Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zivelin, A.
Right arrow Articles by Seligsohn, U.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zivelin, A.
Right arrow Articles by Seligsohn, U.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, Vol. 92 No. 4 (August 15), 1998: pp. 1119-1124

RAPID COMMUNICATION

A Single Genetic Origin for the Common Prothrombotic G20210A Polymorphism in the Prothrombin Gene

By Ariella Zivelin, Nurit Rosenberg, Shlomit Faier, Nurit Kornbrot, Hava Peretz, Christine Mannhalter, Marie Helene Horellou, and Uri Seligsohn

From the Institute of Thrombosis and Hemostasis, Department of Hematology, Sheba Medical Center, Tel Aviv University, Tel Aviv, Israel; the Department of Laboratory Medicine, University of Vienna, Vienna, Austria; and The Central Laboratory of Hematology, Hotel-Dieu Hospital, Paris, France.


    ABSTRACT
Abstract
Introduction
Methods
References

The polymorphism G20210A in the 3' untranslated region of the prothrombin gene is associated with an increased level of factor II activity and confers a twofold to fivefold increase in the risk for venous thromboembolism. Among Caucasian populations, the prevalence of factor II G20210A heterozygotes is 1% to 6%, whereas in non-Caucasian populations it is very rare or absent. The aim of the present study was to discern whether factor II G20210A originated from a single or recurrent mutational events. Allele frequencies of four dimorphisms spanning 16 of 21 kb of the factor II gene were determined in 133 unrelated Caucasian subjects of Jewish, Austrian, and French origins who bore factor II G20210A (10 homozygotes and 123 heterozygotes) and 110 Caucasian controls. Remarkable differences in the allele frequencies for each dimorphism were observed between the study groups (P = .0007 or less), indicating strong linkage disequilibrium and suggesting a founder effect. Indeed, a founder haplotype was present in 68% of 20210A mutant alleles and only in 34% of 20210G normal alleles (P < .0001). These data strongly support a single origin for factor II G20210A that probably occurred after the divergence of Africans from non-Africans and of Caucasoid from Mongoloid subpopulations.

© 1998 by The American Society of Hematology.

    INTRODUCTION
Abstract
Introduction
Methods
References

IN RECENT YEARS, there has been a growing interest in finding genetic polymorphisms that are associated with an increased risk of venous thromboembolism (VTE). Resistance to activated protein C (APC) caused predominantly by a substitution of G by A at nt 1691 of the factor V gene is currently the most commonly observed prothrombotic polymorphis.1-4 It is found in patients with idiopathic VTE at a frequency of 20% to 60%, depending on the mode of their selection.5-7 In Caucasians, the allele frequency of factor V G1691A varies from 1% to 8%,8-10 whereas among Africans, Chinese, Japanese, and native North and South Americans, this polymorphism is absent.8 We recently showed that factor V G1691A originated from a single mutational event that took place about 21,000 to 34,000 years ago after the evolutionary divergence of non-Africans from Africans and of Caucasians from Mongoloids.9

Another prothrombotic polymorphism in the factor II (prothrombin) gene was recently shown to be associated with an increased risk of VTE.11 This polymorphism, a G to A nucleotide transition at nt 20210 in the 3' untranslated region of the factor II gene, is located at or near the cleavage site of the mRNA precursor to which poly A is added.12 The factor II gene is localized on chromosome 11 near the centromere,13 spans approximately 21,000 bp, and is composed of 14 exons and 13 introns.12 Patients bearing the factor II G20210A polymorphism have an increased plasma factor II level for which no explanation has so far been provided.

Four independent studies from The Netherlands, England, and Sweden showed that the factor II polymorphism was associated with a twofold to fivefold increase in risk of VTE.11,14-16 These studies included a total number of 1,293 unselected patients with idiopathic VTE, of whom 73 (5.6%; range, 5.0% to 7.1%) were heterozygotes for the factor II 20210A allele. In contrast, only 31 (1.8%) of 1,428 matched controls (range, 1.2% to 2.6%) were heterozygous for the polymorphism, predicting an allele frequency of 0.009 in North and Western European populations. Additional data recently compiled by Rosendaal et al17 disclosed that the prevalence of carriers of factor II G20210A in healthy Northern Europeans was similar, ie, 1.7%, whereas in Southern Europeans the prevalence was nearly twice (3%).17

In contrast to these figures, factor II G20210A was found in only 1 of 441 African Americans18 and was absent among 231 Amerindians from Brazil19,20 and 210 Japanese subjects.19,21 Taken together, these data suggest that, similarly to factor V G1691A, factor II G20210A is confined to Caucasian populations.

