Infotrieve]
35.
Miller BA,
Antognetti G,
Springer TA:
Identification of cell surface antigens present on murine hematopoietic stem cells.
J Immunol
134:3286,
1985[Abstract]
36.
Ikuta K,
Kina T,
MacNeil I,
Uchida N,
Peault B,
Chien Y-H,
Weissman IL:
A developmental switch in thymic lymphocyte maturation potential occurs at the level of hematopoietic stem cells.
Cell
62:863,
1990[Medline]
[Order article via Infotrieve]
37.
Jordan C,
McKearn J,
Lemischka I:
Cellular and developmental properties of fetal hematopoietic stem cells.
Cell
61:953,
1990[Medline]
[Order article via Infotrieve]
38.
Spangrude G,
Heimfeld S,
Weissman I:
Purification and characterization of mouse hematopoeitic stem cells.
Science
241:58,
1988[Abstract/Free Full Text]
39.
Morrison SJ,
Hemmati HD,
Wandycz AM,
Weissman IL:
The purification and characterization of fetal liver hematopoietic stem cells.
Proc Natl Acad Sci USA
92:10302,
1995[Abstract/Free Full Text]
40.
Trevisan M,
Iscove NN:
Phenotypic analysis of murine long-term hemopoietic reconstituting cells quantitated competitively in vivo and comparison with more advanced colony-forming progeny.
J Exp Med
181:93,
1995[Abstract/Free Full Text]
41.
Hestday K,
Ruscetti FW,
Ihle JN,
Jacobsen SEW,
Dubois CM,
Kopp WC,
Longo DL,
Keller JR:
Characterization and regulation of RB6-8C5 antigen expression on murine bone marrow cells.
J Immunol
147:22,
1991[Abstract]
42.
Coffman RL,
Weissman IL:
A monoclonal antibody that recognizes B cells and B cell precursors in mice.
J Exp Med
153:269,
1981[Abstract/Free Full Text]
43.
Owczarek C,
Layton M,
Robb L,
Nicola N,
Begley CG:
Molecular basis of the soluble and membrane-bound forms of the murine leukemia inhibitory factor receptor alpha-chain.
J Biol Chem
271:5495,
1996[Abstract/Free Full Text]
44.
Begley CG,
Aplan PD,
Denning S,
Haynes BF,
Waldmann TA,
Kirsch SS:
The gene SCL is expressed during early hematopoiesis and encodes a differentiation-related DNA-binding motif.
Proc Natl Acad Sci USA
86:10128,
1989[Abstract/Free Full Text]
45.
Robb L,
Lyons I,
Li R,
Hartley L,
Kontgen F,
Harvey RP,
Metcalf D,
Begley CG:
Absence of yolk sac hematopoiesis from mice with a targeted disruption of the scl gene.
Proc Natl Acad Sci USA
92:7075,
1995[Abstract/Free Full Text]
46.
Shivdasani R,
Mayer E,
Orkin SH:
Absence of blood formation in mice lacking the T-cell leukemia oncoprotein tal-1/SCL.
Nature
373:432,
1995[Medline]
[Order article via Infotrieve]
47.
Orkin S:
GATA-binding transcription factors in hematopoietic cells.
Blood
80:575,
1992[Free Full Text]
48.
Dieterlen-Lievre F:
On the origin of haemopoietic stem cells in the avian embryo: An experimental approach.
J Embryol Exp Morph
33:607,
1975[Medline]
[Order article via Infotrieve]
49.
Lassila O,
Martin C,
Toivanen P,
Dieterlen-Lievre F:
Erythropoiesis and lymphopoiesis in the chick yolk-sac-embryo chimeras: Contribution of yolk sac and intraembryonic stem cells.
Blood
59:377,
1982[Abstract/Free Full Text]
50.
Cumano A,
Dieterlen-LIevre F,
Godin I:
Lymphoid potential, probed before circulation in mouse, is restricted to caudal intraembryonic splanchnopleura.
