Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Keller, G.
Right arrow Articles by Hawley, R. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Keller, G.
Right arrow Articles by Hawley, R. G.
Related Collections
Right arrow Hematopoiesis and Stem Cells
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, Vol. 92 No. 3 (August 1), 1998: pp. 877-887

Overexpression of HOX11 Leads to the Immortalization of Embryonic Precursors With Both Primitive and Definitive Hematopoietic Potential

By Gordon Keller, Charles Wall, Andrew Z.C. Fong, Teresa S. Hawley, and Robert G. Hawley

From the National Jewish Medical and Research Center, Denver; the Department of Immunology, University of Colorado Health Sciences Center, Denver, CO; and the Oncology Gene Therapy Program, The Toronto Hospital and Department of Medical Biophysics, University of Toronto, Toronto, Ontario, Canada.


    ABSTRACT
Abstract
Introduction
Methods
Results
Discussion
References

Primitive and definitive erythropoiesis represent distinct hematopoietic programs that differ with respect to stage of development, transcriptional control, and growth regulation. Although these differences have been recognized for some time, the relationship of the two erythroid lineages to each other is not well established. We have used a model system based on the hematopoietic development of embryonic stem (ES) cells in culture to investigate the origins of the earliest hematopoietic populations. Using ES cells transduced with a retrovirus that overexpresses the HOX11 gene, we have established factor-dependent hematopoietic cell lines that represent novel stages of embryonic hematopoiesis. Analysis of three of these cell lines indicates that they differ with respect to cytokine responsiveness, cell surface markers, and developmental potential. Two of the cell lines, EBHX1 and EBHX11, display the unique capacity to generate both primitive and definitive erythroid progeny as defined by morphology and expression of beta H1 and beta major globin. The third line, EBHX14, has definitive erythroid and myeloid potential, but is unable to generate cells of the primitive erythroid lineage. Analysis of the cytokine responsiveness of the two lines with primitive erythroid potential has indicated that exposure to leukemia inhibitory factor (LIF) results in the upregulation of beta H1 and a change in cellular morphology to that of primitive erythrocytes. These findings are the first demonstration of a clonal cell line with primitive and definitive hematopoietic potential and support the interpretation that these lineages may arise from a common precursor in embryonic life. In addition, they suggest that LIF could play a role in the regulation of primitive erythropoiesis.

© 1998 by The American Society of Hematology.

    INTRODUCTION
Abstract
Introduction
Methods
Results
Discussion
References

THE MURINE EMBRYONIC hematopoietic system undergoes rapid and dynamic changes in both the lineages produced and the sites of production.1,2 The earliest stage of hematopoietic development, known as primitive hematopoiesis, occurs in the yolk sac blood islands and is restricted primarily to the generation of a unique population of erythroid cells, commonly referred to as embryonic or primitive erythrocytes.2-4 These primitive erythrocytes are large, nucleated and produce the embryonic forms of globin.3,4 Three to 4 days after the initiation of yolk sac hematopoiesis, intraembryonic hematopoiesis is established, initially in the region destined to form the aorta-gonad-mesonephros and shortly thereafter in the fetal liver.2,5-7 The onset of fetal liver hematopoiesis marks the switch from the primitive to the definitive hematopoietic program, which is characterized by the production of a broad spectrum of lineages including adult type erythrocytes. These cells differ from their embryonic counterparts in that they are smaller, enucleate, and produce adult globins.3,4 With the establishment of the definitive hematopoietic program, yolk sac hematopoiesis declines and primitive erythrocytes are no longer produced.

Although these developmental changes within the hematopoietic system have been well established for many years, the relationship of the primitive and definitive lineages to one another and the mechanisms regulating them remain poorly defined. Recent gene targeting studies, as well as naturally occurring mutations in mice, have provided some insights into the molecular events involved in the establishment of primitive and definitive hematopoiesis and have documented clear differences in the transcriptional regulation and growth control of these populations. For instance, transcription factors such as myb8 and acute myeloid leukemia-1 (AML-l; core-binding factor [CBF]alpha 2)9,10 are essential for the establishment of definitive hematopoiesis, but appear to be dispensable for primitive erythropoiesis. The c-kit receptor tyrosine kinase and its ligand, kit ligand (KL), are essential for progression into the definitive program, but are not required for the establishment of primitive erythropoiesis in the yolk sac.1,11 Similarly, erythropoietin is essential for maturation of the definitive erythroid lineage, but not for primitive erythropoiesis.12,13 Together these studies suggest that primitive and definitive hematopoiesis represent separate developmental programs that are regulated by different molecular mechanisms and display different growth requirements.

Further understanding of the relationship between primitive and definitive hematopoiesis, including the mechanisms involved in the establishment of the two systems, will require access to early precursor populations as they develop. Whereas definitive precursors are present in the liver throughout most of fetal life and in the bone marrow for all of adult life, the generation of primitive erythroid precursors is restricted to a narrow window of embryonic development that precedes the establishment of the yolk sac blood islands.14 This limited time of development at a stage when the embryo is extremely small and not readily accessible has made the isolation and characterization of this population difficult, if not impossible. To overcome the problem of accessibility of embryonic hematopoietic precursors, a number of groups have used an in vitro model system based on the capacity of embryonic stem (ES) cells to generate hematopoietic precursors in culture.15-17 Analysis of embryoid bodies (EBs) from the differentiating ES cells has shown that hematopoietic differentiation in these cultures recapitulates many aspects of the onset of hematopoietic development in utero, including the switch from the primitive to the definitive program.18,19

The establishment of hematopoiesis in culture from ES cells not only provides access to rare, early developing populations, but also provides a unique system for addressing questions related to the effects of altered gene expression on hematopoietic precursor development, growth, and differentiation. The outstanding advantage of this approach is that genes can be introduced at the level of the starting ES population and subsequently be expressed as the primitive hematopoietic precursors develop from prehematopoietic mesoderm. In addition to providing new insights into gene function, overexpression of genes, particularly those with transforming and/or immortalizing potential, provides a unique opportunity to establish cell lines representing various stages of embryonic hematopoietic development.

Within this context, members of the HOX gene family are of interest, as recent studies have shown that overexpression of these genes can lead to selective expansion and in some instances, immortalization of different hematopoietic precursor populations.20-23 At least two different HOX genes have been shown to have potent immortalizing capacity in primary hematopoietic cells. The first, Hox-2.4 (Hoxb8), whose expression is upregulated in WEHI-3B tumor cells, is able to immortalize bone marrow-derived hematopoietic precursors when transduced and expressed in these cells in the context of a retroviral vector.21 The second, HOX11, originally identified from translocations in certain T-cell acute lymphoblastic leukemias, also displays strong immortalizing potential when transduced into primary mouse bone marrow-derived precursors.20 Given this capacity to immortalize adult marrow precursor populations, we were interested in determining if this class of genes would exhibit similar properties when overexpressed in embryonic hematopoietic precursors. In this report, we show that immortalized hematopoietic cell lines can be generated from ES cell-derived EBs that overexpress the HOX11 gene. The lines generated from these EBs are factor-dependent and display unique developmental potentials including the capacity to generate both primitive and definitive erythroid cells. Using these cell lines, we have identified leukemia inhibitory factor (LIF) as a potential novel regulator of the primitive erythroid lineage.

    MATERIALS AND METHODS
Abstract
Introduction
Methods
Results
Discussion
References

Retroviral-mediated transfer of the HOX11 gene to ES cells.   The construction of the MSCV-HOX11 and MSCV-NEO (MSCVv2.1) retroviral vectors and the generation of the corresponding helper-free ecotropic retroviral vector producer lines GP+E-86/MSCV-HOX11 and GP+E-86/MSCVv2.1, respectively, have been reported.20,24,25 Virus producer lines were maintained in Dulbecco's modified Eagle medium (DMEM) with 4.5 g/L glucose (Life Technologies, Gaithersburg, MD) supplemented with 10% calf serum (Hyclone Laboratories, Logan, UT) in a humidified atmosphere containing 5% CO2/95% air at 37°C. Supernatants were collected from subconfluent cultures 24 hours after the medium was changed to DMEM supplemented with 1.5 × 10-4 mol/L monothioglycerol and 15% fetal calf serum (FCS), filtered through 0.45-mm filters and used immediately to transduce ES cells. Virus titers were in the range of 4 to 8 × 106 colony-forming units/mL when assayed on NIH3T3 fibroblasts in the presence of 400 µg/mL G418.