In this study, we addressed the question of whether factor II G20210A occurred in a single founder or resulted from recurrent mutational events.

    MATERIALS AND METHODS
Abstract
Introduction
Methods
References

Study groups and collection of samples.   To determine the prevalence of the polymorphism in different Jewish ethnic groups, subjects with no history of venous thrombosis were recruited from consecutive admissions to the hospital, outpatient clinics, hospital personnel, and army personnel. The ethnic origin was determined by the country of origin of the 4 grandparents of the subjects. DNA samples that turned out to be homozygous normal (G20210) served as controls for analysis of polymorphisms and haplotypes (see below). To define the origin of factor II G20210A, we analyzed DNA samples of previously diagnosed homozygotes from Israel, Austria, and France and heterozygotes of Jewish origin. The collection of the samples was approved by the Human Subject Ethics Committee of the Sheba Medical Center.

Detection of factor II gene 20210A allele.   Factor II G20210A was detected by a slight modification of the originally described method.11 The 345-bp DNA fragment amplified by polymerase chain reaction (PCR) was simultaneously digested by HindIII for detection of the polymorphism and by Msp I (5 U/15 µL reaction) for detection of a constant 141-bp fragment indicating that digestion took place (Fig 1).


View larger version (59K):
[in this window]
[in a new window]
 
Fig 1. Detection of factor II G20210A polymorphism: homozygote AA, heterozygote GA, and homozygous normal GG. Note the constant fragment obtained by Msp I digestion. The marker (M), an Alu-digested pBR322, was used as a molecular weight standard. Numbers on the right of the gel indicate the size (in basepairs) of the bands.

Analysis of intragenic polymorphic markers in the factor II gene.   Four additional diallelic polymorphisms in the factor II gene were analyzed. The first was a new unpublished polymorphic marker in intron D characterized by direct sequencing with SequiTherm Excell DNA sequencing kit (Epicentre Technologies, Madison, WI). The second was a previously described polymorphism in intron E.22 The third and fourth were new unpublished polymorphisms in exon 10 and intron M, respectively. They were characterized by us after noting variations in the described sequence of the factor II gene.23,24 All 4 polymorphisms were detected by PCR amplification and allele-specific restriction analyses (Fig 2). The site of the polymorphisms, the size of the PCR products, the restriction enzymes used, and forward (F) and reverse (R) primers were as follows: (1) intron D-nt T3728C, 480 bp, Nde I, F5'TCTGCCTGGCCTAGTGGGATGCATGG3 and R5'TACCCAGACCCTCAGCACAGTTACC3'; (2) intron E-nt C4125G, 418 bp, Mbo II, F5'AATAAGTCCCCAGGCTCCAA3' and R5'TGGTCATGGGTCGCCCCACT3'; (3) Exon 10-nt G8845A, 86 bp, Aci I, F5'ACCGCCGCCCACTGCCTCCTGTAC3' and R5'CGGGAGTGCTTGCCAATGCGCACC3'; and (4) intron M-nt G19911A, 271 bp, Mnl I, F5'ATGCCTGTGAAGGTGACAGTGGG3' and R5'GTAGAAGCCATATTTCCCATCCCG3'. The PCR products were generated in 20 µL reaction mixtures that contained 100 to 200 ng of genomic DNA, 250 nmol/L of each primer, 200 mmol/L of each dNTP, 0.125 U of Taq polymerase (Super Nova; Laboratory Products Int, Kent, UK), 1.5 mmol/L MgCl2, and 1× PCR buffer. The reactions were subjected to 30 cycles of 45 seconds of denaturation at 94°C, 45 seconds of annealing at 65°C, and 45 seconds of extension at 72°C. The PCR products (10 µL) were directly subjected for digestion with 5 U of restriction enzymes (New England Biolabs, Beverly, MA) according to the manufacturer's instructions. The digested PCR products were analyzed on 4% Metaphor agarose (FMC Bioproducts, Rockland, ME) for exon 10 and intron M and on 3% agarose for introns D and E. 