Cell
86:907,
1996[Medline]
[Order article via Infotrieve]
51.
Nakano T,
Kodama H,
Honjo T:
In vitro development of primitive and definitive erythrocytes from different precursors.
Science
272:722,
1996[Abstract]
52.
Kennedy M,
Firpo M,
Choi K,
Wall C,
Robertson S,
Kabrun N,
Keller G:
A common precursor for primitive erythropoiesis and definitive haematopoiesis.
Nature
386:488,
1997[Medline]
[Order article via Infotrieve]
53.
Turpen JB,
Kelly CM,
Mead PE,
Zon LI:
Bipotential primitive-definitive hematopoietic progenitors in the vertebrate embryo.
Immunity
7:325,
1997[Medline]
[Order article via Infotrieve]
54.
Stewart CL,
Kaspar P,
Brunet LJ,
Bhatt H,
Gadi I,
Kontgen F,
Abbondanzo SJ:
Blastocyst implantation depends on maternal expression of leukaemia inhibitory factor.
Nature
359:76,
1992[Medline]
[Order article via Infotrieve]
55.
Escary J-L,
Perreau J,
Dumenil D,
Ezine S,
Brulet P:
Leukaemia inhibitory factor is necessary for maintenance of haematopoietic stem cells and thymocyte stimulation.
Nature
363:361,
1993[Medline]
[Order article via Infotrieve]
56.
Yoshida K,
Taga T,
Saito M,
Suematsu S,
Kumanogoh A,
Tanaka T,
Fujiwara H,
Hirata M,
Yamagami T,
Nakahata T,
Hirabayashi T,
Yoneda Y,
Tanaka K,
Wang WZ,
Mori C,
Shiota K,
Yoshida N,
Kishimoto T:
Targeted disruption of gp130, a common signal transducer for the interleukin 6 family of cytokines, leads to myocardial and hematological disorders.
Proc Natl Acad Sci USA
93:407,
1996[Abstract/Free Full Text]
57.
Kawabe T,
Muslin AJ,
Korsmeyer SJ:
HOX11 interacts with protein phosphatases PP2A and PP1 and disrupts a G2/M cell-cycle checkpoint.
Nature
385:454,
1997[Medline]
[Order article via Infotrieve]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
C. Gekas, K. E. Rhodes, L. M. Gereige, H. Helgadottir, R. Ferrari, S. K. Kurdistani, E. Montecino-Rodriguez, R. Bassel-Duby, E. Olson, A. V. Krivtsov, et al.
Mef2C is a lineage-restricted target of Scl/Tal1 and regulates megakaryopoiesis and B-cell homeostasis
Blood,
April 9, 2009;
113(15):
3461 - 3471.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. Metcalf
Concise Review: Hematopoietic Stem Cells and Tissue Stem Cells: Current Concepts and Unanswered Questions
Stem Cells,
October 1, 2007;
25(10):
2390 - 2395.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. S. Akimov, A. Ramezani, T. S. Hawley, and R. G. Hawley
Bypass of Senescence, Immortalization, and Transformation of Human Hematopoietic Progenitor Cells
Stem Cells,
September 1, 2005;
23(9):
1423 - 1433.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Kodama, M. Davis, and D. L. Faustman
Diabetes and Stem Cell Researchers Turn to the Lowly Spleen
Sci. Aging Knowl. Environ.,
January 19, 2005;
2005(3):
pe2 - pe2.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
X. Chen and J. J. Bieker
Stage-Specific Repression by the EKLF Transcriptional Activator
Mol. Cell. Biol.,
December 1, 2004;
24(23):
10416 - 10424.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Carotta, S. Pilat, A. Mairhofer, U. Schmidt, H. Dolznig, P. Steinlein, and H. Beug
Directed differentiation and mass cultivation of pure erythroid progenitors from mouse embryonic stem cells
Blood,
September 15, 2004;
104(6):
1873 - 1880.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Cave, S. Suciu, C. Preudhomme, B. Poppe, A. Robert, A. Uyttebroeck, M. Malet, P. Boutard, Y. Benoit, L. Mauvieux, et al.