ES cell transductions were performed essentially as described for embryonal carcinoma cells.26 Briefly, 1-mL aliquots of vector supernatants were added to 4 × 105 ES cells per 60-mm tissue culture dish and the cultures were incubated in the presence of 4 µg/mL polybrene (hexadimethrine bromide; Sigma, St Louis, MO) at 37°C for 2 hours. ES cell culture medium (see below) was added (4 mL) and the incubations were continued at 37°C for 24 hours. This procedure was repeated, and 24 hours later the cell monolayers were trypsinized into single cell suspensions and transferred to 100-mm tissue culture dishes. Transduced cells were selected in 400 µg/mL G418 and the developing colonies were pooled on day 7 and used in the EB differentiation experiments.

Growth and differentiation of ES cells.   Wild-type CCE ES cells, as well as those transduced with MSCV-HOX11 and MSCV-NEO retroviral vectors, were maintained on gelatinized flasks in DMEM supplemented with 15% FCS (Hyclone), penicillin, streptomycin, 1.5 × 10-4 mol/L monothioglycerol (MTG; Sigma) and saturating amounts of a Chinese hamster ovary (CHO) LIF-containing supernatant (1% conditioned medium; CM). Two days before the initiation of differentiation, cells were transferred to Iscove's modified Dulbecco's medium (IMDM) containing the above components. After 2 days of growth in IMDM, ES cells were trypsinized into a single-cell suspension and plated into differentiation medium containing 1% methyl cellulose in IMDM supplemented with 15% FCS, 2 mmol/L glutamine (Life Technologies), and 4.5 × 10-4 mol/L MTG. The differentiation cultures were performed in Petri grade dishes and maintained in a humidified chamber in a 5% CO2/air mixture at 37°C for 7 days.

Establishment and maintenance of the EBHX cell lines.   Day 7 EBs generated from ES cells transduced with either the MSCV-HOX11 or the MSCV-NEO virus were dissociated by trypsinization and the cells cultured in liquid for 2 months. These liquid cultures were performed in 100-mm Petri grade dishes in IMDM supplemented with 5% FCS, 1.5 × 10-4 mol/L MTG and either KL (1% CM) and erythropoietin (Epo) (2 U/mL) or interleukin-3 (IL-3) (1% CM) and Epo. Duplicate cultures seeded at a density of 5 × 105 cells/mL were maintained with and without G418 for each population of cells. Vigorously growing cultures were either passaged to new dishes or depleted of cells as deemed necessary to maintain appropriate cell densities. Cells from both the MSCV-HOX11 and MSCV-NEO containing EBs grew in the presence of G418. Four and 8 weeks after the initiation of the liquid cultures, G418R cells from each set of conditions were cultured in methylcellulose in the presence of appropriate cytokines. Seven to 10 days later, individual colonies from the methylcellulose cultures were transferred to microtiter wells containing the above described medium. Rapidly growing populations were passaged to larger cultures and established as immortalized cell lines. The immortalized lines could be maintained indefinitely in the presence IMDM, 5% FCS, 1.5 × 10-4 mol/L MTG and the appropriate cytokines (line maintenance conditions). Subclones of the EBHX11 line were generated by single cell micromanipulation, whereas those of EBHX1 were obtained from colonies generated in methylcellulose under sparse conditions. These subclones were maintained in the same conditions as the parental populations.

Differentiation cultures for globin expression analysis.   For analysis of globin expression in colonies, EBHX cells were cultured in methylcellulose in IMDM supplemented with 5% plasma-derived serum (PDS; Antech, Tyler, TX), 5% protein-free medium (PFMHII; Life Technologies), glutamine (2 mmol/L), ascorbic acid (50 µg/mL), and appropriate cytokines. Liquid differentiation cultures consisted of the same components with the exception of the methylcellulose.

Polymerase chain reaction (PCR) globin analysis.   Globin expression patterns in the cell lines were determined using the global amplification strategy of Brady et al.27 Either individual colonies or small numbers (<1,000) of cells from liquid cultures were lysed in 4 µL of first strand buffer. Reverse transcription, tailing, and PCR procedures were performed as previously described,27 with the exception that the (dT)-x oligonucleotide was shortened to CATCTCGAGCGGCCGC(T)24. Amplified products from the PCR reaction were separated on an agarose gel and transferred to a Z-probe GT membrane (Bio-Rad, Richmond, CA). For analysis of beta major globin and L32 expression, the resulting blots were hybridized with 32P randomly primed cDNA probes corresponding to the 3' region of these genes. To analyze beta H1 expression, a probe was prepared by annealing two oligonucleotides, (5'TGGAGTCAAAGAGGGCATCATAGACACATGGG3', 5'CAGTACACTGGCAATCCCATGTG3'), which share an 8 base homology at their 3' termini. This beta H1 specific oligonucleotide was labeled with 32P using a Klenow fill-in reaction. Hybridizations were performed using the method of Church and Gilbert.28 beta major and L32 cDNA probes were hybridized and washed at 65°C, while the beta H1 oligonucleotide probe was hybridized and washed at 42°C.

RNA preparation and Northern blot analysis.   Poly(A)+ RNA was isolated from the EBHX cell lines using an oligo(dT)-cellulose column. For expression analysis, 3 to 5 µg of poly(A)+ RNA from each sample was run in a 1.0% agarose-formaldehyde gel and subsequently transferred to Z-probe GT membrane (Bio-Rad). The membranes were hybridized with appropriate 32P-labeled cDNA probes or with the beta H1 specific oligonucleotide.

Growth factors.   IL-11, IL-6, macrophage colony-stimulating (M-CSF), granulocyte-macrophage colony-stimulating factor (GM-CSF), and vascular endothelial growth factor (VEGF) were purchased from R & D Systems, Minneapolis, MN. LIF and c-kit ligand were derived from medium conditioned by CHO cells transfected with LIF and KL expression vectors (kindly provided by Genetics Institute, Cambridge, MA). For some experiments, recombinant LIF and KL (R & D Systems) were used in place of the conditioned medium. IL-3 was obtained from medium conditioned by X63 AG8-653 myeloma cells transfected with a vector expressing IL-329 or purchased from R & D Systems.

Fluorescence-activated cell sorting (FACS) analysis.   Immunofluorescence flow cytometric analysis was performed essentially as described20,30 with saturating concentrations of affinity-purified rat monoclonal antibodies recognizing murine hematopoietic cell-surface antigens. Fluorescein isothiocyanate-conjugated reagents included: M1/70HL, anti-CD11b/Mac-1 (Boehringer Mannheim, Laval, Quebec); C71/16, anti-CD18/CD11abc (PharMingen, San Diego, CA); 2.4G2, anti-CD32/CD16(Fcgamma RII/RIII) (PharMingen); IM7.8.1, anti-CD44/Ly-24 (obtained from the American Type Culture Collection, Rockville, MD); 30-F11.1, anti-CD45/Ly-5 (ATCC); RA3-6B2, anti-CD45R/B220 (PharMingen); 30-H12, anti-CD90.2/Thy-1.2 (PharMingen); and R6B-8C5, anti-Ly-6G/Gr-1 (PharMingen). Biotinylated reagents included: anti-AA4.1 (generously provided by John McKearn, Searle Research and Development, Monsanto Co, St Louis, MO); M1/69.16.11.HL, anti-CD24/HSA (ATCC); PS/2, anti-CD49d/VLA-4 alpha 4 (kindly supplied by Paul Kincade, Oklahoma Medical Research Foundation, Oklahoma City, OK); and E13-161-7, anti-Sca-1/Ly-6A (a generous gift from Dr Irving Weissman, Stanford University, Stanford, CA). To prevent nonspecific Fc receptor binding, cells (106) were first incubated with 1 mL of culture supernatant from the 2.4G2 anti-CD32/CD16(Fcgamma RII/RIII) hybridoma (ATCC). Biotinylated monoclonal antibodies were developed with R-phycoerythrin streptavidin (Molecular Probes, Eugene, OR) as a second step. Viable cells were gated by a combination of forward and orthogonal light scatter and were analyzed on an Epics Elite flow cytometer (Coulter Corp, Miami, FL).