View larger version (55K):
[in this window]
[in a new window]
 
Fig 2. Allele-specific restriction analysis of four dimorpohic markers in the factor II gene. The 3 possible genotypes for each polymorphism are illustrated. The size (in basepairs) of the bands is depicted.

To analyze the linkage between intron M polymorphism at nt 19911 and the prothrombotic polymorphism at nt 20210, a 345-bp PCR product containing both sites was amplified as described by Poort et al.11 This amplified segment was simultaneously digested by HindIII to determine the G20210A transition and by EcoNI (5 U/10 µL reaction) to determine the G19911A substitution. When A was present at nt 20210, the amplified product was cleaved by HindIII 23 bp upstream to the 3' end, yielding a 322-bp fragment. When A was present at nt 19911, EcoNI cleaved the amplified product 19 bp downstream from its 5' end, yielding a 326-bp fragment. Simultaneous digestion by HindIII and EcoNI enabled detection of a 19911A-20210A haplotype that was represented by a 303-bp fragment (345 bp less the cleaved 23-bp and 19-bp fragments) and a 19911G-20210G haplotype that was represented by the 345-bp fragment resistant to both HindIII and EcoNI (Fig 3A).


View larger version (43K):
[in this window]
[in a new window]
 
Fig 3. Determination of the linkage between nt 19911 and nt 20210 by simultaneous HindIII and EcoNI digestion of a 345-bp amplified fragment spanning both sites. (A) Schematic illustration of 4 possible alleles and specific fragment sizes in basepairs after cleavage at the indicated sites (X). (B) Electrophoretic separation of the following observed genotypes: 3 normal homozygotes for 20210G (lanes 1 through 3) who were GG, GA, and AA for the 19911 polymorphism, respectively; 2 homozygotes for 20210A (lanes 4 and 5) who were AA and AG for the 19911 polymorphism, respectively; and 2 heterozygotes for G20210A who were AA (lane 6) and AG (lane 7) for the 19911 polymorphism. The additional band in lane 7 between the 345- and 303-bp bands represents a heteroduplex (H.D). This was proved by the following two mixing experiments. (1) When 345-bp PCR fragments from a homozygote for 20210G and 19911G and a homozygote for 20210A and 19911A were mixed and digested with HindIII and EcoNI, an uncut 345-bp fragment and a 303-bp fragment were obtained (lane 8). (2) When DNA samples from the same 2 individuals were mixed and then amplified by PCR, followed by digestion and electrophoresis, a pattern representing heteroduplex bands was obtained (lane 9) that is identical to the one shown in lane 7. Numbers alongside the gel indicate the size (in basepairs) of the bands.

Search for new polymorphic markers in the promotor region of the factor II gene.   DNA amplification of nucleotides -1074 to -35425 of the promotor was performed with the primers F5'AGAAATGGGCCTCCCAGGAATTAAGG3' and R5'GTTGTGAGGACTAAAGGAGATTAGG3' under the same conditions for PCR as described above, except for 60 seconds of extension. Three restriction enzymes were chosen for cleavage of the amplified 721-bp segment to smaller fragments suitable for single-stranded conformation polymorphism (SSCP) analysis. The enzymes used and sizes of the obtained fragments in basepairs were: (1) Rsa I, 206 and 515; (2) Mbo II, 395 and 326; and (3) Pvu II, 432 and 289. SSCP was performed as described26 and the radiolabeled PCR fragments were analyzed on MDE gels (FMC Bioproducts) prepared according to the manufacturer's instructions, with and without 10% glycerol.

