|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 92 No. 3 (August 1), 1998:
pp. 996-1002
Chemopreventive Agent Resveratrol, a Natural Product Derived From
Grapes, Triggers CD95 Signaling-Dependent Apoptosis in Human Tumor
Cells
By
Marie-Véronique Clément,
Jayshreekumari L. Hirpara,
Sanaul-Haq Chawdhury, and
Shazib Pervaiz
From the Department of Physiology and Oncology Research Institute,
NUMI, National University of Singapore, Singapore.
 |
ABSTRACT |
Resveratrol, a constituent of grapes and other food products, has
been shown to prevent carcinogenesis in murine models. We report here
that resveratrol induces apoptotic cell death in HL60 human leukemia
cell line. Resveratrol-treated tumor cells exhibit a dose-dependent
increase in externalization of inner membrane phosphatidylserine and in
cellular content of subdiploid DNA, indicating loss of membrane
phospholipid asymmetry and DNA fragmentation. Resveratrol-induced cell
death is mediated by intracellular caspases as observed by the
dose-dependent increase in proteolytic cleavage of caspase substrate
poly (ADP-ribose) polymerase (PARP) and the ability of caspase
inhibitors to block resveratrol cytotoxicity. We also show that
resveratrol treatment enhances CD95L expression on HL60 cells, as well
as T47D breast carcinoma cells, and that resveratrol-mediated cell
death is specifically CD95-signaling dependent. On the contrary,
resveratrol treatment of normal human peripheral blood lymphocytes
(PBLs) does not affect cell survival for up to 72 hours, which
correlates with the absence of a significant change in either CD95 or
CD95L expression on treated PBLs. These data show specific involvement
of the CD95-CD95L system in the anti-cancer activity of resveratrol and
highlight the chemotherapeutic potential of this natural product, in
addition to its recently reported chemopreventive activity.
© 1998 by The American Society of Hematology.
 |
INTRODUCTION |
A NEWER DIMENSION in the management of
neoplasia is the increasing awareness that chemoprevention, which
refers to the administration of chemical agents to prevent the
initiational and promotional events associated with carcinogenesis,
could be the most direct way to reduce mortality and morbidity. In the
search for new cancer chemopreventive agents over the past few years,
hundreds of plant extracts have been evaluated. Resveratrol, a
phytoalexin found in grapes, fruits, and root extracts of the weed
Polygonum cuspidatum, has been an important constituent of
Japanese and Chinese folk medicine.1-3 Indirect evidence
suggests that the presence of resveratrol in white and rose wine may
explain for the reduced risk of coronary heart disease associated with
moderate wine consumption.4,5 This effect has been
attributed to the inhibition of platelet aggregation and coagulation,
in addition to the antioxidant and anti-inflammatory activity of
resveratrol.6,7 Moreover, a recent report shows that
resveratrol is a potent cancer chemopreventive agent in assays
representing three major stages of carcinogenesis.8 Whereas
the ability to inhibit cellular events associated with tumor
initiation, promotion, and progression has been attributed to the
anticyclooxygenase activity (COX-1) of resveratrol, the precise
mechanism of antitumor activity is not well understood.
We report here the results of our findings showing that resveratrol
induces apoptotic cell death in HL60 leukemia cells as well as in T47D
breast carcinoma cells at doses minimally toxic to normal peripheral
blood lymphocytes (PBLs). Resveratrol-induced apoptosis is
mediated via caspase activation inhibitable by tetrapeptide caspase
inhibitors DEVD-CHO or YVAD-CHO. Furthermore, resveratrol enhances
CD95L expression and induces CD95 signaling-dependent cell death in
both tumor cell lines.
 |
MATERIALS AND METHODS |
Chemicals.
Resveratrol, propidium iodide (PI), MTT, crystal violet, and RNAse A
were obtained from Sigma Chemical Co (St Louis, MO). Annexin-fluorescein isothiocyanate (FITC), YVAD-CHO, and DEVD-CHO were
purchased from Clontech Laboratories, Inc (Palo Alto, CA). Anti-PARP
monoclonal antibody (C-2-10) was obtained from Biomol Research
Laboratories, Inc (Plymouth Meeting, PA), anti-CD95 (ZB4) was from
Upstate Biotechnology Inc (Lake Placid, NY), anti-CD95L (NOK-1) and
isotype control mouse IgG1 were purchased
from Pharmingen (San Diego, CA). Stock solution of resveratrol was made
in dimethylsulfoxide (DMSO) at a concentration of 100 mmol/L. Working
dilutions were directly made in the tissue culture medium.
Cytotoxicity assays.
Human promyelocytic leukemia cell line HL60 and human breast carcinoma
cell line T47D were obtained from ATCC (Rockville, MD) and maintained
in culture in RPMI 1640 supplemented with 10% fetal bovine serum (FBS;
Hyclone, Logan, UT) in an atmosphere of 5% CO2 at
37°C. Normal human PBLs were obtained from blood donated by healthy
volunteers by ficoll hypaque density centrifugation. For HL60 cells and
normal PBLs, 1 × 105 cells/well in a 96-well plate
were exposed to increasing concentrations of resveratrol (4 µmol/L to
32 µmol/L) for 24 to 48 hours (HL60) or for 24 to 72 hours (PBLs).
T47D cells were plated in 96-well plates (2 × 104/well) 24 hours before the addition of resveratrol.
Medium was then aspirated and replaced with fresh RPMI 1640 + 10% FBS
containing resveratrol for 24 hours. Equal concentration of the vehicle
carrier (DMSO) was always present in the control wells. For blocking
experiments, tumor cells were preincubated for 1 hour with anti-CD95 (1 µg/mL) or anti- CD95L (1 µg/mL), and in a separate set of
experiments with 2.5 µmol/L DEVD-CHO or YVAD-CHO alone or DEVD+YVAD
(2.5 µmol/L each) before the addition of 32 µmol/L resveratrol.