Radioimmunoprecipitation analysis of HOX11.   Radiolabeling of proteins and immunoprecipitations were performed essentially as described.20,30 Briefly, cells (2 × 107) were labeled for 6 hours at 37°C with 300 µCi [35S]methionine (Amersham Canada Ltd, Oakville, Ontario) in 1 mL of methionine-deficient DMEM (ICN Biomedicals, Costa Mesa, CA) supplemented with 5% FCS and the appropriate cytokines. Cells were washed with cold phosphate-buffered saline and lysed in 1 mL of RIPA buffer (50 mmol/L Tris pH 7.5, 150 mmol/L NaCl, 1% Nonidet P-40, 1% deoxycholate, 0.1% sodium dodecyl sulfate (SDS), 2 mmol/L phenylmethylsulfonyl fluoride) for 30 minutes on ice. The cell extract was clarified by centrifugation and the lysate was precleared by incubation with 40 µg of whole mouse IgG (Jackson ImmunoResearch Laboratories, West Grove, PA) at 4°C overnight and addition of 100 µL formalin-treated S aureus cells (Pansorbin, Calbiochem-Novabiochem Corp, San Diego, CA). The HOX11 proteins were precipitated with 5 µL rabbit HOX11 antiserum (kindly provided by Ming Lu, University of California, San Diego, CA) for 1 hour at 4°C and the immune complexes were collected with 75 µL of 100 mg/mL protein A sepharose CL-4B (Pharmacia Biotech, Baie D'Urfé, Quebec) in phosphate-buffered saline. The immunoprecipitates were washed four times (once in RIPA buffer, once in RIPA buffer containing 0.5 mol/L NaCl, followed by two additional washes in RIPA buffer alone) and resuspended in 30 µL of Laemmli sample buffer (2% SDS, 10% glycerol, 60 mmol/L Tris pH 6.8, 0.001% bromphenol blue) containing 100 mmol/L dithiothreitol. Samples were boiled for 3 minutes and electrophoresed through 12% SDS-polyacrylamide gels. Dried gels were exposed to Kodak XAR-5 film (Eastman Kodak company, Rochester, NY).

    RESULTS
Abstract
Introduction
Methods
Results
Discussion
References

Establishment of EBHX cell lines.   To overexpress HOX11 in early embryonic hematopoietic populations, ES cells were transduced with the MSCV-HOX11 retrovirus, which expresses the HOX11 gene from the LTR promoter and the selectable neo gene from a downstream internal pgk promoter.20,24 Transduced ES cells were selected in G418 for 7 days and then used for the generation of EBs as outlined in Fig 1A. Control ES cells were transduced with MSCV-NEO expressing only the neo gene. Analysis of EBs generated from MSCV-HOX11-transduced ES cells demonstrated the presence of HOX11 mRNA and protein, as well as neo transcripts (Fig 1B and C), indicating that the vector maintained expression of both the HOX11 and neo genes throughout the ES differentiation period.


View larger version (40K):
[in this window]
[in a new window]
 
Fig 1. (A) Protocol used to generate EBHX cell lines. (B) Immunodetection of HOX11 protein (37 kD, arrow) in EBHX cell lines by immunoprecipitation of radiolabeled proteins with HOX11-specific antiserum. PGMD1, an IL-3-dependent myeloid progenitor line used as negative control; HX3, a bone marrow-derived HOX11-immortalized line used as positive control; EBHX, day 6 EBs generated from MSCV-HOX11 transduced ES cells; EBHX1, EBHX4, EBHX11, three EB-derived HOX11-immortalized cell lines. (C) Northern blot analysis with a neo probe demonstrating LTR-directed (4.0 kb) HOX11 mRNA (which contains downstream neo sequences) and pgk-directed (1.3 kb) neo mRNA in EBHX cell lines. CCE ES, wild-type ES cells; ES/HOX11, MSCV-HOX11 transduced ES cells; 3T3/HOX11, NIH3T3 fibroblasts transduced with the MSCV-HOX11 vector.

Seven days after the initiation of ES differentiation, the developing EBs were dissociated and the cells cultured in liquid, either in the presence of IL-3 and Epo or in the presence of KL and Epo. Precursor analysis did not show any significant difference in the hematopoietic potential of the HOX11 expressing and control EBs at this stage of development. Four and 8 weeks later, cells from both sets of conditions were assayed in methylcellulose in the presence of the same cytokines used in the liquid cultures. At both time points, there were clear differences in the types of colonies that grew from the HOX11 expressing cells compared with the NEO control cells. All colonies in the control cultures had similar morphologies and were found to contain only mast cells. In contrast, HOX11-expressing cells generated colonies that displayed significant heterogeneity with respect to cell size and the degree of disperseness of the cells within the colonies. In addition, a significant number of the colonies in these cultures developed hemoglobinized erythroid cells. Many of the colonies derived from the HOX11 expressing EBs consisted of a mixture of maturing hematopoietic cells together with cells with an immature morphology. Individual colonies from cultures at both time points were transferred to microtiter wells in their respective conditions (IL-3/Epo or KL/Epo) in the presence of G418. At this stage, immortalized cell lines could be established from approximately 10% of these colonies. Medium to large colonies with an obvious undifferentiated component were most efficient at generating cell lines. A total of 16 embryoid body-derived HOX11 (EBHX) lines were established in the initial experiment, 10 from the IL-3/Epo cultures and 6 from the KL/Epo cultures.

Based on differences in cell morphology, 3 lines were selected for further characterization. These included EBHX11 isolated at 8 weeks from the KL/Epo cultures and EBHX14 and EBHX1 isolated at 4 and 8 weeks, respectively, from the IL-3/Epo cultures. Two additional lines, EBHX15 and EBHX4, established from the IL-3/Epo cultures at 4 and 8 weeks, as well as subclones of EBHX1 (EBHX1-C7) and EBHX11 (EBHX11-15), were included in some of the analyses. To determine if HOX11 was involved in the immortalization event, three of the lines were analyzed for the presence of HOX11 protein. As shown in Fig 1B, HOX11 protein was detected in EBHX1, EBHX4, and EBHX11. In addition, all three lines also expressed neo mRNA (Fig 1C). These findings demonstrate that the MSCV retroviral vector is able to maintain expression of both transduced genes in the EB-derived cell lines and is consistent with the interpretation that HOX11 is essential for their generation.

EBHX1, EBHX11, and EBHX14 cells display strikingly different morphologies. EBHX1 consists of two cell types, medium to small cells with erythroid characteristics and large megakaryocyte-like cells (Fig 2A). EBHX11 cells are relatively homogeneous in size and have an erythroblastic morphology (Fig 2B), whereas EBHX14 cells show signs of both erythroid and myeloid differentiation potential (Fig 2C). EBHX4 cells were almost identical to those of the EBHX1 line, whereas EBHX15 cells display erythroid and myeloid morphology, similar to EBHX14 cells (not shown).


View larger version (52K):
[in this window]
[in a new window]
 
Fig 2. Morphology of cells in three different EBHX cell lines. EBHX1 (A), EBHX11 (B), and EBHX14 (C). Cells were stained with May-Grünwald and Giemsa. Original magnification × 1,000.