PCR fragments of the promotor region from a 20210A homozygote and a 20210G normal homozygote were cloned into a TA cloning kit (Invitrogen, San Diego, CA) by the procedure recommended by the manufacturer. DNA was purified with Wizard Plus Miniprep DNA purification kit (Promega, Madison, WI) and sequenced by the core facilities of the Weizmann Institute (Rehovot, Israel).

    RESULTS AND DISCUSSION

Prevalence of factor II G20210A polymorphism in Jewish ethnic groups.   A total of 1,670 Jewish subjects belonging to different ethnic groups were examined for the prevalence of FII G20210A polymorphism. As shown in Table 1 the prevalence of heterozygotes for the prothrombotic factor II polymorphism was 6.7% in Ashkenazi (European) Jews and 5.5% in Sephardic Jews from North Africa. This is the highest prevalence so far observed among studied populations that may have stemmed from genetic drift due to isolation, periods of extinction, and times of extensive expansions of Ashkenazi and Sephardic Jews. In Middle Eastern Jews originating in Iraq, Iran, and Yemen, prevalences of 1% to 4% were observed, resembling the prevalences reported in European populations.17 Interestingly, in Ethiopian Jews, who share African genes, none of 177 subjects examined (354 alleles) bore the 20210A genotype.

 
View this table:
[in this window] [in a new window]
 
Table 1. Prevalence of Factor II G20210A Polymorphism in Jewish Ethnic Groups in Israel

Frequency of polymorphic markers in the factor II gene in controls.   Table 2 and Fig 2 illustrate the identification of the 3 new polymorphic markers and of a previously published marker in intron E.21 All four diallelic markers are located 5' to nucleotide 20210 and cover 16 of 21 kb of the factor II gene. All polymorphisms are probably silent changes, because three of them are located in introns D, E, and M, respectively, and one is a change of codon 368 from CCG to CCA, both encoding for Proline.

 
View this table:
[in this window] [in a new window]
 
Table 2. Allele Frequencies of 4 Dimorphic Markers of the Factor II Gene in Normals and Subjects Bearing G20210A

The frequencies of the more common alleles for the 4 markers ranged from 0.55 to 0.84 among 220 alleles of 110 normal controls (Table 2). This frequency distribution was considered adequate for linkage analysis. Interestingly, the frequency of 0.65 and 0.35 for the two complementary alleles in intron E was similar to the frequency observed in Japanese subjects.22

Determination of a founder effect.   Table 2 compares the allele frequencies for the 4 intragenic markers in 110 normal homozygotes (20210G) that represent the different Jewish ethnic distribution in Israel, 123 unrelated heterozygotes (A20210G) from different Jewish ethnic groups, and 10 unrelated homozygotes (20210A), 6 from Israel and 4 non-Jewish subjects (2 from Austria and 2 from France). In homozygotes for the 20210A genotype, the frequency of one of the alleles for each marker was 0.95 to 1.00, whereas in normal homozygotes (20210G), the frequency was only 0.45 to 0.84 (see underlined alleles in Table 2). It was remarkable to note that in heterozygotes bearing one 20210A allele, the frequency of the depicted polymorphic alleles was very high (0.77 to 0.96). The differences in allele frequencies for each marker between 110 normals and 133 subjects bearing 20210A (123 heterozygotes and 10 homozygotes) were highly significant (P = .0007 or less). This degree of linkage disequilibrium strongly suggested that the prothrombotic polymorphism occurred only once on the haplotype 3728T-4125C-8845G-19911A.

We then calculated the frequency of the founder haplotype in normal alleles and in alleles bearing the factor II G20210A polymorphism. Because we were unable to amplify the marker in intron D in DNA samples from 2 20210A homozygotes, only 16 alleles of the homozygotes were analyzed. As can be seen in Table 3, only 28% of 220 alleles derived from normals bore the founder haplotype, which was in striking contrast to 64% of 123 20210A alleles derived from heterozygotes and 94% of 16 alleles of homozygotes (P < .0001). Similarly, the founder haplotype was present in 34% of the combined 343 20210G alleles (of normals and heterozygotes) and in 68% of the combined 139 20210A alleles (of heterozygotes and homozygotes). However, the linkage between the prothrombotic polymorphism and the other polymorphisms could not be established in 46% of the alleles in normals and in 36% of the alleles in heterozygotes. Similar values of undefinable alleles were observed among 20210G alleles derived from normals and heterozygotes (43%) and 20210A alleles combined from heterozygotes and homozygotes (32%).