Mouse IgG1 was used as isotype control for
antibody-blocking experiments. Viability was determined by the MTT
assay for HL60 cells and for PBLs, or by the crystal violet assay for
T47D cells. For MTT assay, 10 µL of 5 mg/mL of MTT was added to each
well and incubated for 4 hours at 37°C. Elution of the precipitate
was performed with 200 µL of DMSO + 10 µL of Tris-glycine
buffer (0.1 mol/L Tris, 0.1 mol/L Glycine, pH 10.5, with 1N NaOH). Cell
viability was calculated from absorption values obtained at 570 nm
using an automated enzyme-linked immunosorbent assay (ELISA) reader.
For crystal violet assays, medium was aspirated and replaced for 10 minutes with 50 µL of 0.75% crystal violet in 50% ethanol, 0.25% NaCl, and 1.75% formaldehyde solution. Cells were then washed with
water, air-dried, and the dye eluted with PBS + 1% sodium dodecyl
sulfate (SDS) solution. Cell viability was assessed by dye absorbance
measured at 595 nm on an automated ELISA reader.
Phosphatidylserine (PS) translocation and DNA content analyses.
Externalization of inner membrane PS was assessed by the
ApoAlert-Annexin V Apoptosis Kit (Clontech) according to the
recommended protocol and analyzed by flow cytometry with Coulter Epics
Elite ESP flow cytometer (Coulter Corporation, Miami, FL) equipped with a single argon ion laser with the excitation wavelength at 488 nm and
the emission set at 525 nm (green). For cellular DNA content determination, 1 × 106 cells/mL were treated with
resveratrol as above. Sample preparation and staining with PI for DNA
content was performed as described elsewhere.9 Stained
cells were analyzed by flow cytometry with the excitation set at 488 nm
and emission at 610 nm (red). At least 10,000 events were analyzed.
Determination of caspase activation.
We analyzed caspase-specific cleavage of poly (ADP-ribose) polymerase
(PARP) in lysates of tumor cells treated with resveratrol. Lysates of HL60 cells (2 × 106) were prepared in
sample buffer (62.5 mmol/L Tris/HCl, pH 6.8; 6 mol/L urea; 10%
glycerol; 2% SDS; 0.00125% bromophenol blue; 5%
-mercaptoethanol) following overnight exposure to
resveratrol (8 to 32 µmol/L). Following 10% polyacrylamide gel
electrophoresis (PAGE) and transfer to nitro-cellulose, membranes were
blocked overnight with 5% dry milk in Tris buffered saline containing Tween 20 (TBST) (50 mmol/L Tris/HCl, pH 7.4; 150 mmol/L NaCl; 0.1%
Tween 20). Blocked membranes were exposed to anti-PARP antibody (1:10,000 dilution) for 2 hours at room temperature,
washed 3 times with TBST, and incubated with 1:10,000
dilution of anti-mouse IgG-HRP conjugate supplied as 0.8 mg/mL (Pierce,
Rockford, IL) for 1 hour and washed 3 times with TBST.
Chemiluminescence was detected using the SuperSignal Substrate Western
Blotting Kit (Pierce).
Immunofluorescence for CD95 and CD95L.
Immunofluorescence staining for CD95 and CD95L was performed as
described elsewhere.10 Briefly, HL60, T47D cells, and
normal human PBLs (1 × 106) were treated with
resveratrol (32 µmol/L), washed twice with phosphate-buffered saline
(PBS) + 1% FBS, and fixed in 1 mL of 4% paraformaldehyde for 15 minutes on ice. After a wash with PBS, cells were permeablized in
ethanol for 1 hour on ice, washed with PBS, and incubated with 1 µg
of anti-CD95 or anti-CD95L for 30 minutes on ice. Following another
wash with PBS + 1% FBS, samples were exposed to FITC-conjugated goat
anti-mouse IgG for 30 minutes, washed, and resuspended in 0.5 mL of 2%
paraformaldehyde. Mouse IgG1 was used as isotype
control. Viable cells were gated on forward side scatter analysis, and
a total of 10,000 events were analyzed by flow cytometry using an
emission wavelength of 525 nm.
Reverse transcription polymerase chain reaction (RT-PCR) for CD95L
expression.
Total RNA was extracted from HL60 cells (10 × 106)
following incubation with 32 µmol/L resveratrol for 0, 4, 8, and 20 hours using TRIZOL reagent (GIBCO-BRL, Gaithesburg, MD) according to the manufacturer's recommendations. First-strand cDNA synthesis was
performed with 5 µg of each RNA using oligo dT primers. Two hundred
units of Superscript reverse transcriptase (GIBCO-BRL) were used per
reaction (total volume 20 µL), and incubation was performed at
42°C for 50 minutes followed by denaturation at 70°C for 10 minutes. PCR amplification was then performed using 3 µL of the
reversed transcribed cDNA using CD95L-specific primers (sense:
5 ATGCAGCAGCCCTTCAAT and antisense:
5 CTTCACTCCACAAAGCAGGAC) generating a product of 524 bp. PCR was
performed using a thermocycler (M J Research Inc, Watertown, MA) with
Ready to Go PCR beads (Pharmacia Biotech, Uppsala, Sweden). An
initial step of 94°C for 2 minutes was followed by 34 cycles of
94°C for 30 seconds, 56°C for 45 seconds, and 68°C for 1 minute. A final extension step at 68°C for 8 minutes was then
performed and the product was visualized on a 1.5% agarose gel.
-actin amplification using the same cDNAs and PCR conditions was
performed using primers (sense: 5 ATGGATGATGATATCGCCGCG and
antisense: 5 CTAGAAGCATTTGCGGTGGAC) as a control.
 |
RESULTS AND DISCUSSION |
Resveratrol induces caspase-mediated apoptosis in HL60 cells.