Growth factor responsiveness of EBHX cell lines.   To further define the developmental potential of the EBHX lines, their growth responsiveness to different cytokines in methylcellulose cultures was next analyzed. The cytokines tested included IL-2, IL-3, IL-4, IL-6, IL-7, IL-11, Epo, thrombopoietin (TPO), KL, G-CSF, GM-CSF, M-CSF, LIF, insulin-like growth factor-1 (IGF-1), VEGF, and basic fibroblast growth factor (FGF). Only data for cytokines found to have a growth promoting activity are shown (Fig 3). None of the lines generated colonies in the absence of growth factors, demonstrating a strict dependence on cytokines for growth in methylcellulose. Of the three lines analyzed, EBHX1 cells responded to the broadest spectrum of cytokines, showing the highest response to IL-3. These cells also responded to Epo, LIF, IL-4, TPO, and IL-6. EBHX11 cells responded best to LIF, but did show significant responses to Epo and IL-3. Although the EBHX11 line was generated in the presence of KL and Epo, the cells showed no significant growth response to KL, either alone or together with Epo. Nevertheless, the cells are routinely maintained in KL and Epo, as they do express the c-kit encoded receptor (see below) and the interaction with KL may be important to preserve the potential of the line. EBHX14 cells respond to IL-3 and GM-CSF, consistent with the interpretation that they have myeloid potential. Colony growth by this line was somewhat cell density-dependent and was best at concentrations of 1 × 104 to 5 × 104 cells per mL. None of the lines showed a significant growth response to M-CSF, G-CSF, IL-2, IL-7, IL-11, KL, VEGF, basic FGF, or IGF-1. Combinations of factors were not extensively tested, with the exception of the large mixture used to measure the maximal growth response and the combination of IL-3/Epo or KL/Epo used for cell line maintenance. The cytokine responsiveness of the subclones, EBHX1-C7 and EBHX1-15, was identical to that of the parental lines (not shown).


View larger version (23K):
[in this window]
[in a new window]
 
Fig 3. Growth factor responsiveness of EBHX cell lines. EBHX cells were cultured in methylcellulose in the presence of the indicated cytokines and the developing colonies scored 7 to 8 days later. EBHX1 cells were cultured at 1 × 104 to 5 × 104 cells/mL, EBHX11 at 250 to 750 cells/mL, and EBHX 14 at 1 × 104 to 5 × 104 cells/mL. Maximum response was determined by the number of colonies that grew in response to a broad mixture of cytokines, which included IL-3, IL-6, IL-11, Epo, KL, LIF, GM-CSF, G-CSF, and M-CSF. Colony-forming cell frequencies in this mixture were approximately 14% for EBHX1, 50% for EBHX11, and 20% for EBHX14. Cytokines were used at the following concentrations: IL-2, 1% conditioned medium; IL-3, 1 ng/mL; IL-6, 5 ng/mL; IL-7, 16 ng/mL; IL-11, 25 ng/mL; Epo, 2 U/mL; KL, 100 ng/mL; LIF, 1 ng/mL; IL-4, 1% conditioned medium; TPO, 5 ng/mL; G-CSF, 30 ng/mL; GM-CSF, 15 ng/mL; M-CSF, 5 ng/mL; IGF-1, 5 ng/mL; and basic FGF, 10 ng/mL. Bars represent standard error of the mean (SEM) from three independent experiments.

The strong response of EBHX11 cells to LIF and Epo suggested that cytokines other than the combination of KL/Epo might be able to support their growth for an extended period of time. To address this question, EBHX11 cells were passaged from KL/Epo to cultures containing either LIF or only Epo. In both conditions, the cells survived, grew, and could be easily maintained over a 6-month period without any apparent signs of senescence. Although there were no obvious significant differences in the growth rate of these populations, the cells maintained in LIF, EBHX11L, were more adhesive than the parental cells and tended to grow in clusters, particularly at high cell density. The cells grown in Epo, EBHX11E, were similar to those maintained in KL/Epo. In addition to these adhesive differences, EBHX11L cells showed different patterns of globin gene expression compared to EBHX11 and EBHX11E cells (see below).

Surface phenotype of EBHX cell lines.   To better define the lineage relationship of the EBHX lines, their cell-surface phenotype was determined by immunofluorescence flow cytometric analysis using a panel of monoclonal antibodies directed against hematopoietic cell surface antigens. A summary of the analysis of five different lines is presented in Table 1. EBHX1 and EBHX4 exhibited similar expression patterns that included low levels of Thy-1 and high levels of the low-affinity Fc receptor, Fcgamma RII/III, found on myeloid, B-cell, T-cell, and natural killer cell precursors.31,32 In addition, cells from these two lines expressed the hyaluronan receptor CD44 found on most hematopoietic precursors,33 the integrin very late antigen (VLA)-4 present on precursors and differentiated myeloid and lymphoid cells,34 and lymphocyte function-associated antigen (LFA)-1/CD18 found on most leukocytes.35 A subpopulation of EBHX1, but not of EBHX4, also expressed TER-119, an erythroid lineage-restricted antigen.36 The cells from these two lines did not express AA4.1, a marker found on fetal liver stem cells and precursors,37 Sca-1 (Ly-6A) found on fetal liver and adult marrow stem cells,38-40 heat stable antigen (HSA), and the panleukocyte antigen CD45, markers found on most hematopoietic precursors,35 Gr-1, a marker of the granulocyte lineage,41 Mac-1, a myeloid differentiation antigen,35 and B220, a marker of the B-cell lineage.42 EBHX14 and EBHX15 also showed similar expression patterns and displayed the broadest spectrum of surface markers of all lines tested. Both lines contain subpopulations of cells that expressed AA4.1, TER-119, Mac-1, and Gr-1. In addition, these lines also expressed Thy-1, Fcgamma RII/III, CD44, VLA-4, and CD18. The expression pattern of these two lines did differ in that EBHX15 expressed CD45, intercellular adhesion molecule (ICAM)-1, HSA, and no detectable Sca-1, whereas EBHX14 expressed very low levels of CD45 and HSA and no detectable ICAM-1. In addition, a small subpopulation of EBHX14 did express Sca-1. EBHX11 cells showed the most restricted pattern of the lines tested and were found to express only CD44, VLA-4, HSA, and ICAM. The results from the surface marker analysis further documents differences between these lines and suggest that EBHX14 and EBHX15 contain the most immature cell types, as defined by AA4.1 expression, EBHX-1 and EBHX4 represent intermediate stage cells, and EBHX11 represents a relatively late stage population.

 
View this table:
[in this window] [in a new window]
 
Table 1. Surface Marker Analysis of EBHX Lines

Gene expression analysis of EBHX cell lines.   Given these observed differences in the lines, we were next interested in determining their patterns of specific receptor, transcription factor, and globin gene expression. Included in this analysis were EBHX1, EBHX11, and EBHX14, as well as the subpopulations of EBHX11 that were maintained in either LIF (EBHX11L) or Epo (EBHX11E). All of the lines, which responded to LIF, expressed two isoforms of the LIF receptor gene,43 a large message of approximately 10 kb and a smaller message of approximately 4.5 kb (Fig 4). Similarly, all of the lines that showed a response to Epo alone expressed the Epo receptor. c-Kit mRNA was detected in all of the lines consistent with the interpretation that they represent early hematopoietic precursor populations. EBHX1 was the only cell line that expressed flk-1, suggesting that it could represent an early stage of embryonic hematopoietic development, a stage characterized by expression of this receptor.19 With respect to transcription factors, all lines expressed tal-1/SCL a member of the helix-loop-helix family of factors that is found in early hematopoietic cells and required for the establishment of the embryonic hematopoietic system.44-46 In addition, all of the lines expressed GATA-1, a transcription factor normally found in cells of the erythroid, mast cell, and megakaryocytic lineages.47 However, in this case, EBHX1 and EBHX11, which contain Epo-responsive erythroid precursors, showed higher levels of GATA-1 expression than EBHX14, which contains less mature precursors that require both IL-3 and Epo for growth.


View larger version (66K):
[in this window]
[in a new window]
 
Fig 4. Expression analysis of EBHX cell lines. (A) Northern blot analysis of receptor and transcription factor gene expression. (B) Northern blot analysis of globin gene expression. The relative amounts of RNA loaded are indicated by hybridization to the probe specific for glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Cells from day 4.5 EBs were included as a control (C).