 
View this table:
[in this window] [in a new window]
 
Table 3. Frequency of the Founder Haplotype (TCGA) in Normal 20210G and Polymorphic 20210A Alleles

To increase the number of definable alleles, we took advantage of the proximity of the dimorphic marker at nt 19911 and the prothrombotic polymorphism at nt 20210. A 345-bp PCR-amplified product containing both polymorphic sites and specific restriction analysis with HindIII and EcoNI enabled us to phase the linkage of these two sites in all alleles examined (Fig 3). Full linkage of 19911A and 20210A was observed in all 123 heterozygotes (A20210G). Similarly, with the exception of one allele that probably represents a recombination event (see below), 19 of 20 alleles of 20210A homozygotes had nt A at position 19911. Thus, of 143 alleles (123 + 20) bearing the prothrombotic polymorphism, 142 (>99%) shared the same marker in intron M, in contrast to its frequency of 0.45 in normals (Table 2).

Detection of a recombination in a homozygote for 20210A.   In one 20210A homozygous Jewish proband, the genotype was 3728T-G4125C-8845G-G19911A, which was different from the founder haplotype at nts 4125 and 19911. Direct sequencing of nts 4125, 19911, and 20210 confirmed the results of the restriction analysis (data not shown). Based on the analysis of the subject's sister, who was a G20210A heterozygote and was homozygous for 4125C and 19911A, we concluded that one of the proband's alleles bore the founder haplotype, ie, 3728T-4125C-8845G-19911A, and that the second allele was different in intron E and intron M, ie, 3728T-4125G-8845G-19911G. Because one of the proband's alleles differed twice from the expected sequence, it seems reasonable to assume that it stemmed from a recombination event. Conceivably, this recombination event, found in only 1 of 143 alleles bearing 20210A, is evolutionary young and has not had a chance to disseminate even in closely related Jewish populations.

Search for polymorphism in the promotor region of the factor II gene.   Because the mechanism by which the change in nt 20210 at the 3' untranslated region of the factor II gene is associated with an elevated plasma level of factor II is dubious, a search for a linked sequence variation in the promotor region seemed warranted.

Poort et al11 found no sequence variations in approximately 400 bp upstream of the prothrombin gene transcription site in 28 homozygous normals (20210G) and 5 heterozygotes (G20210A). We extended the search for a possible alteration in sequence to nucleotides -350 to -1050 of the promotor region that contains regulatory elements.25 DNA samples from 8 normal homozygotes for 20210G and 2 homozygotes for 20210A were amplified by PCR and the 721-bp fragments were subjected to digestion by 3 restriction enzymes (Rsa I, Mbo II, and Pvu II), as described. SSCP analysis of the cleaved fragments showed no aberrant bands suggestive for polymorphisms (data not shown). The 721-bp fragments obtained from one homozygote (20210A) and one normal homozygote (20210G) were cloned into a TA vector and sequenced. Only one sequence variation, insertion of G at position -646, was found in both subjects. Thus, our data and the data of Poort et al11 failed to show a change in the -1,050-bp region of the promotor that might be linked with 20210A.

Similarly to factor V G1691A, our findings are consistent with a common Caucasian founder for the factor II G20210A prothrombotic polymorphism. However, unlike factor V G1691A, for which APC resistance is the assigned mechanism for VTE, the mechanisms by which factor II G20210A is associated with an elevated plasma factor II and by which it confers an increased risk of VTE remain to be elucidated.

    FOOTNOTES

   Submitted February 26, 1998; accepted May 27, 1998.
   Address reprint requests to Uri Seligsohn, MD, Institute of Thrombosis and Hemostasis, Department of Hematology, Sheba Medical Center, Tel Hashomer 52621, Israel; e-mail: zeligson{at}post.tau.ac.il.
   The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.