HL60 cells were exposed to increasing concentrations (4 to 32 µmol/L)
of commercially available resveratrol (trans resveratrol) for
24 to 48 hours. Our results show a dose-dependent increase in tumor
cell mortality with greater than 80% cell death by 48 hours
(Fig 1). To investigate the mode of cell
death induced by resveratrol, we studied three hallmarks of apoptotic
commitment, ie, DNA subdiploidy, change in membrane phospholipid
asymmetry, and intracellular caspase activation. Analysis of DNA
content following resveratrol treatment of HL60 cells indicates an
increase in the subdiploid DNA content as shown by the
sub-G1 population on cell cycle analysis
(Fig 2). This fraction is representative of
cells with decreased staining for PI and is an indicator of DNA
fragmentation associated with apoptotic cell death.11 Our data also show that HL60 cells treated for 18 hours with 32 µmol/L resveratrol exhibit increase in cell surface expression of inner membrane PS (Fig 2), indicating loss of phospholipid asymmetry. PS
externalization is another marker associated with onset of apoptotic
cell death in response to a variety of stimuli.12-14 Finally, we investigated the role of intracellular
caspases,15 homologs of the Caenorhabditis
elegans apoptotic inducer CED-3 family16 in apoptotic
cell death induced by resveratrol. Apoptotic cells exhibit increased
caspase activity detected by cleavage of caspase-specific substrate
PARP that occurs at the onset of apoptosis.17-19 Our
results indicate a dose-dependent increase in the cleaved PARP fragment
(85 kD) upon Western analysis of lysates from resveratrol-treated HL60
cells indicating caspase activation (Fig
3A). Furthermore, we show that resveratrol cytotoxicity is
significantly inhibited in the presence of either tetrapeptide inhibitor of caspase-3 (DEVD-CHO) or caspase-1 and caspase-1-like proteases (YVAD-CHO), and complete rescue of the cells is obtained when
both inhibitors are added together (Fig 3B). These data clearly highlight the role of caspase activation in resveratrol-induced cell
death. Taken together, our first set of experiments show that leukemia
cells treated with resveratrol exhibit morphological and biochemical
hallmarks of apoptotic cell death.

View larger version (11K):
[in this window]
[in a new window]
| Fig 1.
Sensitivity of HL60 cells to resveratrol. HL60 cells were
treated with increasing concentrations of resveratrol for 24 and 48 hours, and viability was determined by the MTT assay as described in
Materials and Methods. Data shown are representative of at least three
independent experiments.
|
|

View larger version (14K):
[in this window]
[in a new window]
| Fig 2.
Resveratrol induces DNA fragmentation and loss of
membrane phospholipid asymmetry. (A) Flow cytometry analysis of DNA
cleavage in resveratrol-treated tumor cells. HL60 cells were treated
with 32 µmol/L resveratrol for 18 hours, immediately fixed in
ethanol, and stained with PI for DNA content analysis as described in
Materials and Methods. Sub-G1 population indicates
subdiploid DNA content indicative of apoptotic DNA fragmentation. Data
shown are representative of at least three independent experiments. (B)
Externalization of membrane PS induced by resveratrol in HL60 cells. 1 × 106 cells were treated with resveratrol for 18 hours,
and PS translocation was assessed by staining tumor cells with Annexin
V-FITC (1 µg/mL) conjugate. A total of 10,000 events were analyzed by
flow cytometry.
|
|

View larger version (31K):
[in this window]
[in a new window]
| Fig 3.
Caspase-mediated apoptotic cell death induced by
resveratrol (A) SDS-PAGE analysis of caspase-specific PARP cleavage in
lysates of resveratrol-treated HL60 cells. Tumor cells (2 × 106) were treated with resveratrol (8 to 32 µmol/L) for
24 hours, lysed, subjected to 10% SDS-PAGE, and transferred to
nitro-cellulose membranes as described in Materials and Methods. PARP
cleavage was detected using a primary monoclonal antibody C-2-10
followed by the secondary HRP-conjugated anti-mouse IgG. Arrows
indicate the intact protein of 116 kD and the proteolytic cleaved
fragment (85 kD). (B) Inhibition of apoptotic cell death in HL60 cells treated with 32 µmol/L resveratrol for 24 hours in the presence of
2.5 µmol/L caspase inhibitors DEVD-CHO or YVAD-CHO or both. Cytotoxicity was determined by the MTT assay, and data shown are mean
±SD of three independent experiments.
|
|
Resveratrol enhances CD95L and induces CD95 signaling-dependent
apoptosis in HL60 and T47D cells.
Recent observations have highlighted the role of CD95-CD95L system in
chemotherapy-induced apoptosis of tumor cells via upregulation of the
CD95 receptor or its ligand CD95L.20-22 Given the fact that HL60 leukemia cells, like many other leukemia cell lines,23 express the CD95 receptor, we hypothesized that resveratrol-induced HL60 cell death may also involve the CD95-CD95L system. Indeed, our
results show that enhanced CD95L expression is detectable within 12 hours of treatment with resveratrol and is significantly increased at
24 hours following drug exposure (Fig 4).
These findings are corroborated by increased expression of CD95L mRNA
following exposure to resveratrol (4 to 20 hours), as shown in Fig 4B.
On the contrary, CD95 expression is not significantly changed at 12 hours; however, by 24 hours the cells surviving resveratrol cytotoxicity have a CD95low phenotype, suggesting that
resveratrol-induced cell death preferentially targets
CD95high-expressing cells. Moreover, a comparison of
resveratrol-induced CD95L upregulation and cell cytotoxicity reveals
that cell death measured by cell cytotoxicity assays coincides with
increased expression of CD95L as shown in Fig 4. The specific
involvement of CD95-CD95L system in HL60 cell death induced by
resveratrol is further supported by significant inhibition of cell
death in the presence of either anti-CD95 or anti-CD95L, whereas
isotype control antibody has little effect on cell death as shown in
Fig 5.

View larger version (26K):
[in this window]
[in a new window]

View larger version (22K):
[in this window]
[in a new window]
| Fig 4.
CD95 and CD95L expression following resveratrol treatment
of HL60 cells. (A) HL60 cells were treated with 32 µmol/L
resveratrol, and surface expression of CD95 and CD95L was analyzed by
flow cytometry at 6 hours, 12 hours, and 24 hours as described in
Materials and Methods. The shaded histograms are for mouse
IgG1 used as an isotype control, the dotted lines
represent nontreated HL60 cells, and the solid lines indicate
resveratrol-treated HL60 cells. At least 10,000 events were
counted, and data shown are representative of at least three
separate experiments. (B) RT-PCR amplification of CD95L and -actin
mRNA following treatment of HL60 cells with 32 µmol/L resveratrol for
0, 4, 8, and 20 hours.
|
|

View larger version (38K):
[in this window]
[in a new window]
| Fig 5.
Resveratrol-induced tumor cell death is dependent on
CD95-CD95L interaction. HL60 cells were preincubated for 1 hour with either anti-CD95 (1 µg/mL) or anti-CD95L (1 µg/mL) before the addition of 32 µmol/L resveratrol. Cell viability was determined following 24 hours incubation by the MTT assay, and data shown are mean
±SD of three independent experiments.
|
|
To ascertain if resveratrol-mediated CD95-dependent apoptosis was a
general phenomenon or if it was exclusive for leukemia cells, we
investigated the effect of resveratrol on a solid tumor model, ie, T47D
breast carcinoma cell line. Similar to HL60 cells, T47D cells
constitutively express the CD95 receptor but not the CD95L. However,
our data show that following 18 hours of exposure to resveratrol there
is a significant increase in cell surface expression of CD95L, whereas
CD95 expression essentially remains unchanged
(Fig 6A). Concomitantly, 37% of
resveratrol-treated (32 µmol/L) T47D cells undergo cell death, which
is completely inhibited in the presence of anti-CD95 antibody (Fig 6B).
These data show that CD95-signaling-dependent apoptosis triggered by resveratrol is not exclusive for human leukemia cells and further highlight the specific involvement of the CD95-CD95L system in tumor
cell death induced by resveratrol.

View larger version (25K):
[in this window]
[in a new window]
| Fig 6.
Resveratrol enhances CD95L expression and induces CD95
signaling-dependent cell death in T47D cells. (A) T47D cells were
treated with 32 µmol/L resveratrol for 18 hours, and surface
expression of CD95 and CD95L was analyzed by flow cytometry as
described in Materials and Methods. The shaded histograms are for mouse IgG1 used as an isotype control, the dotted lines
represent nontreated T47D cells, and the solid lines indicate
resveratrol-treated T47D cells. At least 10,000 events were counted,
and data shown are representative of at least three separate
experiments. (B) T47D cells were treated for 24 hours with 32 µmol/L
resveratrol alone (medium) or in the presence of 1 µg/mL of anti-CD95
(anti-CD95) or IgG1 (isotype Ig) antibody. Cell
viability was determined by the crystal violet assay, and data shown
are mean ±SD of three independent experiments.
|
|
Resveratrol does not affect survival of normal human PBLs.
Triggered by our findings on the antitumor activity of resveratrol, we
next investigated the effect of resveratrol treatment on normal human
PBLs. Our data show that resveratrol has minimal toxicity to normal
human PBLs for up to 72 hours as shown in
Fig 7A. Moreover, normal human PBLs that
express basal levels of CD9524 and CD95L25 do
not significantly undergo change in surface expression of either CD95
or CD95L following resveratrol exposure for up to 72 hours (Fig 7B). In
a separate set of experiments, PBLs were activated with
phytohemaglutinin (PHA) in the presence or absence of resveratrol (up
to 32 µmol/L) for 72 hours. No acceleration of activation-induced
cell death was observed as compared with PHA-activated cells alone
(data not shown). The inability of resveratrol to induce cell death in
normal human PBLs, unlike HL60 and T47D cells, could then be explained
by the failure of resveratrol to upregulate CD95L, thereby preventing
CD95-CD95L interaction in normal PBLs. These results show that
resveratrol-induced cell death is tumor specific and further support
the involvement of CD95-CD95L system as the apoptotic trigger.

View larger version (10K):
[in this window]
[in a new window]

View larger version (26K):
[in this window]
[in a new window]
| Fig 7.
Effect of resveratrol on normal human PBL survival and
cell surface expression of CD95 and CD95L. (A) Normal human PBLs were treated with resveratrol (8 to 32 µmol/L) for 24 and 72 hours as
described in Materials and Methods. Cell viability was determined by
the MTT assay and represents three independent observations. (B) Flow
cytometry analysis of CD95 and CD95L expression on normal human PBLs
was performed as for HL60 cells, except that PBLs were analyzed for 12, 24, and 72 hours. The shaded histograms are for mouse
IgG1 used as an isotype control, the dotted lines
represent nontreated PBLs, and the solid lines indicate
resveratrol-treated PBLs. At least 10,000 events were counted, and data
shown are representative of at least three separate experiments.
|
|
The selective targeting of human tumor cell lines by resveratrol is
extremely interesting, especially in the context of a recent report on
the chemopreventive activity of this natural product in murine models
of skin tumors.8 Our findings suggest a basis for the
observed inhibition of tumor formation in these animals. The
chemopreventive activity of resveratrol could be explained by the
induction of CD95-dependent apoptotic cell death in tumor cells,
resulting in inhibition of tumor initiation and progression. Several
recent communications have highlighted the role of the CD95-CD95L
system in drug-induced or immune-mediated clearance of tumor
cells,20-23,26,27 suggesting that the fate of antitumor
therapy might be determined by the balance between CD95 and CD95L
expression on tumor cells and on immune cells. Once triggered, the CD95
receptor can then activate a series of intracellular events culminating
in the death cascade composed of intracellular
caspases.28,29 These observations have led to the
suggestion that autocrine and/or paracrine CD95/CD95L-mediated signaling might be one critical event in drug-induced tumor cell death.
Our observations show that resveratrol treatment provides the critical
level of expression of the CD95-CD95L system on tumor cells sufficient
to trigger intracellular apoptotic cascade. In addition, the inability
of resveratrol to induce CD95-mediated cell death in normal PBLs
further supports the specific involvement of the CD95-CD95L system in
resveratrol-induced tumor cell death. Resveratrol-induced enhancement
of CD95L on CD95+ tumor cells constitutes an effective
system for the induction of tumor suicide without nonspecific toxicity
to the normal PBLs. However, to extrapolate our in vitro findings to in
vivo chemoprevention, more studies need to be performed to determine
the stability, half-life, and biologically significant concentrations
of resveratrol needed to activate the apoptotic pathway in vivo.
Nevertheless, these data provide evidence that this natural
chemopreventive agent, not known for its chemotherapeutic potential,
also fulfils two basic criteria for an effective therapeutic agent, ie,
tumor specificity and minimal toxicity to the normal hematopoietic
cells. Taken together, our findings strongly suggest that resveratrol merits further investigation as a cancer chemopreventive as well as a
chemotherapeutic agent in humans.
 |
FOOTNOTES |
Supported by Grant No. 970333 from the National University of
Singapore.
Address reprint requests to Shazib Pervaiz, MD, PhD, Department of
Physiology, Faculty of Medicine, National University of Singapore, 10 Kent Ridge Crescent, Singapore 119260.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.
 |
ACKNOWLEDGMENT |
The authors acknowledge the technical assistance of Christopher Loh,
Bee Ling Ng, and Kameedea Appleton.
 |
REFERENCES |
1.
Nonomura S,
Kanagawa H,
Makimoto A:
Chemical constituents of polygonaceous plants. I. Studies on the components of K0-jo-kon. (Polygonum cuspidatum SIEB et ZUCC).
Yakugaku Zasshi
83:988,
1963
2.
Kubo M,
Kimura Y,
Shin H,
Haneda T,
Tani T,
Namba K:
Studies on the antifungal substance of crude drug (II). On the roots of Polygonum cupsidatum Sieb et Zucc (Polygonaceae).
Shoyakugaku Zashi
35:58,
1981
3.
Soleas GJ,
Diamandis EP,
Goldberg DM:
Resveratrol: A molecule whose time has come? and gone?
Clin Biochem
30:91,
1997[Medline]
[Order article via Infotrieve]
4.
Rimm EB,
Klatsky A,
Grobbee D,
Stampfer MJ:
Review of moderate alcohol consumption and reduced risk of coronary heart disease: Is the effect due to beer, wine, or spirits?
Br Med J
312:731,
1996[Abstract/Free Full Text]
5.
Gaziano JM,
Buring JE,
Breslow JL,
Goldhaber SZ,
Rosner B,
Van Denburgh M,
Willett W,
Hennekens CH:
Moderate alcohol intake, increased levels of low density lipoprotein and its subfractions and decreased risk of myocardial infarction.
N Engl J Med
329:1829,
1993[Abstract/Free Full Text]
6.
Pace-Asciak CR,
Hahn S,
Diamandis EP,
Soleas G,
Goldberg DM:
The red wine phenolics trans resveratrol and quercetin block human platelet aggregation and eicosanoid synthesis: Implications for protection against coronary heart disease.
Clin Chim Acta
235:207,
1995[Medline]
[Order article via Infotrieve]
7.
Frankel EN,
Waterhouse AL,
Kinsella JE:
Inhibition of human LDL oxidation by reveratrol.
Lancet
341:1103,
1993[Medline]
[Order article via Infotrieve]
8.
Jang M,
Cai L,
Udeani GO,
Slowing KV,
Thomas CF,
Beecher CW,
Fong HH,
Farnsworth NR,
Kinghorn AD,
Mehta RG,
Moon RC,
Pezzuto JM:
Cancer chemopreventive activity of resveratrol, a natural product derived from grapes.
Science
275:218,
1997[Abstract/Free Full Text]
9.
O'Brien MC,
Healy SF Jr,
Raney SR,
Hurst JM,
Avner B,
Hanly A,
Mies C,
Freeman JW,
Snow C,
Koester SK,
Bolton WE:
Discrimination of late apoptotic/necrotic cells (type III) by flow cytometry in solid tumors.
Cytometry
28:81,
1997[Medline]
[Order article via Infotrieve]
10.
Villunger A,
Egle A,
Kos M,
Hartmann BL,
Geley S,
Kofler R,
Greil R:
Drug-induced apoptosis is associated with enhanced Fas(Apo-1/CD95) ligand expression but occurs independently of Fas(Apo-1/CD95) signaling in human T-acute lymphatic leukemia cells.
Cancer Res
57:3331,
1997[Abstract/Free Full Text]
11.
Kaufman SH:
Induction of endonucleolytic DNA cleavage in human acute myelogenous leukemia cells by etoposide, camptotecin, and other cytotoxic anticancer drugs: Cautionary note.
Cancer Res
49:5870,
1989[Abstract/Free Full Text]
12.
Connor J,
Pak CC,
Schroit AJ:
Exposure of phosphatidylserine in the outer leaflet of human red cells. Relationship to cell density, cell age, and clearance by mononuclear cells.
J Biol Chem
28:2399,
1994
13.
Martin SJ,
Reutelingsperger CPM,
McGahon AJ,
Rader J,
van Schie RCAA,
LaFace DM,
Green DR:
Early redistribution of plasma membrane phosphatidylserine is a general feature of apoptosis regardless of the initiating stimulus. Inhibition by overexpression of Bcl-2 and Abl.
J Exp Med
182:1545,
1995[Abstract/Free Full Text]
14.
Fadok VA,
Voelker DR,
Campbell PA,
Cohen JJ,
Bratton DL,
Henson PM:
Exposure of phosphatidylserine on the surface of apoptotic lymphocytes triggers recognition and removal by macrophages.
J Immunol
148:2207,
1992[Abstract]
15.
Alnemri ES,
Livingston DJ,
Nicholson DW,
Salvesen G,
Thornberry NA,
Wong WW,
Yuian J:
Human ICE/CED-3 protease nomenclature.
Cell
87:171,
1996[Medline]
[Order article via Infotrieve]
16.
Yuan J,
Shaham S,
Ledoux S,
Ellis HM,
Horvitz HR:
The C. elegans cell death gene ced-3 encodes a protein similar to mammalian interleukin 1b converting enzyme.
Cell
75:641,
1993[Medline]
[Order article via Infotrieve]
17.
Miura M,
Zhu H,
Rotello R,
Hartwieg EA,
Yuan J:
Induction of apoptosis in fibroblasts by interleukin1b-converting enzyme, a mamalian homolog of the C. elegans cell death gene ced-3.
Cell
75:653,
1993[Medline]
[Order article via Infotrieve]
18.
Lazebnick YA,
Kaufman SH,
Desnoyers S,
Poirier GG,
Earnshaw WC:
Cleavage of poly (ADP-ribose) polymerase by the proteinase with properties like ICE.
Nature
371:346,
1994[Medline]
[Order article via Infotrieve]
19.
Kaufman SH,
Desnoyers S,
Ottaviano Y,
Davidson NE,
Poirier GG:
Specific proteolytic cleavage of poly (ADP-ribose) polymerase: An early marker of chemotherapy-induced apoptosis.
Cancer Res
53:3976,
1993[Abstract/Free Full Text]
20.
Friesen C,
Herr I,
Krammer PH,
Debatin K-M:
Involvement of the CD95 (APO-1/Fas) receptor/ligand system in drug-induced apoptosis in leukemia cells.
Nat Med
2:574,
1996[Medline]
[Order article via Infotrieve]
21.
Muller M,
Strand S,
Hug H,
Heinemann E-M,
Walczak H,
Hofmann WJ,
Stremmel W,
Krammer PH,
Galle PR:
Drug-induced apoptosis in hepatoma cells is mediated by the CD95 (APO-1/Fas) receptor/ligand system and involves activation of wild type p53.
J Clin Invest
99:403,
1997[Medline]
[Order article via Infotrieve]
22.
Fulda S,
Sieverts H,
Friesen C,
Herr I,
Debatin KM:
The CD95 (APO-1/Fas) system mediates drug-induced apoptosis in neuroblastoma cells.
Cancer Res
57:3823,
1997[Abstract/Free Full Text]
23.
Micheau O,
Solary E,
Hammann A,
Martin F,
Dimanche-Boitrel M-T:
Sensitization of cancer cells treated with cytotoxic drugs to fas-mediated cytotoxicity.
J Natl Cancer Inst
89:783,
1997[Abstract/Free Full Text]
24.
Miyawaki T,
Uehara T,
Nibu R,
Tsuji T,
Yachie A,
Yonehara S,
Taniguchi N:
Differential expression of apoptosis-related Fas antigen on lymphocyte subpopulations in human peripheral blood.
J Immunol
149:3753,
1992[Abstract]
25.
Suda T,
Takahashi T,
Goldstein P,
Nagata S:
Molecular cloning and expression of the Fas ligand, a novel member of the tumor necrosis factor family.
Cell
75:1169,
1993[Medline]
[Order article via Infotrieve]
26.
Trauth BC,
Klas C,
Peters AJM,
Matzku S,
Moller P,
Falk W,
Debatin KM,
Krammer PH:
Monoclonal antibody-mediated tumor regression by induction of apoptosis.
Science
245:301,
1989[Abstract/Free Full Text]
27.
Rensing-Ehl A,
Frei K,
Flury R,
Matiba B,
Mariani SM,
Weller M,
Aebischer P,
Krammer PH,
Fontana A:
Local Fas/Apo-1 (CD95) ligand-mediated tumor cell killing in vivo.
Eur J Immunol
25:2253,
1995[Medline]
[Order article via Infotrieve]
28.
Muzio M,
Chinnaiyan AM,
Kischkel FC,
O'Rouke K,
Shevchenko A,
Ni J,
Scaffidi C,
Bretz JD,
Zhang M,
Gentz R,
Mann M,
Krammer HP,
Peter ME,
Dixit V:
FLICE, a novel FADD-homologous to ICE/CED-3-like protease, is recruited to the CD95(Fas/Apo-1) death-inducing signaling complex.
Cell
85:817,
1996[Medline]
[Order article via Infotrieve]
29.
Kuida K,
Lippke JA,
Ku G,
Harding MW,
Livingston DJ,
Su MS,
Flavell RA:
Altered cytokine export and apoptosis in mice deficient in interleukin 1b converting enzyme.