In contrast to the above expression patterns, the globin analysis showed some unexpected and important differences among the lines. EBHX11, EBHX11L, and EBHX11E all expressed beta major globin, consistent with the interpretation that they represent erythroid precursors at a late stage of maturation. EBHX1 and EBHX14 did not express detectable amounts of beta major globin, suggesting that the erythroid precursors in these lines represent an intermediate stage of development. Although EBHX11, EBHX11L, and EBHX11E expressed comparable levels of adult goblin, they displayed striking differences in the levels of beta H1 expression. The parental line grown in the presence of KL/Epo showed little beta H1 expression, whereas the subpopulation maintained in LIF expressed significant levels of this embryonic globin. The line maintained in Epo showed low, but detectable, levels of beta H1. In addition to EBHX11L, EBHX1 also expressed some beta H1. beta H1 expression was not detected in EBHX14 cells. The presence of cells that express beta H1 suggests that lines EBHX1 and EBHX11 have the potential to generate cells of the primitive erythroid lineage. Furthermore, the high levels of beta H1 in EBHX11L cells indicates that LIF could be an important mediator in the upregulation of this embryonic globin and possibly in establishing the primitive erythroid program.

Primitive and definitive erythroid potential of the EBHX cell lines.   To further explore the primitive and definitive potential of these lines, EBHX11 cells were cultured in methylcellulose in the presence of LIF or Epo and the cells analyzed for globin expression patterns and morphologic characteristics of these lineages. Epo was used in place of KL/Epo, as studies subsequent to the Northern blot analysis indicated that EBHX11 cells do not express significant levels of beta H1 when cultured in the presence of this cytokine. Colonies generated in both sets of conditions showed visible signs of hemoglobinization (Fig 5A and C), but did display distinct differences in morphology. In the presence of LIF, the colonies had a tighter, more compact appearance than those generated in response to Epo. More than 50% of the cells within the LIF-stimulated colonies were large and displayed characteristics of primitive erythrocytes (Fig 5B). The remainder of these colonies typically consisted of undifferentiated cells and cells with a definitive erythroid morphology. In contrast, the majority of the cells in the Epo-stimulated colonies were significantly smaller than those in the LIF-stimulated colonies and had the morphology of cells of the definitive erythroid lineage (Fig 5D). The Epo-stimulated colonies also contained some cells with an undifferentiated morphology. Similar differences were observed in colonies generated from the EBHX11-15 subclone and from EBHX1 cells in these two sets of conditions (not shown).


View larger version (99K):
[in this window]
[in a new window]
 
Fig 5. EBHX11-derived colonies and cells. (A) Colonies grown in the presence of LIF for 7 days. (B) Cells from LIF-stimulated colonies. (C) Colony grown in the presence of Epo for 7 days. (D) Cells from Epo-stimulated colonies. Original magnification for (A and C), ×200 and for (B and D), ×1,000.

Globin analysis of the colony-derived cells from these two conditions confirmed the morphologic differences. Colonies generated from EBHX11, EBHX11-15, or EBHX1 in the presence of LIF or LIF/Epo expressed readily detectable levels of beta H1 (Fig 6). In contrast, those generated in the presence of Epo, KL/Epo, or IL-3/Epo showed little, if any, embryonic globin expression. The lack of significant beta H1 expression in EBHX11-derived colonies generated in the presence of Epo or in EBHX1-derived colonies grown in the presence of IL-3 and Epo differs from the previous Northern blot analysis, which demonstrated low levels of embryonic globin in these populations. These differences could reflect differences in the culture conditions used for cell line maintenance compared with those used for differentiation (see Materials and Methods). beta major was expressed in colonies generated in all conditions, although in many experiments EBHX11 colonies or cells grown in the presence of LIF expressed lower levels of the adult globin than those grown in the presence of Epo or KL/Epo (see also Fig 7). Erythroid colonies generated from EBHX14 cells in the presence of IL-3/Epo or in the presence of IL-3/LIF/Epo did not express detectable levels of beta H1. Together, these findings strongly suggest that lines EBHX11, the subclone EBHX11-15 and EBHX1, have the potential to generate cells of the primitive and definitive erythroid lineages and that LIF is an important regulator of the primitive erythroid program.


View larger version (91K):
[in this window]
[in a new window]
 
Fig 6. Globin expression analysis of EBHX-derived colonies. Colonies were grown in the indicated cytokines for 7 days and then picked and analyzed for beta H1 and beta major expression by Poly(A) PCR. The analysis of three individual colonies is shown for each set of conditions. EBHX11-15 is a subclone of EBHX11. Control Ep represents primitive erythroid colonies grown from day 6 EB precursors, control Ed are definitive erythroid colonies generated from fetal liver precursors, and control M are macrophage colonies grown from day 6 EB-derived precursors. N represents PCR reagents with no cells added. Expression of the ribosomal L32 gene was used as an indication of the amount of material in each lane. Cytokines were used at the concentrations indicated in the legend to Fig 3.


View larger version (44K):
[in this window]
[in a new window]
 
Fig 7. Globin expression analysis of EBHX11 and EBHX11L cells grown under different conditions. Cells were seeded into microtiter wells at a concentration of 30 or 100 cells per well, maintained in the indicated cytokines for 7 days, and then analyzed for beta H1 and beta major expression by Poly(A) PCR. Three samples from each set of conditions are shown. T0 represents the starting populations. Controls are the same as those in Fig 6. Expression of the ribosomal L32 gene was used as an indication of the amount of material in each lane.

The previous data indicated that switching EBHX11 cells from KL/Epo to LIF results in the onset of a primitive erythroid program characterized by the generation of large cells with the morphology of primitive erythrocytes, which express beta H1 globin. We were next interested in determining if EBHX cells exposed to LIF were still able to generate cells with a definitive phenotype when removed from LIF and cultured in KL/Epo. To address this question, EBHX11L cells that were maintained in LIF for 6 months were cultured in microtiter wells in the presence of LIF, KL/Epo, or Epo. As a control, parental EBHX11 cells were cultured under identical conditions. After 7 days of culture, both lines showed similar changes in goblin gene expression in response to the different cytokines (Fig 7). In the presence of LIF, both EBHX11L and EBHX11 cells expressed readily detectable levels of beta H1 as expected. However, when cultured in KL/Epo or Epo alone, EBHX11L cells downregulated beta H1 expression, indicating that the line maintained in LIF retained the capacity to generate cells with a definitive erythroid phenotype.

    DISCUSSION
Abstract
Introduction
Methods
Results
Discussion
References

In this report we describe the generation and characterization of novel hematopoietic cell lines from EBs that were genetically modified to overexpress the HOX11 gene. All of the established EBHX lines analyzed expressed the HOX11 gene originally transduced into the starting ES population, all retained factor dependency, and all showed some capacity to differentiate. Several features of these cell lines distinguish them from virtually all other hematopoietic cell lines established to date. First, they were generated from day-7 EBs, a population representative of the embryonic or yolk sac phase of hematopoiesis.18,19 Most other hematopoietic cell lines have been derived from fetal or adult precursors. Second, at least two of the cell lines display the unique capacity to generate both primitive and definitive erythroid progeny. To our knowledge, this is the first demonstration of a clonal cell line with both primitive and definitive hematopoietic potential.

The developmental potential of the EBHX cell lines, summarized in Fig 8, raises some important questions with respect to the origin of the primitive and definitive erythroid lineages. Studies in both the avian and murine systems have provided evidence that primitive erythropoiesis and definitive hematopoiesis arise at distinct times and sites during embryogenesis and as such suggest that these populations derive from separate precursors.48-50 Further support for this concept was provided by findings, which demonstrated that the primitive and definitive erythroid lineages can arise from separate precursors in developing EBs.51 While these observations are consistent with the interpretation that these lineages have separate origins, several studies have challenged this notion and provided evidence indicating they arise from a common precursor early in development.52,53 The restricted potential of EBHX11 and its subclone, EBHX11-15, further supports the concept of a common ancestor for primitive and definitive hematopoiesis and suggests that, at early stages of development, the primitive and definitive erythroid lineages develop from an erythroid committed precursor. One concern with these interpretations is that they are based on the potential of immortalized cell lines, which may not accurately reflect potential of normal embryonic precursors. Our current studies are focused on the identification of comparable precursor populations in EBs and developing embryos.