    REFERENCES
Abstract
Introduction
Methods
References

1. Dahlback B, Carlsson M, Svensson PJ: Familial thrombophilia due to a previously unrecognized mechanism characterized by poor anticoagulant response to activated protein C: Prediction of a cofactor to activated protein C. Proc Natl Acad Sci USA 90:1004, 1993[Abstract/Free Full Text]

2. Bertina RM, Koeleman BPC, Koster T, Rosendaal FR, Dirven RJ, de Ronde H, van der Velden PA, Reitsma PH: Mutation in blood coagulation factor V associated with resistance to activated protein C. Nature 369:64, 1994[Medline] [Order article via Infotrieve]

3. Greengard JS, Sun X, Xu X, Fernandes JA, Griffin JH, Evatt B: Activated protein resistance caused by Arg506Gln mutation in factor Va. Lancet 343:1361, 1994[Medline] [Order article via Infotrieve]

4. Voorberg J, Roelse J, Koopman R, Buller H, Berends F, ten Cate JW, Mertens K, van Mourik JA: Association of idiopathic venous thromboembolism with single point mutation at Arg506 factor V. Lancet 343:1535, 1994[Medline] [Order article via Infotrieve]

5. Griffin JH, Evatt B, Wideman C, Fernandes JA: Anticoagulant protein C pathway defective in majority of thrombophilic patients. Blood 82:1989, 1993[Abstract/Free Full Text]

6. Svensson PJ, Dahlback B: Resistance to activated protein C as a basis for venous thrombosis. N Engl J Med 330:517, 1994[Abstract/Free Full Text]

7. Koster T, Rosendaal FR, deRonde H, Briet E, Vandenbroucke JP, Bertina RM: Venous thrombosis due to poor anticoagulant response to activated protein C: Leiden thrombophilia study. Lancet 342:1503, 1993[Medline] [Order article via Infotrieve]

8. Rees DC, Cox M, Clegg JB: World distribution of factor V Leiden. Lancet 346:1133, 1995[Medline] [Order article via Infotrieve]

9. Zivelin A, Griffin JH, Xiao X, Pabinger I, Samama M, Conard J, Brenner B, Eldor A, Seligsohn U: A single genetic origin for a common Caucasian risk factor for venous thrombosis. Blood 89:397, 1997[Abstract/Free Full Text]

10. Seligsohn U, Zivelin A: Thrombophilia as a multigenic disorder. Thromb Haemost 78:297, 1997[Medline] [Order article via Infotrieve]

11. Poort SR, Rosendaal FR, Reitsma PH, Bertina RM: A common genetic variation in the 3'-untranslated region of the prothrombin gene is associated with elevated plasma prothrombin levels and an increase in venous thrombosis. Blood 88:3696, 1996

12. Degen SJF, Davie EW: Nucleotide sequence of the gene for human prothrombin. Biochemistry 26:6165, 1987[Medline] [Order article via Infotrieve]

13. Royle NJ, Irwin DM, Koschinsky ML, MacGillivray RTA, Hamerton JL: Human genes encoding prothrombin and ceruloplasmin map to 11p11-q12 and 3q21-24, respectively. Somat Cell Mol Genet 13:285, 1987[Medline] [Order article via Infotrieve]

14. Brown K, Luddington R, Williamson D, Baker P, Baglin T: Risk of venous thromboembolism associated with a G to A transition at position 20210 in the 3'-untranslated region of the prothrombin gene. Br J Haematol 98:907, 1997[Medline] [Order article via Infotrieve]

15. Cumming AM, Keeney S, Salden A, Bhavnani M, Shwe KH, Hay CRM: The prothrombin gene G20210A variant: Prevalence in a U.K anticoagulant clinic population. Br J Haematol 98:353, 1997[Medline] [Order article via Infotrieve]

16. Hillarp A, Zoller B, Svensson PJ, Dahlback B: The 20210 A allele of the prothrombin gene is a common risk factor among Swedish outpatients with verified deep vein thrombosis. Thromb Haemost 78:990, 1997[Medline] [Order article via Infotrieve]