Clinical significance of HOX11L2 expression linked to t(5;14)(q35;q32), of HOX11 expression, and of SIL-TAL fusion in childhood T-cell malignancies: results of EORTC studies 58881 and 58951
Blood,
January 15, 2004;
103(2):
442 - 450.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Schmerer and T. Evans
Primitive erythropoiesis is regulated by Smad-dependent signaling in postgastrulation mesoderm
Blood,
November 1, 2003;
102(9):
3196 - 3205.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. M. Hanson, H. Dickensheets, C.-K. Qu, R. P. Donnelly, and A. D. Keegan
Regulation of the Dephosphorylation of Stat6. PARTICIPATION OF TYR-713 IN THE INTERLEUKIN-4 RECEPTOR alpha , THE TYROSINE PHOSPHATASE SHP-1, AND THE PROTEASOME
J. Biol. Chem.,
January 31, 2003;
278(6):
3903 - 3911.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
W.-M. Yu, T. S. Hawley, R. G. Hawley, and C.-K. Qu
Immortalization of yolk sac-derived precursor cells
Blood,
November 15, 2002;
100(10):
3828 - 3831.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. M. Owens and R. G. Hawley
HOX and Non-HOX Homeobox Genes in Leukemic Hematopoiesis
Stem Cells,
September 1, 2002;
20(5):
364 - 379.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. G. Hawley and D. A. Sobieski
Of Mice and Men: The Tale of Two Therapies
Stem Cells,
July 1, 2002;
20(4):
275 - 278.
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. B. Cantor, S. G. Katz, and S. H. Orkin
Distinct Domains of the GATA-1 Cofactor FOG-1 Differentially Influence Erythroid versus Megakaryocytic Maturation
Mol. Cell. Biol.,
June 15, 2002;
22(12):
4268 - 4279.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. Zhang, E. Nelson, H. S. Radomska, J. Iwasaki-Arai, K. Akashi, A. D. Friedman, and D. G. Tenen
Induction of granulocytic differentiation by 2 pathways
Blood,
May 29, 2002;
99(12):
4406 - 4412.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. M. Bjornsson, E. Andersson, P. Lundstrom, N. Larsson, X. Xu, E. Repetowska, R. K. Humphries, and S. Karlsson
Proliferation of primitive myeloid progenitors can be reversibly induced by HOXA10
Blood,
December 1, 2001;
98(12):
3301 - 3308.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
W. Zhang, S. Kadam, B. M. Emerson, and J. J. Bieker
Site-Specific Acetylation by p300 or CREB Binding Protein Regulates Erythroid Kruppel-Like Factor Transcriptional Activity via Its Interaction with the SWI-SNF Complex
Mol. Cell. Biol.,
April 1, 2001;
21(7):
2413 - 2422.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
L. Vallier, J. Mancip, S. Markossian, A. Lukaszewicz, C. Dehay, D. Metzger, P. Chambon, J. Samarut, and P. Savatier
An efficient system for conditional gene expression in embryonic stem cells and in their in vitro and in vivo differentiated derivatives
PNAS,
February 15, 2001;
(2001)
41617198.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
C. J. Auernhammer and S. Melmed
Leukemia-Inhibitory Factor--Neuroimmune Modulator of Endocrine Function
Endocr. Rev.,
June 1, 2000;
21(3):
313 - 345.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
L. Vallier, J. Mancip, S. Markossian, A. Lukaszewicz, C. Dehay, D. Metzger, P. Chambon, J. Samarut, and P. Savatier
An efficient system for conditional gene expression in embryonic stem cells and in their in vitro and in vivo differentiated derivatives
PNAS,
February 27, 2001;
98(5):
2467 - 2472.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Abstract
Introduction
Abstract