View larger version (13K):
[in this window]
[in a new window]
 
Fig 8. Summary of the developmental potential of three EBHX cell lines. Meg, megakaryocyte; Eryp, primitive erythroid; Eryd, definitive erythroid.

The capacity to respond to LIF defines two separate populations of erythroid precursors represented by the different EBHX lines. LIF-responsive cells found in the EBHX11 line have both primitive and definitive erythroid potential and may be representative of precursors found in the yolk sac blood islands. The LIF nonresponsive population present in the EBHX14 line is unable to generate primitive erythroid progeny and could be the equivalent of the earliest definitive precursors found in the fetal liver. The correlation of LIF responsiveness with primitive erythroid potential suggests that this molecule could be a regulator of yolk sac erythropoiesis. This is an important observation as regulation of the growth and maturation of this early erythroid lineage is not well defined. The only known cytokine that stimulates primitive erythroid precursors in culture is Epo and, as with the definitive erythroid lineage, it appears to act at the equivalent of the CFU-E stage of development.15 Although Epo can stimulate these precursors in culture, studies on Epo and Epo receptor knockout mice demonstrate that this cytokine is not essential for development of the lineage in vivo and suggest that other growth regulators are involved.12,13

Although our data implicate LIF as a possible regulator of primitive erythropoiesis, analysis of knockout mice indicates that this factor is not essential for development of this lineage in the embryonic yolk sac. Mice lacking LIF or gp130, the signaling component of the LIF receptor, survive through embryonic development, suggesting that neither the ligand nor the normal receptor complex is absolutely required for primitive erythropoiesis.54-56 However, as the early erythroid population in these animals was not characterized, it is not known if this lineage was negatively affected by these mutations. The fact that the LIF receptor is expressed in the EBHX lines would suggest that LIF or a LIF-like molecule that can bind this receptor does play some role in the regulation of the primitive erythroid lineage. Preliminary studies indicate that other cytokines that signal through gp130 including IL-6, IL-11, and oncostatin M are unable to mediate the switch to the primitive phenotype, suggesting that the effect could be specific to LIF (unpublished observation, 1997). Future studies will determine whether other molecules, either known or novel, have effects similar to those of LIF.

Immortalization of EB-derived embryonic precursors by HOX11 confirms and extends our earlier findings that constitutive expression of HOX11 immortalized bone marrow-derived precursors,20,30 and further demonstrates the potential of this class of genes to dramatically alter growth regulation within the hematopoietic system. In particular, our current studies document that HOX11 can affect the growth and development of embryonic hematopoietic precursors. In an earlier study, Helgason et al23 showed that deregulated expression of HOXB4 resulted in an expansion of the multipotential and erythroid precursor pool in EBs. However, overexpression of this particular HOX gene did not lead to the immortalization of these precursors. The strong immortalizing potential of HOX11 in the different hematopoietic populations raises important questions as to mechanisms of action. A recent study suggests that HOX11 can disrupt cell cycle checkpoints through interaction with specific protein phosphatases.57 Whether or not this is its primary mode of action in the EBHX lines remains to be determined.

In summary, we have shown that ectopic HOX11 expression in EBs leads to the immortalization of embryonic hematopoietic precursors. The EBHX cell lines derived from these precursors are representative of different stages of embryonic hematopoietic development and are the first to demonstrate both primitive and definitive potential. Using these lines, we have obtained evidence suggesting that LIF could play a role in the regulation of the primitive erythroid program. The availability of these lines provides a unique opportunity to further characterize the growth regulation of the primitive erythroid lineage, as well as to define the molecular events involved in its establishment.

    FOOTNOTES

   Submitted January 14, 1998; accepted March 27, 1998.
   Supported in part by Grant No. R01 HL48834A from the National Institutes of Health, Bethesda, MD, and by the National Cancer Institute of Canada, Toronto, Canada, (8398) with funds from the Canadian Cancer Society (to R.G.H.).
   Address reprint requests to Gordon Keller, PhD, National Jewish Medical and Research Center, 1400 Jackson St, Denver, CO 80206; e-mail: kellerg{at}njc.org.
   The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.

    ACKNOWLEDGMENT

We thank Ming Lu for the HOX11 antiserum, Scott Robertson, Georges Lacaud, Mitch Weiss, and Suzanne Kirby for critically reading the manuscript, and Leigh Landskroner for expert assistance with graphics and photography.

    REFERENCES
Abstract
Introduction
Methods
Results
Discussion
References

1. Russell E: Heriditary anemias of the mouse: A review for geneticists. Adv Genet 20:357, 1979[Medline] [Order article via Infotrieve]

2. Moore M, Metcalf D: Ontogeny of the hematopoietic system: Yolk sac origin of in vivo and in vitro colony forming cells in the developing mouse embryo. Br J Haematol 18:279, 1970[Medline] [Order article via Infotrieve]

3. Barker J: Development of the mouse hematopoietic system I. Types of hemoglobin produced in embryonic yolk sac and liver. Dev Biol 18:14, 1968[Medline] [Order article via Infotrieve]

4. Brotherton T, Chui D, Gauldie J, Patterson M: Hemoglobin ontogeny during normal mouse fetal development. Proc Natl Acad Sci USA 76:2853, 1979[Abstract/Free Full Text]

5. Johnson G, Barker D: Erythroid progenitor cells and stimulating factors during murine embryonic and fetal development. Exp Hematol 13:200, 1985[Medline] [Order article via Infotrieve]

6. Godin I, Dieterlen-Lievre F, Cumano A: Emergence of multipotent hemopoietic cells in the yolk sac and paraaortic splanchnopleura in mouse embryos, beginning at 8.5 days postcoitus. Proc Natl Acad Sci USA 92:773, 1995[Abstract/Free Full Text]

7. Muller AM, Medvinsky A, Strouboulis J, Grosveld F, Dzierzak E: Development of hematopoietic stem cell activity in the mouse embryo. Immunity 1:291, 1994[Medline] [Order article via Infotrieve]

8. Mucenski M, McLain K, Kier A, Swerdlow S, Schreiner C, Miller T, Pietryga D, Scott JW, Potter S: A functional c-myb gene is required for normal murine fetal hepatic hematopoiesis. Cell 65:677, 1991[Medline] [Order article via Infotrieve]

9. Okuda T, Van Deursen J, Hiebert S, Grosveld G, Downing JR: AML1, the target of multiple chromosomal translocations in human leukemia, is essential for normal fetal liver hematopoiesis. Cell 84:321, 1996[Medline] [Order article via Infotrieve]

10. Wang Q, Stacy T, Binder M, Marin-Padilla M, Sharpe A, Speck N: Disruption of the Cbfa2 gene causes necrosis and hemorrhaging in the central nervous system and blocks definitive hematopoiesis. Proc Natl Acad Sci USA 93:3444, 1996[Abstract/Free Full Text]

11. Nocka K, Majumder S, Chabot B, Ray P, Cervone M, Bernstein A, Besmer P: Expression of c-kit gene products in known cellular targets of W mutations in normal and W mutant mice-evidence for an impaired c-kit kinase in mutant mice. Genes Dev 3:816, 1989[Abstract/Free Full Text]

12. Wu H, Liu X, Jaenisch R, Lodish H: Generation of committed erythroid BFU-E and CFU-E progenitors does not require erythropoietin or the erythropoietin receptor. Cell 83:59, 1995[Medline] [Order article via Infotrieve]

13. Lin C, Lim S, DAgati V, Costantini F: Differential effects of an erythropoietin receptor gene disruption on primitive and definitive erythropoiesis. Genes Dev 10:154, 1996[Abstract/Free Full Text]

14. Wong P, Chung S, Chui D, Eaves C: Properties of the earliest clonogenic hemopoietic precursor to appear in the developing murine yolk sac. Proc Natl Acad Sci USA 83:3851, 1986[Abstract/Free Full Text]

15. Keller G, Kennedy M, Papayannopoulou T, Wiles M: Hematopoietic commitment during embryonic stem cell differentiation in culture. Mol Cell Biol 13:473, 1993[Abstract/Free Full Text]

16. Schmitt R, Bruyns E, Snodgrass H: Hematopoietic development of embryonic stem cells in vitro: Cytokine and receptor gene expression. Genes Dev 5:728, 1991[Abstract/Free Full Text]

17. Burkert U, von Ruden T, Wagner EF: Early fetal hematopoietic development from in vitro differentiated embryonic stem cells. New Biol 3:698, 1991[Medline] [Order article via Infotrieve]

18. Keller G: In vitro differentiation of embryonic stem cells. Curr Opin Cell Biol 7:862, 1995[Medline] [Order article via Infotrieve]

19. Kabrun N, Buhring HJ, Choi K, Ullrich A, Risau W, Keller G: Flk-1 expression defines a population of early embryonic hematopoietic precursors. Development 124:2039, 1997[Abstract]

20. Hawley RG, Fong AZC, Lu M, Hawley TS: The HOX11 homeobox-containing gene of human leukemia immortalizes murine hematopoietic precursors. Oncogene 9:1, 1994[Medline] [Order article via Infotrieve]

21. Perkins AC, Cory S: Conditional immortalization of mouse myelomonocytic, megakaryocytic and mast cell progenitors by the Hox-2.4 homeobox gene. EMBO J 12:3835, 1993[Medline] [Order article via Infotrieve]

22. Sauvageau G, Thorsteinsdottir U, Eaves C, Lawrence HJ, Largman C, Lansdorp PM, Humphries RK: Overexpression of HOXB4 in hematopoietic cells causes the selective expansion of more primitive populations in vitro and in vivo. Genes Dev 9:1753, 1995[Abstract/Free Full Text]

23. Helgason CD, Sauvageau G, Lawrence HJ, Largman C, Humphries RK: Overexpression of HOXB4 enhances the hematopoietic potential of embryonic stem cell differentiated in vitro. Blood 87:2740, 1996[Abstract/Free Full Text]

24. Hawley RG, Lieu FHL, Fong AZC, Hawley TS: Versatile retroviral vectors for potential use in gene therapy. Gen Ther 1:136, 1994[Medline] [Order article via Infotrieve]

25. Hawley RG, Hawley TS, Fong AZC, Quinto C, Collins M, Leonard JP, Goldman SJ: Thrombopoietic potential and serial repopulating ability of murine hematopoietic stem cells constitutively expressing interleukin-11. Proc Natl Acad Sci USA 93:10297, 1996[Abstract/Free Full Text]

26. Hawley TS, Sabourin LA, Hawley RG: Comparative analysis of retroviral vector expression in mouse embyonal carcinoma cells. Plasmid 22:120, 1989[Medline] [Order article via Infotrieve]

27. Brady G, Barbara M, Iscove N: Representative in vitro cDNA amplification from individual hemopoietic cells and colonies. Methods Mol Cell Biol 2:17, 1990

28. Church GM, Gilbert W: Genomic sequencing. Proc Natl Acad Sci USA 81:1991, 1984[Abstract/Free Full Text]

29. Karasuyama H, Melchers F: Establishment of mouse cell lines which constitutively secrete large quantitites of interleukin 2, 3, 4, or 5 using modified cDNA expression vectors. Eur J Immunol 18:97, 1988[Medline] [Order article via Infotrieve]

30. Hawley RG, Fong AZC, Reis MD, Zhang N, Lu M, Hawley TS: Transforming function of the HOX11/TCL3 homeobox gene. Cancer Res 57:337, 1997[Abstract/Free Full Text]

31. Rodewald H-R, Moingeon P, Lucich J, Dosiou C, Lopez P, Reinherz E: A population of early fetal thymocytes expressing Fcgamma RII/III contains precursors of T lymphocytes and natural killer cells. Cell 69:139, 1992[Medline] [Order article via Infotrieve]

32. Carlsson L, Candeias S, Staerz U, Keller G: Expression of Fcgamma RIII defines distinct subpopulations of fetal liver B cell and myeloid precursors. Eur J Immunol 25:2308, 1995[Medline] [Order article via Infotrieve]

33. Miyake K, Medina KL, Hayashi S, Ono S, Hamaoka T, Kincade PW: Monoclonal antibodies to Pgp-1/CD44 block lympho-hemopoiesis in long-term bone marrow cultures. J Exp Med 171:477, 1990[Abstract/Free Full Text]

34. Hemler ME: VLA proteins in the integrin family: Structures, functions, and their role on leukocytes. Annu Rev Immunol 8:365, 1990[Medline] [Order article via Infotrieve]

35. Miller BA, Antognetti G, Springer TA: Identification of cell surface antigens present on murine hematopoietic stem cells. J Immunol 134:3286, 1985[Abstract]

36. Ikuta K, Kina T, MacNeil I, Uchida N, Peault B, Chien Y-H, Weissman IL: A developmental switch in thymic lymphocyte maturation potential occurs at the level of hematopoietic stem cells. Cell 62:863, 1990[Medline] [Order article via Infotrieve]

37. Jordan C, McKearn J, Lemischka I: Cellular and developmental properties of fetal hematopoietic stem cells. Cell 61:953, 1990[Medline] [Order article via Infotrieve]

38. Spangrude G, Heimfeld S, Weissman I: Purification and characterization of mouse hematopoeitic stem cells. Science 241:58, 1988[Abstract/Free Full Text]

39. Morrison SJ, Hemmati HD, Wandycz AM, Weissman IL: The purification and characterization of fetal liver hematopoietic stem cells. Proc Natl Acad Sci USA 92:10302, 1995[Abstract/Free Full Text]

40. Trevisan M, Iscove NN: Phenotypic analysis of murine long-term hemopoietic reconstituting cells quantitated competitively in vivo and comparison with more advanced colony-forming progeny. J Exp Med 181:93, 1995[Abstract/Free Full Text]

41. Hestday K, Ruscetti FW, Ihle JN, Jacobsen SEW, Dubois CM, Kopp WC, Longo DL, Keller JR: Characterization and regulation of RB6-8C5 antigen expression on murine bone marrow cells. J Immunol 147:22, 1991[Abstract]

42. Coffman RL, Weissman IL: A monoclonal antibody that recognizes B cells and B cell precursors in mice. J Exp Med 153:269, 1981[Abstract/Free Full Text]

43. Owczarek C, Layton M, Robb L, Nicola N, Begley CG: Molecular basis of the soluble and membrane-bound forms of the murine leukemia inhibitory factor receptor alpha-chain. J Biol Chem 271:5495, 1996[Abstract/Free Full Text]

44. Begley CG, Aplan PD, Denning S, Haynes BF, Waldmann TA, Kirsch SS: The gene SCL is expressed during early hematopoiesis and encodes a differentiation-related DNA-binding motif. Proc Natl Acad Sci USA 86:10128, 1989[Abstract/Free Full Text]

45. Robb L, Lyons I, Li R, Hartley L, Kontgen F, Harvey RP, Metcalf D, Begley CG: Absence of yolk sac hematopoiesis from mice with a targeted disruption of the scl gene. Proc Natl Acad Sci USA 92:7075, 1995[Abstract/Free Full Text]

46. Shivdasani R, Mayer E, Orkin SH: Absence of blood formation in mice lacking the T-cell leukemia oncoprotein tal-1/SCL. Nature 373:432, 1995[Medline] [Order article via Infotrieve]

47. Orkin S: GATA-binding transcription factors in hematopoietic cells. Blood 80:575, 1992[Free Full Text]

48. Dieterlen-Lievre F: On the origin of haemopoietic stem cells in the avian embryo: An experimental approach. J Embryol Exp Morph 33:607, 1975[Medline] [Order article via Infotrieve]

49. Lassila O, Martin C, Toivanen P, Dieterlen-Lievre F: Erythropoiesis and lymphopoiesis in the chick yolk-sac-embryo chimeras: Contribution of yolk sac and intraembryonic stem cells. Blood 59:377, 1982[Abstract/Free Full Text]

50. Cumano A, Dieterlen-LIevre F, Godin I: Lymphoid potential, probed before circulation in mouse, is restricted to caudal intraembryonic splanchnopleura. Cell 86:907, 1996[Medline] [Order article via Infotrieve]

51. Nakano T, Kodama H, Honjo T: In vitro development of primitive and definitive erythrocytes from different precursors. Science 272:722, 1996[Abstract]

52. Kennedy M, Firpo M, Choi K, Wall C, Robertson S, Kabrun N, Keller G: A common precursor for primitive erythropoiesis and definitive haematopoiesis. Nature 386:488, 1997[Medline] [Order article via Infotrieve]

53. Turpen JB, Kelly CM, Mead PE, Zon LI: Bipotential primitive-definitive hematopoietic progenitors in the vertebrate embryo. Immunity 7:325, 1997[Medline] [Order article via Infotrieve]

54. Stewart CL, Kaspar P, Brunet LJ, Bhatt H, Gadi I, Kontgen F, Abbondanzo SJ: Blastocyst implantation depends on maternal expression of leukaemia inhibitory factor. Nature 359:76, 1992[Medline] [Order article via Infotrieve]

55. Escary J-L, Perreau J, Dumenil D, Ezine S, Brulet P: Leukaemia inhibitory factor is necessary for maintenance of haematopoietic stem cells and thymocyte stimulation. Nature 363:361, 1993[Medline] [Order article via Infotrieve]

56. Yoshida K, Taga T, Saito M, Suematsu S, Kumanogoh A, Tanaka T, Fujiwara H, Hirata M, Yamagami T, Nakahata T, Hirabayashi T, Yoneda Y, Tanaka K, Wang WZ, Mori C, Shiota K, Yoshida N, Kishimoto T: Targeted disruption of gp130, a common signal transducer for the interleukin 6 family of cytokines, leads to myocardial and hematological disorders. Proc Natl Acad Sci USA 93:407, 1996[Abstract/Free Full Text]

57. Kawabe T, Muslin AJ, Korsmeyer SJ: HOX11 interacts with protein phosphatases PP2A and PP1 and disrupts a G2/M cell-cycle checkpoint. Nature 385:454, 1997[Medline] [Order article via Infotrieve]


© 1998 by the American Society of Hematology.
 
0006-4971/98/92-0014$3.00/0

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
BloodHome page
C. Gekas, K. E. Rhodes, L. M. Gereige, H. Helgadottir, R. Ferrari, S. K. Kurdistani, E. Montecino-Rodriguez, R. Bassel-Duby, E. Olson, A. V. Krivtsov, et al.
Mef2C is a lineage-restricted target of Scl/Tal1 and regulates megakaryopoiesis and B-cell homeostasis
Blood, April 9, 2009; 113(15): 3461 - 3471.
[Abstract] [Full Text] [PDF]


Home page
Sci Aging Knowl EnvironHome page
S. Kodama, M. Davis, and D. L. Faustman
Diabetes and Stem Cell Researchers Turn to the Lowly Spleen
Sci. Aging Knowl. Environ., January 19, 2005; 2005(3): pe2 - pe2.
[Abstract] [Full Text]


Home page
Mol. Cell. Biol.Home page
X. Chen and J. J. Bieker
Stage-Specific Repression by the EKLF Transcriptional Activator
Mol. Cell. Biol., December 1, 2004; 24(23): 10416 - 10424.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Carotta, S. Pilat, A. Mairhofer, U. Schmidt, H. Dolznig, P. Steinlein, and H. Beug
Directed differentiation and mass cultivation of pure erythroid progenitors from mouse embryonic stem cells
Blood, September 15, 2004; 104(6): 1873 - 1880.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
H. Cave, S. Suciu, C. Preudhomme, B. Poppe, A. Robert, A. Uyttebroeck, M. Malet, P. Boutard, Y. Benoit, L. Mauvieux, et al.
Clinical significance of HOX11L2 expression linked to t(5;14)(q35;q32), of HOX11 expression, and of SIL-TAL fusion in childhood T-cell malignancies: results of EORTC studies 58881 and 58951
Blood, January 15, 2004; 103(2): 442 - 450.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Schmerer and T. Evans
Primitive erythropoiesis is regulated by Smad-dependent signaling in postgastrulation mesoderm
Blood, November 1, 2003; 102(9): 3196 - 3205.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. M. Hanson, H. Dickensheets, C.-K. Qu, R. P. Donnelly, and A. D. Keegan
Regulation of the Dephosphorylation of Stat6. PARTICIPATION OF TYR-713 IN THE INTERLEUKIN-4 RECEPTOR alpha , THE TYROSINE PHOSPHATASE SHP-1, AND THE PROTEASOME
J. Biol. Chem., January 31, 2003; 278(6): 3903 - 3911.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
W.-M. Yu, T. S. Hawley, R. G. Hawley, and C.-K. Qu
Immortalization of yolk sac-derived precursor cells
Blood, November 15, 2002; 100(10): 3828 - 3831.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
A. B. Cantor, S. G. Katz, and S. H. Orkin
Distinct Domains of the GATA-1 Cofactor FOG-1 Differentially Influence Erythroid versus Megakaryocytic Maturation
Mol. Cell. Biol., June 15, 2002; 22(12): 4268 - 4279.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
P. Zhang, E. Nelson, H. S. Radomska, J. Iwasaki-Arai, K. Akashi, A. D. Friedman, and D. G. Tenen
Induction of granulocytic differentiation by 2 pathways
Blood, May 29, 2002; 99(12): 4406 - 4412.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. M. Bjornsson, E. Andersson, P. Lundstrom, N. Larsson, X. Xu, E. Repetowska, R. K. Humphries, and S. Karlsson
Proliferation of primitive myeloid progenitors can be reversibly induced by HOXA10
Blood, December 1, 2001; 98(12): 3301 - 3308.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
W. Zhang, S. Kadam, B. M. Emerson, and J. J. Bieker
Site-Specific Acetylation by p300 or CREB Binding Protein Regulates Erythroid Kruppel-Like Factor Transcriptional Activity via Its Interaction with the SWI-SNF Complex
Mol. Cell. Biol., April 1, 2001; 21(7): 2413 - 2422.
[Abstract] [Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
L. Vallier, J. Mancip, S. Markossian, A. Lukaszewicz, C. Dehay, D. Metzger, P. Chambon, J. Samarut, and P. Savatier
An efficient system for conditional gene expression in embryonic stem cells and in their in vitro and in vivo differentiated derivatives
PNAS, February 15, 2001; (2001) 41617198.
[Abstract] [Full Text]


Home page
Endocr. Rev.Home page
C. J. Auernhammer and S. Melmed
Leukemia-Inhibitory Factor--Neuroimmune Modulator of Endocrine Function
Endocr. Rev., June 1, 2000; 21(3): 313 - 345.
[Abstract] [Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
L. Vallier, J. Mancip, S. Markossian, A. Lukaszewicz, C. Dehay, D. Metzger, P. Chambon, J. Samarut, and P. Savatier
An efficient system for conditional gene expression in embryonic stem cells and in their in vitro and in vivo differentiated derivatives
PNAS, February 27, 2001; 98(5): 2467 - 2472.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Keller, G.
Right arrow Articles by Hawley, R. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Keller, G.
Right arrow Articles by Hawley, R. G.
Related Collections
Right arrow Hematopoiesis and Stem Cells
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 1998 by American Society of Hematology         Online ISSN: 1528-0020