17. Rosendaal FR, Doggen CJM, Zivelin A, Arruda VR, Aiach M, Siscovick DS, Hillarp A, Watzke HH, Bernardi F, Cumming AM, Preston FE, Reitsma PH: Geographic distribution of the 20210 G to A prothrombin variant. Thromb Haemost 79:700, 1998

18. (abstr, suppl 1) Dilley A, Hooper WC, Austin H, Lally C, Wenger NK, Evatt BL: The prevalence of the prothrombin 20210 G right-arrow A variant in African Americans. Blood 90:652a, 1997

19. (abstr, suppl 1) Franco RF, Elion J, Tavella MH, Araujo AG, Zago MA: Heterogeneous distribution of the 20210 Gright-arrow A prothrombin and 677 C right-arrowT methylenetetrahydrofolate reductase mutations in different human populations: Relevance for vascular disease risk. Blood 90:3130a, 1997

20. (abstr, suppl 1) Arruda VR, Siqueira LH, Chiaparini LC, Coelho OR, Mansur AP, Ramires A, Costa FF, Annichino-Bizzacchi JM: Prevalence of the prothrombin gene variant 20210 G right-arrow A among patients with venous thrombosis and arterial disease. Blood 90:651a, 1997

21. Isshiki I, Murata M, Watanabe R, Matsubara Y, Kawano K, Aoki N, Yoshino H, Ishikawa K, Watanabe G, Ikeda Y: Frequencies of prothrombin 20210 G right-arrow A mutation may be different among races-studies on Japanese populations with various forms of thrombotic disorders and healthy subjects. Blood Coagul Fibrinol 9:105, 1998[Medline] [Order article via Infotrieve]

22. Iwahana H, Yoshimoto K, Itakura M: Highly polymorphic region of the human prothrombin (F2) gene. Hum Genet 89:123, 1992[Medline] [Order article via Infotrieve]

23. O'Marcaigh, Nichols WL, Hassinger NL, Mullins JD, Mallouh AA, Gilchrist GS, Owen WG: Genetic analysis and functional characterization of prothrombin Corpus Christi (Arg382-Cys), Dhahran (Arg271-His), and hypoprothrombinemia. Blood 88:2611, 1996[Abstract/Free Full Text]

24. Miyata T, Zheng YZ, Kato A, Kato H: A point mutation (Arg271-Cys) of a homozygote for dysfunctional prothrombin, prothrombin Obihiro, which has a region of high sequence variability. Br J Haematol 90:688, 1995[Medline] [Order article via Infotrieve]

25. Bancroft JD, Schaefer LA, Degen SJD: Characterization of the Alu-rich 5'-flanking region of the human prothrombin-encoding gene: Identification of a positive cis-acting element that regulates liver-specific expression. Gene 95:253, 1990[Medline] [Order article via Infotrieve]

26. Orita M, Suzuki Y, Sekiya T, Hayashi K: Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics 5:874, 1989[Medline] [Order article via Infotrieve]


© 1998 by the American Society of Hematology.
 
0006-4971/98/92-0037$3.00/0

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J Am Board Fam MedHome page
J. L. Ferguson and D. R. Hennion
Portal Vein Thrombosis: An Unexpected Finding in a 28-Year-Old Male With Abdominal Pain
J Am Board Fam Med, May 1, 2008; 21(3): 237 - 243.
[Abstract] [Full Text] [PDF]


Home page
CLIN APPL THROMB HEMOSTHome page
S. Kabukcu, N. Keskin, A. Keskin, and E. Atalay
The Frequency of Factor V Leiden and Concomitance of Factor V Leiden With Prothrombin G20210A Mutation and Methylene Tetrahydrofolate Reductase C677T Gene Mutation in Healthy Population of Denizli, Aegean Region of Turkey
Clinical and Applied Thrombosis/Hemostasis, April 1, 2007; 13(2): 166 - 171.
[Abstract] [PDF]