Science
267:2000,
1995[Abstract/Free Full Text]

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
P. D. A. Issuree, P. N. Pushparaj, S. Pervaiz, and A. J. Melendez
Resveratrol attenuates C5a-induced inflammatory responses in vitro and in vivo by inhibiting phospholipase D and sphingosine kinase activities
FASEB J,
August 1, 2009;
23(8):
2412 - 2424.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Bianchi, C. Zuccato, I. Lampronti, M. Borgatti, and R. Gambari
Fetal Hemoglobin Inducers from the Natural World: A Novel Approach for Identification of Drugs for the Treatment of {beta}-Thalassemia and Sickle-Cell Anemia
Evid. Based Complement. Altern. Med.,
June 1, 2009;
6(2):
141 - 151.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. B. Harikumar, G. Kuttan, and R. Kuttan
Phyllanthus amarus Inhibits Cell Growth and Induces Apoptosis in Dalton's Lymphoma Ascites Cells Through Activation of Caspase-3 and Downregulation of Bcl-2
Integr Cancer Ther,
June 1, 2009;
8(2):
190 - 194.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Seya, K. Kanemaru, C. Sugimoto, M. Suzuki, T. Takeo, S. Motomura, H. Kitahara, M. Niwa, Y. Oshima, and K.-I. Furukawa
Opposite Effects of Two Resveratrol (trans-3,5,4'-Trihydroxystilbene) Tetramers, Vitisin A and Hopeaphenol, on Apoptosis of Myocytes Isolated from Adult Rat Heart
J. Pharmacol. Exp. Ther.,
January 1, 2009;
328(1):
90 - 98.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. J. Zhang, M. Wu, N. W. Schoene, W.-H. Cheng, T. T. Y. Wang, A. A. Alshatwi, M. Alsaif, and K. Y. Lei
Effect of resveratrol and zinc on intracellular zinc status in normal human prostate epithelial cells
Am J Physiol Cell Physiol,
January 1, 2009;
297(3):
C632 - C644.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. S. Byun, J. K. Song, Y.-R. Kim, L. Piao, M. Won, K. A. Park, B. L. Choi, H. Lee, J. H. Hong, J. Park, et al.
Caspase-8 has an essential role in resveratrol-induced apoptosis of rheumatoid fibroblast-like synoviocytes
Rheumatology,
March 1, 2008;
47(3):
301 - 308.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E.-O. Lee, H.-J. Lee, H.-S. Hwang, K.-S. Ahn, C. Chae, K.-S. Kang, J. Lu, and S.-H. Kim
Potent inhibition of Lewis lung cancer growth by heyneanol A from the roots of Vitis amurensis through apoptotic and anti-angiogenic activities
Carcinogenesis,
October 1, 2006;
27(10):
2059 - 2069.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. KASDALLAH-GRISSA, B. MORNAGUI, E. AOUANI, M. HAMMAMI, N. GHARBI, A. KAMOUN, and S. EL-FAZAA
PROTECTIVE EFFECT OF RESVERATROL ON ETHANOL-INDUCED LIPID PEROXIDATION IN RATS
Alcohol Alcohol.,
May 1, 2006;
41(3):
236 - 239.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Sengottuvelan, P. Viswanathan, and N. Nalini
Chemopreventive effect of trans-resveratrol - a phytoalexin against colonic aberrant crypt foci and cell proliferation in 1,2-dimethylhydrazine induced colon carcinogenesis
Carcinogenesis,
May 1, 2006;
27(5):
1038 - 1046.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-J. Chun, S.-K. Lee, and M. Y. Kim
MODULATION OF HUMAN CYTOCHROME P450 1B1 EXPRESSION BY 2,4,3',5'-TETRAMETHOXYSTILBENE
Drug Metab. Dispos.,
December 1, 2005;
33(12):
1771 - 1776.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Boissy, T. L. Andersen, B. M. Abdallah, M. Kassem, T. Plesner, and J.-M. Delaisse
Resveratrol Inhibits Myeloma Cell Growth, Prevents Osteoclast Formation, and Promotes Osteoblast Differentiation
Cancer Res.,
November 1, 2005;
65(21):
9943 - 9952.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Vyas, Y. Asmerom, and D. D. De Leon
Resveratrol Regulates Insulin-Like Growth Factor-II in Breast Cancer Cells
Endocrinology,
October 1, 2005;
146(10):
4224 - 4233.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. B. Jones, S. E. DePrimo, M. L. Whitfield, and J. D. Brooks
Resveratrol-Induced Gene Expression Profiles in Human Prostate Cancer Cells
Cancer Epidemiol. Biomarkers Prev.,
March 1, 2005;
14(3):
596 - 604.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. C. Lazze, M. Savio, R. Pizzala, O. Cazzalini, P. Perucca, A. I. Scovassi, L. A. Stivala, and L. Bianchi
Anthocyanins induce cell cycle perturbations and apoptosis in different human cell lines
Carcinogenesis,
August 1, 2004;
25(8):
1427 - 1433.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S.-H. Tseng, S.-M. Lin, J.-C. Chen, Y.-H. Su, H.-Y. Huang, C.-K. Chen, P.-Y. Lin, and Y. Chen
Resveratrol Suppresses the Angiogenesis and Tumor Growth of Gliomas in Rats
Clin. Cancer Res.,
March 15, 2004;
10(6):
2190 - 2202.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. A. Ahmad, M.-V. Clement, I. M. Hanif, and S. Pervaiz
Resveratrol Inhibits Drug-Induced Apoptosis in Human Leukemia Cells by Creating an Intracellular Milieu Nonpermissive for Death Execution
Cancer Res.,
February 15, 2004;
64(4):
1452 - 1459.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Bian, T. D. Giordano, H.-J. Lin, G. Solomon, V. P. Castle, and A. W. Opipari Jr.
Chemotherapy-induced Apoptosis of S-type Neuroblastoma Cells Requires Caspase-9 and Is Augmented by CD95/Fas Stimulation
J. Biol. Chem.,
February 6, 2004;
279(6):
4663 - 4669.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. PERVAIZ
Resveratrol: from grapevines to mammalian biology
FASEB J,
November 1, 2003;
17(14):
1975 - 1985.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. J. Gescher and W. P. Steward
Relationship between Mechanisms, Bioavailibility, and Preclinical Chemopreventive Efficacy of Resveratrol: A Conundrum
Cancer Epidemiol. Biomarkers Prev.,
October 1, 2003;
12(10):
953 - 957.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Whiteman, J. L. Siau, and B. Halliwell
Lack of Tyrosine Nitration by Hypochlorous Acid in the Presence of Physiological Concentrations of Nitrite. IMPLICATIONS FOR THE ROLE OF NITRYL CHLORIDE IN TYROSINE NITRATION IN VIVO
J. Biol. Chem.,
February 28, 2003;
278(10):
8380 - 8384.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
U. G. B. Haider, D. Sorescu, K. K. Griendling, A. M. Vollmar, and V. M. Dirsch
Resveratrol Suppresses Angiotensin II-Induced Akt/Protein Kinase B and p70 S6 Kinase Phosphorylation and Subsequent Hypertrophy in Rat Aortic Smooth Muscle Cells
Mol. Pharmacol.,
October 1, 2002;
62(4):
772 - 777.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Gao, Y. X. Xu, G. Divine, N. Janakiraman, R. A. Chapman, and S. C. Gautam
Disparate In Vitro and In Vivo Antileukemic Effects of Resveratrol, a Natural Polyphenolic Compound Found in Grapes
J. Nutr.,
July 1, 2002;
132(7):
2076 - 2081.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Kuwajerwala, E. Cifuentes, S. Gautam, M. Menon, E. R. Barrack, and G. P. V. Reddy
Resveratrol Induces Prostate Cancer Cell Entry into S Phase and Inhibits DNA Synthesis
Cancer Res.,
May 1, 2002;
62(9):
2488 - 2492.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Shih, F. B. Davis, H.-Y. Lin, and P. J. Davis
Resveratrol Induces Apoptosis in Thyroid Cancer Cell Lines via a MAPK- and p53-Dependent Mechanism
J. Clin. Endocrinol. Metab.,
March 1, 2002;
87(3):
1223 - 1232.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. J. Baek, L. C. Wilson, and T. E. Eling
Resveratrol enhances the expression of non-steroidal anti-inflammatory drug-activated gene (NAG-1) by increasing the expression of p53
Carcinogenesis,
March 1, 2002;
23(3):
425 - 432.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. K. Joe, H. Liu, M. Suzui, M. E. Vural, D. Xiao, and I. B. Weinstein
Resveratrol Induces Growth Inhibition, S-phase Arrest, Apoptosis, and Changes in Biomarker Expression in Several Human Cancer Cell Lines
Clin. Cancer Res.,
March 1, 2002;
8(3):
893 - 903.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. P. Simopoulos
The Mediterranean Diets: What Is So Special about the Diet of Greece? The Scientific Evidence
J. Nutr.,
November 1, 2001;
131(11):
3065S - 3073.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-W. Park, Y.-J. Choi, S.-I. Suh, W.-K. Baek, M.-H. Suh, I.-N. Jin, D. S. Min, J.-H. Woo, J.-S. Chang, A. Passaniti, et al.
Bcl-2 overexpression attenuates resveratrol-induced apoptosis in U937 cells by inhibition of caspase-3 activity
Carcinogenesis,
October 1, 2001;
22(10):
1633 - 1639.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Gusman, H. Malonne, and G. Atassi
A reappraisal of the potential chemopreventive and chemotherapeutic properties of resveratrol
Carcinogenesis,
August 1, 2001;
22(8):
1111 - 1117.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. P. L. Bhat and J. M. Pezzuto
Resveratrol Exhibits Cytostatic and Antiestrogenic Properties with Human Endometrial Adenocarcinoma (Ishikawa) Cells
Cancer Res.,
August 1, 2001;
61(16):
6137 - 6144.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Wolter, B. Akoglu, A. Clausnitzer, and J. Stein
Downregulation of the Cyclin D1/Cdk4 Complex Occurs during Resveratrol-Induced Cell Cycle Arrest in Colon Cancer Cell Lines
J. Nutr.,
August 1, 2001;
131(8):
2197 - 2203.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Dorrie, H. Gerauer, Y. Wachter, and S. J. Zunino
Resveratrol Induces Extensive Apoptosis by Depolarizing Mitochondrial Membranes and Activating Caspase-9 in Acute Lymphoblastic Leukemia Cells
Cancer Res.,
June 1, 2001;
61(12):
4731 - 4739.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Kimura and H. Okuda
Resveratrol Isolated from Polygonum cuspidatum Root Prevents Tumor Growth and Metastasis to Lung and Tumor-Induced Neovascularization in Lewis Lung Carcinoma-Bearing Mice
J. Nutr.,
June 1, 2001;
131(6):
1844 - 1849.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
N. Ahmad, V. M. Adhami, F. Afaq, D. K. Feyes, and H. Mukhtar
Resveratrol Causes WAF-1/p21-mediated G1-phase Arrest of Cell Cycle and Induction of Apoptosis in Human Epidermoid Carcinoma A431 Cells
Clin. Cancer Res.,
May 1, 2001;
7(5):
1466 - 1473.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
L. Tessitore, A. Davit, I. Sarotto, and G. Caderni
Resveratrol depresses the growth of colorectal aberrant crypt foci by affecting bax and p21CIP expression
Carcinogenesis,
August 1, 2000;
21(8):
1619 - 1622.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. K. Manna, A. Mukhopadhyay, and B. B. Aggarwal
Resveratrol Suppresses TNF-Induced Activation of Nuclear Transcription Factors NF-{kappa}B, Activator Protein-1, and Apoptosis: Potential Role of Reactive Oxygen Intermediates and Lipid Peroxidation
J. Immunol.,
June 15, 2000;
164(12):
6509 - 6519.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. L. Hirpara, M. A. Seyed, K. W. Loh, H. Dong, R. M. Kini, and S. Pervaiz
Induction of mitochondrial permeability transition and cytochrome C release in the absence of caspase activation is insufficient for effective apoptosis in human leukemia cells
Blood,
March 1, 2000;
95(5):
1773 - 1780.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H.-F. Li, S.-A. Chen, and S.-N. Wu
Evidence for the stimulatory effect of resveratrol on Ca2+-activated K+ current in vascular endothelial cells
Cardiovasc Res,
March 1, 2000;
45(4):
1035 - 1045.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. Holian, S. Wahid, M. J. Atten, and B. M. Attar
Inhibition of gastric cancer cell proliferation by resveratrol: role of nitric oxide
Am J Physiol Gastrointest Liver Physiol,
May 1, 2002;
282(5):
G809 - G816.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|