Home page
J. Mol. Diagn.Home page
D. Bosler, J. Mattson, and D. Crisan
Phenotypic Heterogeneity in Patients with Homozygous Prothrombin 20210AA Genotype: A Paper from the 2005 William Beaumont Hospital Symposium on Molecular Pathology
J. Mol. Diagn., September 1, 2006; 8(4): 420 - 425.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. Zivelin, R. Mor-Cohen, V. Kovalsky, N. Kornbrot, J. Conard, F. Peyvandi, P. A. Kyrle, R. Bertina, F. Peyvandi, J. Emmerich, et al.
Prothrombin 20210G>A is an ancestral prothrombotic mutation that occurred in whites approximately 24 000 years ago
Blood, June 15, 2006; 107(12): 4666 - 4668.
[Abstract] [Full Text] [PDF]


Home page
ASH ANNUAL MEETING ABSTRACTSHome page
A. Zivelin, R. Mor-Cohen, V. Kovalsky, J. Conard, F. Peyvandi, I. Pabinger, R. Bertina, F. Peyvandi, J. Emmerich, and U. Seligsohn
The Prothrombotic Polymorphism Prothrombin G20210A Is an Ancestral Mutation That Arose in Caucasians Approximately 20,000 Years Ago.
Blood (ASH Annual Meeting Abstracts), November 16, 2005; 106(11): 729 - 729.
[Abstract]


Home page
Arch Intern MedHome page
G. Kovalevsky, C. R. Gracia, J. A. Berlin, M. D. Sammel, and K. T. Barnhart
Evaluation of the Association Between Hereditary Thrombophilias and Recurrent Pregnancy Loss: A Meta-analysis
Arch Intern Med, March 8, 2004; 164(5): 558 - 563.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
N. von Ahsen and M. Oellerich
The intronic prothrombin 19911A>G polymorphism influences splicing efficiency and modulates effects of the 20210G>A polymorphism on mRNA amount and expression in a stable reporter gene assay system
Blood, January 15, 2004; 103(2): 586 - 593.
[Abstract] [Full Text] [PDF]


Home page
SEMIN CARDIOTHORAC VASC ANESTHHome page
R. D. McBane II
Genetically Determined Procoagulant States and Heparin Use
Seminars in Cardiothoracic and Vascular Anesthesia, December 1, 2003; 7(4): 427 - 442.
[Abstract] [PDF]


Home page
JCOHome page
C. Duggan, K. Marriott, R. Edwards, and J. Cuzick
Inherited and Acquired Risk Factors for Venous Thromboembolic Disease Among Women Taking Tamoxifen to Prevent Breast Cancer
J. Clin. Oncol., October 1, 2003; 21(19): 3588 - 3593.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
U. Seligsohn and A. Lubetsky
Genetic Susceptibility to Venous Thrombosis
N. Engl. J. Med., April 19, 2001; 344(16): 1222 - 1231.
[Full Text] [PDF]


Home page
BloodHome page
J. M. Soria, L. Almasy, J. C. Souto, I. Tirado, M. Borell, J. Mateo, S. Slifer, W. Stone, J. Blangero, and J. Fontcuberta
Linkage analysis demonstrates that the prothrombin G20210A mutation jointly influences plasma prothrombin levels and risk of thrombosis
Blood, May 1, 2000; 95(9): 2780 - 2785.
[Abstract] [Full Text] [PDF]


Home page
CLIN APPL THROMB HEMOSTHome page
A. Nguyen
State-of-the-Art Review : Review and Management of Patients With the Prothrombin G20210A Polymorphism
Clinical and Applied Thrombosis/Hemostasis, April 1, 2000; 6(2): 94 - 99.
[Abstract] [PDF]


Home page
BloodHome page
D. A. Lane and P. J. Grant
Role of hemostatic gene polymorphisms in venous and arterial thrombotic disease
Blood, March 1, 2000; 95(5): 1517 - 1532.
[Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
O. Salomon, D. M. Steinberg, A. Zivelin, S. Gitel, R. Dardik, N. Rosenberg, S. Berliner, A. Inbal, A. Many, A. Lubetsky, et al.
Single and Combined Prothrombotic Factors in Patients With Idiopathic Venous Thromboembolism : Prevalence and Risk Assessment
Arterioscler. Thromb. Vasc. Biol., March 1, 1999; 19(3): 511 - 518.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow