|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 92 No. 4 (August 15), 1998:
pp. 1259-1267
Thrombin-Activated Human Endothelial Cells Support Monocyte
Adhesion In Vitro Following Expression of Intercellular Adhesion
Molecule-1 (ICAM-1; CD54) and Vascular Cell Adhesion Molecule-1
(VCAM-1; CD106)
By
Gilles Kaplanski,
Valérie Marin,
Martine Fabrigoule,
Vera Boulay,
Anne-Marie Benoliel,
Pierre Bongrand,
Solange Kaplanski, and
Catherine Farnarier
From the Laboratoire d'Immunologie-INSERM U387, Hôpital
Sainte-Marguerite, Marseille, France.
 |
ABSTRACT |
Thrombin, a central molecule in coagulation, is also involved in
inflammation. Notably, thrombin induces endothelial neutrophil adhesion, P- and E-selectin expression, and chemokine production. We
show here that thrombin induces expression of intercellular adhesion
molecule-1 (ICAM-1; CD54) and vascular cell adhesion molecule-1
(VCAM-1; CD106) on human umbilical vein endothelial cells (HUVECs)
associated with increased adhesion of monocytes. Thrombin increased
mRNA steady-state levels and expression of ICAM-1 over 24 hours.
Thrombin-induced VCAM-1 expression exhibited unusual kinetics, reaching
maximum levels after 6 to 12 hours, but decreasing to near baseline
after 24 hours. Thrombin activity on HUVECs was mediated through
interaction with its specific receptor, because ICAM-1 and VCAM-1
expression were similarly induced by the 14-amino acid thrombin
receptor-activating peptide. Thrombin-induced ICAM-1 and VCAM-1
expression was significantly inhibited by hirudin, but not by
interleukin-1 receptor antagonist or anti-tumor necrosis factor 
monoclonal antibody (MoAb). Thrombin-activated HUVECs significantly
increased greater numbers of adhering THP-1 macrophagic cells,
peripheral blood mononuclear cells, or purified monocytes than
unstimulated HUVECs. This adhesion was inhibited by anti-CD18 and
anti-CD49d MoAb, demonstrating that thrombin-induced ICAM-1 and VCAM-1
were functional. These results show that, in addition to selectins,
thrombin directly induces a cytokine-independent expression of adhesion
molecules of the Ig superfamily on HUVECs that may support firm
leukocyte attachment during inflammation.
© 1998 by The American Society of Hematology.
| |
INTRODUCTION |
LEUKOCYTE-ENDOTHELIAL interactions play a
central role in inflammation. Adhesion is mediated by molecules
belonging to different families such as selectins, integrins, and Ig
superfamily.1,2 Polymorphonuclear cell (PMN) adhesion to
endothelial cells (ECs) is the main event in acute inflammation and
follows several steps. Selectins, namely L-selectin (CD62L) on
leukocytes, P-selectin (CD62P) on platelets and ECs, and E-selectin
(CD62E) on ECs mediate weak reversible bonds between PMN and ECs under
physiological flow conditions and are responsible for rolling, the
first step in the adhesion cascade.3,4 Rolling is followed
by PMN activation mediated by chemoattractants in the vicinity of
endothelium glycocalix.5 PMN activation increases avidity
of the  2 integrins (CD11a/CD18, LFA-1; CD11b/CD18, Mac1)
for their ligands, inducing the firm later step of PMN-endothelium
adhesion though interactions with molecules of the Ig superfamily,
intercellular adhesion molecule-1 (ICAM-1; CD54), and ICAM-2 (CD102).
ICAM-1, the counter-receptor for both CD11a/CD18 and CD11b/CD18, is a
5-Ig domain molecule expressed on various cells and constitutively
present on EC.1,6 On EC, ICAM-1 expression is highly
increased by inflammatory cytokines such as interleukin-1/
(IL-1/), tumor necrosis factor (TNF), or interferon-
(IFN-).1
The mechanisms of monocyte adhesion to ECs that characterize chronic
inflammation are less well known, but may also follow several steps.
Monocyte spontaneously adhere to ECs under static conditions.7 However, under physiological dynamic
conditions, monocytes only adhere to cytokine-stimulated
ECs.8 The first step of monocyte-endothelial adhesion
induces a rolling motion due to the interaction of L-selectin on
monocytes with its ligand on ECs.8,9 The central step of
monocyte-endothelial adhesion is mediated by the interaction of the
1 integrin VLA-4 (CD49d) on monocytes with vascular cell
adhesion molecule-1 (VCAM-1; CD106) on ECs.8 VCAM-1 is a 6- or 7-Ig domain molecule expressed on vascular and nonvascular
tissues.10 Endothelial VCAM-1 expression is controlled by
cytokines such as IL-1/, TNF, or IL-4.8,10 The
interaction of VLA-4 with VCAM-1 may induce rolling as well as firm
arrest of monocytes on IL-4-stimulated human umbilical vein ECs
(HUVECs).8,11,12 The next step of monocyte spreading is
under the dependence of the interaction of 2 integrins
with ICAM-1, whereas transendothelial migration may involve several molecules such as ICAM-1, VCAM-1, and platelet endothelial cell adhesion molecule-1 (PECAM-1).8,13
Both in vivo and vitro experiments have shown that the inflammatory and
the coagulation cascades are linked.14-17 As an example, thrombin plays a central role in coagulation and in inflammation. This
serine protease generated from prothrombin during the coagulation cascade is a potent platelet agonist and cleaves fibrinogen into fibrin, controlling the final step of clot formation.18
Thrombin also exerts various proinflammatory functions on cells through interactions with a recently recognized specific
receptor.19 Thrombin activates ECs to produce prostacyclin
(PGI2) and platelet-activating factor (PAF) and to express
P-selectin (CD62P).20-22 We have recently shown that
thrombin also activates ECs in a more delayed and sustained way through
protein synthesis, defining type II endothelial
activation.23 Through this mode of activation, thrombin
induces E-selectin (CD62E) expression as well as chemokine production
in an IL-1/- and TNF-independent way.23,24
Thrombin is important in acute inflammation, because it is chemotactic
for PMN and has been shown to favor PMN-endothelial adhesion.23,25,26 In addition, thrombin may be an important stimulus in chronic inflammation, because it is known to be chemotactic for monocytes.27 However, whether thrombin increases
monocyte adhesion to ECs is not known. In this study, we asked whether thrombin was able to induce endothelial Ig superfamily proteins ICAM-1
and VCAM-1 expression and to favor monocyte firm adhesion to ECs.
| |
MATERIALS AND METHODS |
Materials.
The following materials were purchased: M199 culture medium and fetal
calf serum (FCS; BioWhittaker, Fontenay/Bois, France); human
-thrombin (1,000 U/mg; tested negative for contamination by plasmin,
plasminogen, fibrin degradation products, human immunodeficiency virus
[HIV], and hepatitis virus), recombinant hirudin, endothelial supplement growth factor from bovine pituitary gland, and polymyxin B
sulfate (Sigma Chemical Co, Coger, Paris, France); BioMag goat antimouse IgG (BioAdvance, Emerainville, France) and sodium
51chromate (ICN Pharmaceuticals, Orsay, France; 433 mCi/µg); calcein (Molecular Probes, Eugene, OR); rabbit antihuman
TNF polyclonal antibodies (Abs) and recombinant human IL-1
(Genzyme, Le Perray en Yvelines, France); mouse antihuman CD54 and
CD106 monoclonal antibodies (MoAbs; IgG1), mouse antihuman CD2,
antihuman CD8, antihuman CD20, antihuman CD18, antihuman CD49d and
control IgG1, mouse antihuman HLA class I MoAbs, and fluorescein goat
antimouse IgG F(ab')2 (Immunotech, Marseille, France);
thrombin receptor agonist peptide (TRAP-14, 42-55) consisting of
Ser-Phe-Leu-Leu-Arg-Asn-Pro-Asn-Asp-Lys-Tyr-Glu-Pro-Phe and a control
scrambled peptide consisting of
Asn-Glu-Phe-Ser-Leu-Pro-Lys-Pro-Phe-Arg-Tyr-Leu-Asn-Asp (Neosystem
Laboratories, Strasbourg, France).23 IL-1 receptor antagonist (IL-1Ra) was a gift of Dr D.E. Tracey (Upjohn Co, Kalamazoo, MI).
Cell cultures.
HUVECs were obtained as previously described17 and used on
passage 2 or 3. Cells were grown until confluent in 25-cm2
flasks coated with 1% gelatin. The cells were then cultured in 6- or
24-well plates in M199 supplemented with endothelial growth factor and
containing 20% heat-inactivated FCS, 100 U/mL penicillin G, and 100 µg/mL streptomycin. Forty-eight hours before each experiment, endothelial growth factor was withheld and the cells were cultured in
the same medium containing 10% FCS for the first 24 hours and then 5%
FCS for the following 24 hours. Thrombin, TRAP-14, or control peptide
was then added to HUVECs for various culture times. Thrombin at the
concentration of 8 U/mL, as used in the main part of the following
experiments, was not toxic for HUVECs, as stated by the trypan blue
exclusion test, conserved expression of HLA class I antigens, and low
amount of lacticodeshydrogenases release. In some experiments, either
IL-1Ra (10 µg/mL), anti-TNF (10 µg/mL), or hirudin (40 U/mL) was
added to the culture. All experiments described in this report were
performed in the presence of polymyxin B (7 µg/mL).
Peripheral blood mononuclear cells (PBMCs) from healthy volunteers were
prepared from freshly drawn heparinized blood by Ficoll density
gradient separation. Blood monocytes were purified from PBMCs by
negative selection following a two-step procedure. First, PBMCs were
depleted of CD2 cells by rosetting with 2-aminoethylisothiouronium bromide (AET) sheep erythrocytes. The resulting cells were then incubated with anti-CD3 MoAb (15 µg/107 cells), anti-CD8
MoAb (15 µg/107 cells), and anti-CD20 MoAb (30 µg/107 cells) for 30 minutes. After washing, BioMag goat
antimouse IgG magnetic particles were added to the cell preparation for
30 minutes at 4°C, followed by cell magnetic separation, according
to the manufacturer's instructions. Contamination of the uncoated
cells by CD3, CD8, or CD20 cells was less than 2%. Monocytes were
greater than 95% pure by microscopic examination of Giemsa-stained
centrifuge preparations.
Confocal microscopy.
Unstimulated, thrombin-stimulated, or IL-1-stimulated HUVEC
monolayers on coverslips were labeled with 2 µmol/L calcein for 30 minutes at 37°C or with an anti-HLA class I MoAb (20 µg/mL) for
30 minutes, followed by fluorescein goat antimouse IgG
F(ab')2 at room temperature. After washing, coverslips
were inverted and deposited on a glass slide and then examined on a
confocal laser scanning microscope (Leica, Heidelberg, Germany)
operated under xy and xz modes to observe sections
perpendicular to the monolayers. Images were then transferred to an
IBM-compatible desk computer by real time digitization and processed,
allowing us to determine the monolayer thickness, following a
previously reported procedure.28
Fluorescence-activated cell sorter (FACS) analysis.
Unless otherwise indicated, HUVECs were stimulated with either thrombin
(8 U/mL), IL-1 (50 pg/mL), or TRAP (100 µmol/L) or control
scrambled peptide for 6, 12, or 24 hours. For surface expression of
CD54, CD106, or HLA class I antigen, HUVECs were trypsinized and
stained using the following sequence at 4°C: (1) unconjugated
anti-CD54, anti-CD106, anti-HLA-class I MoAb, or an isotype control
IgG1 (2 µg/105 cells); (2) fluorescein goat antimouse IgG
F(ab')2 fragments (1:200). Fluorescence was measured on a
FACS analyzer (XL; Coultronics, Margency, France).
RNA extraction.
Unstimulated and thrombin-activated HUVECs in 25-cm2
culture flasks were directly solubilized in RNA extraction solution
(RNA-B; BioProbe Systems, Montreuil sous Bois, France).
Total RNA was isolated using chloroform and precipitated with
isopropanol. RNA was quantified by spectrophotometry at 260 nm.
Synthesis of the cDNA.
A 25-µL reverse transcription mixture in strand buffer (25 mmol/L
Tris HCl pH 8.3, 37.5 mmol/L KCl, 1.5 mmol/L MgCl2)
contained 4 µg RNA, 0.1 µg oligo (dT)12-18 (Pharmacia LKB,
Biotechnology, France), 0.2 µmol/L dithiothreitol, 13 U RNase
inhibitor (Eurogentec, Angers, France), 400 µmol/L dNTP (BioProbe
Systems), and 100 U Moloney murine leukemia virus reverse transcriptase
(Superscript RT; GIBCO BRL, Life Technology, Eragny, France) and was
incubated at 37°C for 60 minutes.
Polymerase chain reaction (PCR).
PCR amplification of the cDNA using glyceraldehyde-3-phosphate
dehydrogenase (GAPDH) primers confirmed that equal amounts of RNA were
reverse transcribed. For each condition, 3 different cDNA
concentrations ranging from 32 to 6.4 ng RNA equivalent concentrations were amplified in 25 µL containing 250 mmol/L dNTP, 2 mmol/L
MgCl2, 0.25 U Taq polymerase (Eurogentec), and 1 µmol/L
of 5 sense and 5 antisense specific primers for ICAM-1
and VCAM-1 for 30 cycles in a modified version from.29,30
Amplification consisted of 5 minutes of denaturation at 94°C,
followed by 30 sequential cycles consisting of 1 minute at 55°C and
45 seconds at 72°C and then a final elongation cycle of 10 minutes
at 72°C in a crocodile II thermal cycler (Appligen, Illkirch,
France). Products of PCR (10 µL) were electrophoresed in a 2%
agarose gel (Nusieve, Tebu, Le Perray en Yvelines, France) and then,
after ethidium bromide coloration, were quantified using densitometry
on a gel imager EASY Herolab (Osi, Elancourt, France). As predicted,
the amplification product (amplicon) for ICAM-1 was 238 bp and for
VCAM-1 was 260 bp.
Reverse transcription-PCR (RT-PCR)-specific primers.
Specific primers were 5 TATGGCAACGACTCCTTCT 3 sense and
5 CATTCAGCGTCACCTTGG 3 antisense for ICAM-1; 5
ATGACATGCTTGAGCCAGG 3 sense and 5 GTGTCTCCTTCTTTGACACT
3 antisense for VCAM-130; and
5CCACCCATGGCAAATTCCATGGCA3 sense and
5TCTAGACCGCATCAGGTCAGGTCCACC3 antisense for GAPDH
(Genset, Paris, France).31
Adhesion assays.
THP-1 cells, PBMCs, or monocytes were labeled with 300 µL of
51Cr for 45 minutes at 37°C and then washed 3 times in
culture medium before counting. Before adhesion experiments, cells
remained either untreated or were incubated at 4°C for 1 hour in
the presence of either anti-CD18 MoAb, anti-CD49d MoAb, or control IgG1
at the concentration of 17 µg for 106 cells. After
washing, 106/mL THP-1, 106/mL PBMCs, or 5 × 105/mL purified monocytes were deposited on
unstimulated, IL-1-stimulated, or thrombin-activated
HUVECs in static conditions, under the volume of 500 µL of culture
medium containing 5% FCS, for 1 hour at 37°C. Wells were then
washed extensively to eliminate nonadherent cells, and then adherent
cells were lysed with Triton X-100, collected, and counted in a gamma
counter.
Statistical analysis.
Adhesion levels were expressed as the mean ± SEM of results
obtained from 3 to 7 experiments performed in triplicate. The data were
compared using the paired Student's t-test.
| |
RESULTS |
Thrombin induces ICAM-1 (CD54) expression on HUVECs in a dose- and
time-dependent manner: inhibition by hirudin.
HUVECs were cultured in the presence of thrombin and polymyxin B, and
then ICAM-1 expression was studied by FACS analysis after various
times. ICAM-1 was spontaneously expressed on HUVECs after 6 or 24 hours
(Fig 1, top panels), but levels of
expression were higher after stimulation with thrombin (Fig 1, middle
panels). Induction was observed with 0.5 U/mL of thrombin and increased in a dose-dependent way (control, 31%; 0.5 U/mL, 35%; 2 U/mL, 45%; 8 U/mL, 50%, after 6 hours of thrombin stimulation; data not shown).
Thrombin-induced ICAM-1 expression was higher after 24 hours than after
6 hours of stimulation (Fig 1 and Table 1), but was consistently less than after stimulation with IL-1 (Table 1). The addition of the specific thrombin inhibitor hirudin inhibited thrombin-increased ICAM-1 expression on HUVECs (Fig 1, bottom panels).
View larger version (29K):
[in this window]
[in a new window]
| Fig 1.
Thrombin induces CD54 expression on HUVECs
(FACS analysis). HUVECs were cultured for 6 hours (left side) and 24 hours (right side) in culture medium (upper panels), in the presence of
8 U/mL of thrombin (intermediate panels), or in the presence of
thrombin with hirudin (lower panels). After cell trypsinization, CD54
expression was studied by FACS analysis (1 representative experiment
among 5).
|
|
Endothelial VCAM-1 (CD106) expression is induced by thrombin in a
dose- and time-dependent fashion and inhibited by hirudin.
Thrombin induced significant VCAM-1 expression compared with HUVECs
grown in culture medium (Fig 2, top and
middle panels). VCAM-1 was consistently expressed after 6 hours of
stimulation with thrombin, reached maximum levels between 6 and 12 hours, and then markedly decreased 24 hours after stimulation (Fig 2, middle panels, and Table 2). Thrombin
induced VCAM-1 expression in a dose-dependent way (control, 3%; 0.5 U/mL, 9%; 2 U/mL, 17%; 8 U/mL, 36%, after 6 hours of thrombin
stimulation; data not shown). IL-1-stimulated levels of VCAM-1 were
consistently higher than after thrombin stimulation and, in contrast to
thrombin, remained elevated after 24 hours of stimulation (Table 2).
When added to the culture, hirudin 90% inhibited the effects of
thrombin on VCAM-1 expression (Fig 2, bottom panels).
View larger version (24K):
[in this window]
[in a new window]
| Fig 2.
Thrombin induces CD106 expression on HUVECs (FACS
analysis). HUVECs were cultured for 6 hours (left side) and 24 hours
(right side) in culture medium (upper panels), in the presence of 8 U/mL of thrombin (intermediate panels), or in the presence of thrombin with hirudin (lower panels). After cell trypsinization, CD106 expression was studied by FACS analysis (1 representative experiment among 5).
|
|
Thrombin induces ICAM-1 and VCAM-1 expression through interaction
with its specific receptor.
To establish whether thrombin was acting through interaction with its
specific receptor, a 14 AA peptide (TRAP-14) reproducing the active
NH2 terminal part of the thrombin receptor was tested for
ICAM-1 and VCAM-1 induction. TRAP-14 induced similar ICAM-1 expression
than thrombin itself (Table 3). In
contrast, a 14-AA control scrambled peptide did not induce significant
ICAM-1 expression compared with control (Table 3). TRAP-14 also induced
VCAM-1 expression in a similar fashion and kinetics than thrombin
itself (Table 4), whereas the control
peptide did not induce significant VCAM-1 expression compared with
control (Table 4).
Thrombin increases steady-state levels of ICAM-1 and VCAM-1 mRNA.
Using RT-PCR, ICAM-1 mRNA was detected in unstimulated HUVECs, but mRNA
steady-state levels clearly increased 2 hours after thrombin
stimulation, reached maximal levels after 10 hours of stimulation, and
remained elevated after 24 hours of stimulation (Fig 3). VCAM-1 mRNA was present in
unstimulated cells, increased after 2 hours of stimulation, reached a
maximum between 4 and 6 hours, and then started to decrease until 24 hours of stimulation (Fig 3).
View larger version (53K):
[in this window]
[in a new window]
| Fig 3.
Increased CD54 and CD106 mRNA steady-state levels in
thrombin-activated HUVECs. PCR products of RNA prepared from HUVECs
stimulated by 8 U/mL of thrombin for different times were deposited on
a 2% agarose gel. ICAM-1 mRNA was detected in unstimulated cells but
increased after 2 hours and remained high after 24 hours of thrombin
stimulation. VCAM-1 mRNA was detected in unstimulated HUVECs, raised to
a maximum level between 4 and 6 hours and then decreased
until 24 hours.
|
|
Thrombin-induced ICAM-1 and VCAM-1 expression is not mediated by
IL-1/ or TNF.
Thrombin-induced ICAM-1 or VCAM-1 expression was not significantly
decreased by saturating concentrations of IL-1Ra (10 µg/mL), whereas
at these same concentrations, IL-1Ra nearly completely inhibited
IL-1-induced ICAM-1 or VCAM-1 expression
(Table 5). Similarly, in 2 experiments,
anti-TNF MoAb did not significantly decrease thrombin-induced ICAM-1
and VCAM-1 (Table 6) expression.
Thrombin stimulation of HUVECs increases monocyte adhesion.
HUVECs were activated for 6 to 8 hours with thrombin. THP-1 cell line,
PBMCs, or purified monocytes were used as sources of monocytes. We
previously observed that THP-1 cells spontaneously expressed both CD18
and CD49d on their membranes by FACS analysis (data not shown). Labeled
THP-1 cells, PBMCs, or monocytes were then added to unstimulated,
IL-1-stimulated, or 6-hour thrombin-activated HUVECs and, after 1 hour, adherence of mononuclear cells was measured. As shown in
Fig 4, thrombin significantly increased the
levels of THP-1, PBMCs, or purified monocyte adhesion to HUVECs (250%, 249%, and 180% increase, respectively) compared with HUVECs cultured in medium alone. However, the amount of mononuclear cell adhesion on 8 U/mL thrombin-activated HUVECs was consistently lower than on 50 pg/mL
IL-1-stimulated endothelial cells (Fig 4).
View larger version (34K):
[in this window]
[in a new window]
| Fig 4.
Thrombin induces increased monocyte adhesion to
HUVECs. Radiolabeled THP-1 cells, PBMCs, or monocytes were
deposited on untreated or 6-hour treated thrombin- (8 U/mL) or
IL-1- (50 pg/mL) activated HUVECs and allowed to adhere for 1 hour.
After cell lysis, radioactivity was counted and expressed for each
condition as the percentage of adhesive cells compared with 100%
deposited cells (*P < .02 compared with adhesion of
respective cells on unstimulated HUVECs, n = 4). ( ) Medium; ( )
thrombin; ( ) IL-1.
|
|
Inhibition of thrombin-induced mononuclear cell adhesion by anti-CD18
and anti-CD49d MoAb.
THP-1 cells or PBMCs were treated with anti-CD49d MoAb, anti-CD18 MoAb,
or a control IgG1 before the addition to thrombin-activated HUVECs, and the amount of adhesive cells was measured in
these conditions. As shown in Fig 5, both
anti-CD49d MoAb and anti-CD18 MoAb alone or in combination
significantly decreased thrombin-induced THP-1 and PBMC adhesion to
thrombin-activated HUVECs, whereas the control IgG1 did not.
View larger version (36K):
[in this window]
[in a new window]
| Fig 5.
Inhibitory effects of anti-CD18 and anti-CD49d MoAb on
mononuclear cells adhesion to thrombin-activated HUVECs. In some
experiments, THP-1 cells or PBMCs were previously treated with either
anti-CD49d MoAb, anti-CD18 MoAb, or a control IgG1 and then deposited
on HUVECs stimulated with 8 U/mL of thrombin for 6 hours. After cell lysis, radioactivity was counted and expressed for each condition as
the percentage of adhesive cells compared with 100% deposited cells
(*P < .05, **P < .01 compared with adhesive
respective cells on thrombin-activated HUVECs in the presence of
control IgG1, n = 3). () Medium; () thrombin + IgG1; ( )
thrombin + anti-CD18 MoAb; ( ) thrombin + anti-CD49d MoAb; ()
thrombin + anti-CD18 + anti-CD49d.
|
|
Mononuclear cell adhesion on thrombin-activated HUVECs is not due to
HUVEC retraction.
Because thrombin has been reported to induce HUVEC retraction after 30 minutes of stimulation,32 we wanted to eliminate thrombin-induced HUVEC retraction and leukocyte adhesion on
gelatin covering plastic dishes in our experiments. We used a
previously reported confocal microscopy method that allowed us to
measure HUVEC thickness.28 Whereas thrombin-activated
HUVECs showed an increased thickness after 15 minutes of stimulation
(medium, 4.5 ± 0.3 µm; thrombin, 5.9 ± 0.5 µm), after 6 hours of thrombin stimulation, no difference was observed (medium, 4.5 ± 0.2 µm; thrombin, 4.45 ± 0.4 µm; mean of 10 determinations for each experiment, 3 different experiments; data not
shown), showing that long-term HUVEC stimulation by thrombin did not
induce significant HUVEC retraction. In addition, THP-1 cells, PBMCs,
and monocytes did not adhere to plastic covered by gelatin alone (1%
to 3% adhesion; data not shown).
| |
DISCUSSION |
Thrombin not only is involved in the coagulation cascade, but also
appears to play an important role in inflammation through cell
activation properties such as prostaglandin, PAF, or chemokine secretion and selectin expression.20-27 Inflammation is
characterized by a multistep adhesive interaction between leukocytes
and endothelium mediated by molecules belonging to different families
such as selectins, integrins, and the Ig superfamily. In vitro,
thrombin is able to induce P- and E-selectin expression on HUVECs and
may thus control the first step of adhesion.22,23 Thrombin
also induces chemokine production by HUVECs23,24 and thus
may favor leukocyte activation, the second step of the adhesive
cascade.5 In this study, we showed that thrombin was also
involved in the last step of leukocyte-endothelium adhesion, because
thrombin was able to induce expression of functional forms of both
ICAM-1 and VCAM-1 on endothelial cells.
First, we observed that thrombin stimulated significant increases in
mRNA steady-state levels and membrane expression of ICAM-1 in HUVECs
following the usual kinetics. Thrombin-increased expression of ICAM-1
was always at a lower level than after IL-1 stimulation. Thrombin
also increased mRNA steady-state levels of VCAM-1, with a maximum
between 4 and 6 hours, followed by a sharp decrease and weakly
detectable levels after 24 hours. VCAM-1 gene transcription is under
the control of NF- B,33 and some functions of thrombin such as vascular smooth muscle cells proliferation have been shown to
also involve NF-B.34 VCAM-1 expression on HUVECs was
consistent with mRNA concentrations, being significant after 6 hours of
thrombin stimulation, with a maximum after 12 hours and weakly
detectable after 24 hours. This kinetic of VCAM-1 expression appears
rather unusual, because VCAM-1 expression has been usually reported to be sustained for almost 48 hours after IL-1/ or TNF
stimulation.1,10 However, a recent report showed that
VCAM-1 expression on HUVECs after IL-1 stimulation is maximum after
6 to 12 hours and decreased rapidly thereafter.35
Nevertheless, in our hands, despite low concentrations of IL-1 (50 pg/mL), VCAM-1 labeling after IL-1 stimulation was sustained over 24 hours, at a time that it was weakly detectable after thrombin
stimulation. IL-1-induced VCAM-1 expression was also stronger than
after thrombin stimulation. Therefore, we can conclude that thrombin is
a less potent and more transient HUVEC activator than IL-1 for
ICAM-1 and VCAM-1 expression.
A previous report had shown that thrombin induced ICAM-1 expression on
HUVECs.36 Surprisingly, thrombin was reported to induce
ICAM-1 on HUVECs after a few minutes of stimulation, without the need
of protein synthesis and independently of the thrombin receptor
pathway. ICAM-1-increased expression is known to depend on mRNA
transcription and protein synthesis, thus requiring several hours.1,5 Our data are consistent with this
finding and not with the previous report. Moreover, we
found that thrombin induction of ICAM-1 and VCAM-1 was due to an
interaction of thrombin with its specific receptor. This recently
discovered receptor belongs to a new family of protease-activated
receptors.19 Thrombin cleaves the extracellular
NH2-terminal part of the thrombin receptor and shows a new
NH2-terminal part, which then tethers the receptor itself.19 We used a 14-amino acid thrombin receptor
activating peptide, TRAP-14, identical to the newly shown
NH2-terminal part of the trombin receptor, and found that
activation of HUVECs by this peptide was able to induce both ICAM-1 and
VCAM-1 in a way similar to that of thrombin itself.
Inducers of ICAM-1 and VCAM-1 include endotoxin, IL-1/, and
TNF.1,5,10 In this study, we prevented the effects of possible endotoxin contamination of the thrombin preparation by adding
polymyxin B to HUVECs in all experiments. In addition, thrombin action
appears specific, because it was inhibited by the specific thrombin
inhibitor, hirudin, and reproduced by TRAP-14. Moreover, if endotoxin
contamination was responsible for the effects of thrombin in these
experiments, thrombin would have induced IL-1/ and TNF, which
would have likely mediated ICAM-1 and VCAM-1 expression. In agreement
with our previous report,23 we found no significant
inhibitory effects of either IL-1Ra or anti-TNF MoAb on
thrombin-induced ICAM-1 and VCAM-1 expression. Therefore, thrombin has
direct proinflammatory properties on HUVECs without a requirement for
intermediate autocrine or juxtacrine actions of either IL-1/ or
TNF.37,38
Thrombin is known to favor PMN adhesion to HUVECs and to be chemotactic
for neutrophils in vitro and thus to be potentially important in acute
inflammation in vivo.25,26 Thrombin has been shown to be
also chemotactic for monocytes in vitro.27 In this report,
we found that thombin induced significant monocyte adhesion to HUVECs
in vitro that could be significantly decreased by anti-CD18 and
anti-CD49d MoAb. Increased adhesion of monocytes on thrombin-activated
HUVECs could not be due to thrombin-induced HUVEC
retraction32 and adhesion to gelatin, because we eliminated HUVEC retraction using a confocal microscopy method that allowed us to
measure HUVEC thickness and we observed no significant mononuclear cell
adhesion on gelatin alone. Adhesion of THP-1 on thrombin-activated HUVECs appeared to be more affected by anti-CD18 MoAb than that of
PBMCs. This result may be the consequence of different levels of
CD11/CD18 avidity on THP-1 compared with PBMCs. Therefore, thrombin is
likely to play an important role in chronic inflammatory situations
characterized by tissular monocyte infiltration, such as rheumatoid
arthritis, atherogenesis, and chronic allograft rejection.
In rheumatoid arthritis, for example, thrombin is present in the
synovial fluid and has been shown to mediate both direct cartilage
degradation39 and synovial cell
proliferation.40 Rheumatoid joints are characterized by
monocyte and T-lymphocyte migration from the blood
compartment.41 Memory T-lymphocyte adhesion to endothelium
involves E-selectin as well as ICAM-1.42 In experimental
models, monocyte migration into the joints can be blocked by a
combination of anti-CD11a/CD18, anti CD11b/CD18, and anti-CD49d MoAbs,
demonstrating the important role of these molecules in the pathogenesis
of inflammatory arthritis.43 Because thrombin directly
induces endothelial E-selectin expression23 and both ICAM-1
and VCAM-1, as shown in this report, thrombin in rheumatoid arthritis
fluid may participate in mononuclear cell adhesion. In addition,
thrombin induces endothelial chemokine production, such as IL-8 and
MCP-1, that have been found at high concentrations in rheumatoid
arthritis joint fluids.41 Thus, thrombin may participate to
both leukocyte migration and adhesion into rheumatoid joints.
Thrombin induction of VCAM-1 expression may also be important in
atherogenesis, because the first steps of the atherosclerotic lesions
are characterized by monocytes adhesion to ECs.44 VCAM-1 has been shown to be a critical molecule in this phenomenon, because it
is expressed in close association with foam cells and its endothelial expression is induced by lipids.45 ICAM-1 is also present
in the atheromatous plaque and may participate in monocyte adhesion. Thrombin has been suggested to be an important player in atherogenesis, because the thrombin receptor has been found widely expressed in the
atheromatous plaque, in close association with macrophages and vascular
smooth muscle cells.46 Thrombin is indeed a potent smooth
muscle cell mitogen47 and induces MCP-1 production by HUVECs, a chemokine active on monocytes that is highly expressed in the
plaque.48 Thrombin ability to induce both ICAM-1 and VCAM-1
adds important clue to understand its role in atherogenesis.
Chronic allograft rejection is also characterized by mononuclear cell
infiltration, and ICAM-1 and VCAM-1 are both highly expressed on ECs
during allograft rejection.49,50 Thrombin is also present
in rejected tissues, because infiltrating monocytes express tissue
factor, fibrin deposition is intense, and thrombomodulin, a thrombin
inhibitor, is decreased.51 Thrombin ability to induce both
ICAM-1 and VCAM-1 and to favor endothelial monocyte adhesion may
therefore participate in the rejection cascade.
In conclusion, we showed that thrombin is able to directly induce not
only endothelial selectin expression and, therefore, low-affinity
adhesive interaction between leukocyte and endothelium, but also
molecules of the Ig superfamily, such as ICAM-1 and VCAM-1, which
mediate firm adhesion of mononuclear cells to endothelium and may be
important during chronic inflammation.
| |
FOOTNOTES |
Submitted November 11, 1997;
accepted April 9, 1998.
Address reprint requests to Gilles Kaplanski, MD, PhD, INSERM U387,
Hôpital Sainte-Marguerite, 270 Boulevard Sainte-Marguerite, 13009 Marseille, France.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.
| |
REFERENCES |
1.
Bevilacqua MP:
Endothelial-leukocyte adhesion molecules.
Ann Rev Immunol
11:767,
1993[Medline]
[Order article via Infotrieve]
2.
Lasky LA:
Selectins: Interpreters of cell-specific carbohydrate information during inflammation.
Science
258:964,
1992[Abstract/Free Full Text]
3.
Lawrence MB,
Springer TA:
Leukocyte roll on a selectin at physiologic flow rates: Distinction from and prerequisite for adhesion through integrins.
Cell
65:859,
1991[Medline]
[Order article via Infotrieve]
4.
Kaplanski G,
Farnarier C,
Tissot O,
Pierres A,
Benoliel AM,
Alessi MC,
Kaplanski S,
Bongrand P:
Granulocyte-endothelium initial adhesion: Analysis of transient binding events mediated by E-selectin in a laminar shear flow.
Biophys J
64:1922,
1993[Medline]
[Order article via Infotrieve]
5.
Springer TA:
Traffic signals for lymphocyte recirculation and leukocyte emigration: The multistep paradigm.
Cell
76:301,
1994[Medline]
[Order article via Infotrieve]
6.
Kishimoto TK,
Larson RS,
Corbi AL,
Dustin ML,
Staunton DE,
Springer TA:
The leukocyte integrins.
Adv Immunol
46:149,
1989[Medline]
[Order article via Infotrieve]
7.
Pawlowski NA,
Abraham EL,
Pontier S,
Scott WA,
Cohn ZA:
Human monocyte-endothelial cell interaction in vitro.
Proc Natl Acad Sci USA
82:8208,
1985[Abstract/Free Full Text]
8.
Luscinskas FW,
Kansas GS,
Ding H,
Pizcueta P,
Schleiffenbaum BE,
Tedder TF,
Gimbrone MA:
Monocyte rolling, arrest and spreading on IL-4-activated vascular endothelium under flow is mediated via sequential action of L-selectin, 1 integrins, and 2 integrins.
J Cell Biol
125:1417,
1994[Abstract/Free Full Text]
9.
Spertini O,
Luscinskas FW,
Gimbrone MA,
Tedder TF:
Monocyte attachment to activated human vascular endothelium in vitro is mediated by leukocyte adhesion molecule-1 (L-selectin) under nonstatic conditions.
J Exp Med
175:1789,
1992[Abstract/Free Full Text]
10.
Osborn L,
Hession C,
Tizard R,
Vassalo C,
Luhowskyj S,
Chi-Rosso G,
Lobb R:
Direct expression cloning of vascular cell adhesion molecule 1, a cytokine-induced endothelial protein that binds to lymphocytes.
Cell
59:1203,
1989[Medline]
[Order article via Infotrieve]
11.
Berlin C,
Bargatze RF,
Campbell JJ,
von Andrian UH,
Sczabo MC,
Hasslen SR,
Nelson RD,
Berg EL,
Erlandsen SL,
Butcher EC:
4 integrins mediate lymphocyte attachment and rolling under physiologic flow.
Cell
80:413,
1995[Medline]
[Order article via Infotrieve]
12.
Alon R,
Kassner PD,
Woldemar Carr M,
Finger EB,
Hemler ME,
Springer TA:
The integrin VLA-4 supports tethering and rolling in flow on VCAM-1.
J Cell Biol
128:1243,
1995[Abstract/Free Full Text]
13.
Newman PJ:
The biology of PECAM-1.
J Clin Invest
99:3,
1997[Medline]
[Order article via Infotrieve]
14.
Cirino G,
Cicala C,
Bucci MR,
Sorrentino L,
Maraganore JM,
Stone SR:
Thrombin functions as an inflammatory mediator through activation of its receptor.
J Exp Med
183:821,
1996[Abstract/Free Full Text]
15.
Bevilaqua MP,
Pober JS,
Majeau GR,
Cotran RS,
Gimbrone MA:
Interleukin 1 (IL-1) induces biosynthesis and cell surface expression of procoagulant activity in human vascular endothelial cell.
J Exp Med
160:618,
1984[Abstract/Free Full Text]
16.
Toosi Z,
Sedor JR,
Mettler MA,
Everson B,
Young T,
Ratnoff OD:
Induction of expression of monocyte interleukin 1 by Hageman factor (factor XII).
Proc Natl Acad Sci USA
89:11969,
1992[Abstract/Free Full Text]
17.
Kaplanski G,
Porat R,
Aiura K,
Erban JK,
Gealfand JA,
Dinarello CA:
Activated platelets induce endothelial secretion of interleukin-8 via an interleukin-1 mediated event.
Blood
81:2492,
1993[Abstract/Free Full Text]
18.
Stubbs MT,
Bode W:
A player of many parts: The spotlight falls on thrombin's structure.
Thromb Res
69:1,
1993[Medline]
[Order article via Infotrieve]
19.
Vu TKH,
Hung DT,
Wheaton VI,
Coughlin SR:
Molecular cloning of a functional thrombin receptor reveals a novel proteolytic mechanism of receptor activation.
Cell
64:1057,
1991[Medline]
[Order article via Infotrieve]
20.
Weksler BB,
Ley CW,
Jaffe EA:
Stimulation of endothelial cell prostacyclin production by thrombin, trypsin and the ionophore A23187.
J Clin Invest
62:923,
1978
21.
Prescott SM,
Zimmerman GA,
McIntyre TM:
Human endothelial cells in culture produce platelet-activating factor (1-alkyl-2-acetyl-sn-glycero-3-phosphocholine) when stimulated with thrombin.
Proc Natl Acad Sci USA
81:3534,
1984[Abstract/Free Full Text]
22.
Lorant DE,
Patel KDA,
McIntyre TM,
McEver RP,
Prescott SM,
Zimmerman GA:
Coexpression of GMP-140 and platelet activating factor by endothelium stimulated by histamine and thrombin: A juxtacrine system for adhesion and activation of neurophils.
J Cell Biol
115:223,
1991[Abstract/Free Full Text]
23.
Kaplanski G,
Fabrigoule M,
Boulay V,
Dinarello CA,
Bongrand P,
Farnarier C:
Thrombin induces endothelial type II activation in vitro: IL-1 and TNF--independent IL-8 secretion and E-selectin expression.
J Immunol
158:5435,
1997[Abstract]
24.
Colotta F,
Sciacca FL,
Sironi M,
Luini W,
Rabiet MJ,
Mantovani A:
Expression of monocyte chemotactic protein-1 by monocytes and endothelial cells exposed to thrombin.
Am J Pathol
144:975,
1994[Abstract]
25.
Bizios R,
Lai L,
Fenton JW,
Malik AB:
Thrombin-induced chemotaxis and aggregation of neutrophils.
J Cell Physiol
128:485,
1986[Medline]
[Order article via Infotrieve]
26.
Zimmerman GA,
McIntyre TM,
Prescott SM:
Thrombin stimulates the adherence of neutrophils to human endothelial cells in vitro.
J Clin Invest
76:2235,
1985
27.
Bar-Shavit R,
Kahn A,
Fenton JW,
Wilner GD:
Chemotactic response of monocytes to thrombin.
J Cell Biol
96:282,
1983[Abstract/Free Full Text]
28.
Kaplanski G,
Farnarier C,
Benoliel AM,
Foa C,
Kaplanski S,
Bongrand P:
A novel role for E- and P-selectins: Shape control of endothelial cell monolayers.
J Cell Sci
107:2449,
1994[Abstract]
29.
Bouaboula M,
Legoux P,
Pésségé B,
Delpech B,
Dumont X,
Piechaczyk H,
Casselas P,
Shire D:
Standardization of mRNA titration using a polymerase chain reaction method involving co-amplification with multispecific internal control.
J Biol Chem
267:21830,
1992[Abstract/Free Full Text]
30.
Maegher L,
Mahiouc D,
Sugars K,
Burrows N,
Norris P,
Yarwood H,
Becker-Andre M,
Haskard DO:
Measurement of mRNA for E-selectin, VCAM-1 and ICAM-1 by reverse transcription and the polymerase chain reaction.
J Immunol Methods
175:237,
1994[Medline]
[Order article via Infotrieve]
31.
Tso JY,
Sun XH,
Kao TH,
Reece KS,
Wu R:
Isolation and characterization of rat and human glyceraldehyde-3-phosphate deshydrogenase cDNAs: Genomic complexity and molecular evolution of the gene.
Nucleic Acids Res
6:625,
1985[Abstract/Free Full Text]
32.
Goeckeler ZM,
Wysolmerski RB:
Myosin light chain kinase-regulated endothelial cell contraction: The relationship between isometric tension, actin polymerization, and myosin phosphorylation.
J Cell Biol
130:613,
1995[Abstract/Free Full Text]
33.
Neish AS,
Williams AJ,
Palmer HJ,
Whitley MZ,
Collins T:
Functional analysis of the human vascular cell adhesion molecule 1 promoter.
J Exp Med
176:1583,
1992[Abstract/Free Full Text]
34.
Nakajima T,
Kitajima I,
Shin H,
Takasaki I,
Shigeta K,
Abeyama K,
Yamashita Y,
Tokioka T,
Soejima Y,
Maruyama I:
Involvement of NF-B activation in thrombin-induced human vascular smooth muscle cell proliferation.
Biochem Biophys Res Commun
204:950,
1994[Medline]
[Order article via Infotrieve]
35.
Scholz D,
Devaux B,
Hirche A,
Pötzsch B,
Kropp B,
Schaper W,
Schaper J:
Expression of adhesion molecules is specific and time-dependent in cytokine-stimulated endothelial cells in culture.
Cell Tissue Res
284:415,
1996[Medline]
[Order article via Infotrieve]
36.
Sugama Y,
Tiruppathi C,
Janakidevi K,
Andersen TT,
Fenton JW,
Malik AB:
Thrombin-induced expression of endothelial P-selectin and intercellular adhesion molecule-1: A mechanism for stabilizing neutrophil adhesion.
J Cell Biol
119:935,
1992[Abstract/Free Full Text]
37.
Kaplanski G,
Teysseire N,
Farnarier C,
Kaplanski S,
Lissitzky JC,
Durand JM,
Soubeyrand J,
Dinarello CA,
Bongrand P:
IL-6 and IL-8 production from cultured human endothelial cells stimulated by infection with Rickettsia conorii is via a cell-associated IL-1-dependent pathway.
J Clin Invest
96:2839,
1995
38.
Schmidt MH,
Binder K,
Grell M,
Scheurich P,
Pfizenmaier K:
Both tumor necrosis factor receptors, TNFR 60 and TNFR 80, are involved in signalling endothelial tissue factor expression by juxtacrine tumor necrosis factor .
Blood
86:123,
1995
39.
Furmaniak-Kazmierczak E,
Cooke TDV,
Manuel R,
Scudamore A,
Hoogendorn H,
Giles AR,
Nesheim M:
Studies of thrombin-induced proteoglycan release in the degradation of human and bovine cartilage.
J Clin Invest
94:472,
1994
40.
Shin H,
Nakajima T,
Kitajima I,
Shigeta K,
Abeyama K,
Imamura T,
Okano T,
Kawahara K,
Nakamura T,
Maruyama I:
Thrombin receptor-mediated synovial proliferation in patients with rheumatoid arthritis.
Clin Immunol Immunopathol
76:225,
1995[Medline]
[Order article via Infotrieve]
41.
Feldmann M,
Brennan F,
Maini RN:
Role of cytokines in rheumatoid arthritis.
Annu Rev Immunol
14:397,
1996[Medline]
[Order article via Infotrieve]
42.
Rosen SD:
Cell surface lectins in the immune system.
Semin Immunol
5:237,
1993[Medline]
[Order article via Infotrieve]
43.
Issekutz AC,
Issekutz TB:
Monocytes migration to arthritis in the rat utilizes both CD11/CD18 and very late activation antigen 4 integrin mechanisms.
J Exp Med
181:1197,
1995[Abstract/Free Full Text]
44.
Ross R:
The pathogenesis of atherosclerosis: An update.
N Engl J Med
314:488,
1986[Medline]
[Order article via Infotrieve]
45.
Cybulsky MI,
Gimbrone MA:
Endothelial expression of a mononuclear leukocyte adhesion molecule during aherogenesis.
Science
251:788,
1991[Abstract/Free Full Text]
46.
Nelken NA,
Soifer SJ,
O'Keefe J,
Vu TKH,
Charo IF,
Coughlin SR:
Thrombin receptor expression in normal and atherosclerotic human arteries.
J Clin Invest
90:1614,
1992
47.
McNamara CA,
Sarembock IJ,
Gimple LW,
Fenton JW,
Coughlin SR,
Owens GK:
Thrombin stimulates proliferation of cultured rat aortic smooth muscle cells by a proteolitically activated receptor.
J Clin Invest
91:94,
1993
48.
Nelken NA,
Coughlin SR,
Gordon D,
Wilcox JN:
Monocyte chemoattractant protein-1 in human atheromatous plaques.
J Clin Invest
88:1121,
1991
49.
Cosimi AB,
Conti D,
Delmonico FL,
Preffer FI,
Wee SL,
Rothlein R,
Faanes R,
Colvin RB:
In vivo effects of monoclonal antibody to ICAM-1 (CD54) in nonhuman primates with renal allografts.
J Immunol
144:4604,
1990[Abstract]
50.
Pelletier RP,
Ohye RG,
Vanbuskirk A,
Sedmark DD,
Kincade P,
Ferguson RM,
Orosz CG:
Importance of endothelial VCAM-1 for inflammatory leukocytic infiltration in vivo.
J Immunol
149:2473,
1992[Abstract]
51.
Tsuchida A,
Salem H,
Thomson N,
Hancock WW:
Tumor necrosis factor production during human renal allograft rejection is associated with depression of plasma protein C and free protein S levels and decreased intragraft thrombomodulin expression.
J Exp Med
175:81,
1992[Abstract/Free Full Text]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
R. C. Landis
Redefining the Systemic Inflammatory Response
Seminars in Cardiothoracic and Vascular Anesthesia,
June 1, 2009;
13(2):
87 - 94.
[Abstract]
[PDF]
|
|
|
|
|
|
|
J. I. Borissoff, H. M.H. Spronk, S. Heeneman, and H. ten Cate
Is thrombin a key player in the 'coagulation-atherogenesis' maze?
Cardiovasc Res,
June 1, 2009;
82(3):
392 - 403.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. A. Sharfuddin, R. M. Sandoval, D. T. Berg, G. E. McDougal, S. B. Campos, C. L. Phillips, B. E. Jones, A. Gupta, B. W. Grinnell, and B. A. Molitoris
Soluble Thrombomodulin Protects Ischemic Kidneys
J. Am. Soc. Nephrol.,
March 1, 2009;
20(3):
524 - 534.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. S. Mullins, K. W. Kombrinck, K. E. Talmage, M. A. Shaw, D. P. Witte, J. M. Ullman, S. J. Degen, W. Sun, M. J. Flick, and J. L. Degen
Genetic elimination of prothrombin in adult mice is not compatible with survival and results in spontaneous hemorrhagic events in both heart and brain
Blood,
January 15, 2009;
113(3):
696 - 704.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G. Dever, C. M. Spickett, S. Kennedy, C. Rush, G. Tennant, A. Monopoli, and C. L. Wainwright
The Nitric Oxide-Donating Pravastatin Derivative, NCX 6550 [(1S-[1{alpha}(betaS*, {delta}S*), 2{alpha}, 6{alpha}, 8beta-(R*), 8a{alpha}]]-1,2,6,7,8,8a-Hexahydro-beta, {delta}, 6-trihydroxy-2-methyl-8-(2-methyl-1-oxobutoxy)-1-naphtalene-heptanoic Acid 4-(Nitrooxy)butyl Ester)], Reduces Splenocyte Adhesion and Reactive Oxygen Species Generation in Normal and Atherosclerotic Mice
J. Pharmacol. Exp. Ther.,
January 1, 2007;
320(1):
419 - 426.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Z. Lin, A. Hamik, R. Jain, A. Kumar, and M. K. Jain
Kruppel-Like Factor 2 Inhibits Protease Activated Receptor-1 Expression and Thrombin-Mediated Endothelial Activation
Arterioscler Thromb Vasc Biol,
May 1, 2006;
26(5):
1185 - 1185.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Tedgui and Z. Mallat
Cytokines in Atherosclerosis: Pathogenic and Regulatory Pathways
Physiol Rev,
April 1, 2006;
86(2):
515 - 581.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. R.S. Day, K. M. Taylor, E. A. Lidington, J. C. Mason, D. O. Haskard, A. M. Randi, and R. C. Landis
Aprotinin inhibits proinflammatory activation of endothelial cells by thrombin through the protease-activated receptor 1
J. Thorac. Cardiovasc. Surg.,
January 1, 2006;
131(1):
21 - 27.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. A. Lidington, R. Steinberg, A. R. Kinderlerer, R. C. Landis, M. Ohba, A. Samarel, D. O. Haskard, and J. C. Mason
A role for proteinase-activated receptor 2 and PKC-{epsilon} in thrombin-mediated induction of decay-accelerating factor on human endothelial cells
Am J Physiol Cell Physiol,
December 1, 2005;
289(6):
C1437 - C1447.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
N. Miho, T. Ishida, N. Kuwaba, M. Ishida, K. Shimote-Abe, K. Tabuchi, T. Oshima, M. Yoshizumi, and K. Chayama
Role of the JNK pathway in thrombin-induced ICAM-1 expression in endothelial cells
Cardiovasc Res,
November 1, 2005;
68(2):
289 - 298.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Steinhoff, J. Buddenkotte, V. Shpacovitch, A. Rattenholl, C. Moormann, N. Vergnolle, T. A. Luger, and M. D. Hollenberg
Proteinase-Activated Receptors: Transducers of Proteinase-Mediated Signaling in Inflammation and Immune Response
Endocr. Rev.,
February 1, 2005;
26(1):
1 - 43.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C.-R. Yang, S.-L. Hsieh, F.-M. Ho, and W.-W. Lin
Decoy Receptor 3 Increases Monocyte Adhesion to Endothelial Cells via NF-{kappa}B-Dependent Up-Regulation of Intercellular Adhesion Molecule-1, VCAM-1, and IL-8 Expression
J. Immunol.,
February 1, 2005;
174(3):
1647 - 1656.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
U. M. Chandrasekharan, L. Yang, A. Walters, P. Howe, and P. E. DiCorleto
Role of CL-100, a Dual Specificity Phosphatase, in Thrombin-induced Endothelial Cell Activation
J. Biol. Chem.,
November 5, 2004;
279(45):
46678 - 46685.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Tobu, O. Iqbal, D. Fareed, M. Chatha, D. Hoppensteadt, V. Bansal, and J. Fareed
Erythropoietin-Induced Thrombosis as a Result of Increased Inflammation and Thrombin Activatable Fibrinolytic Inhibitor
Clinical and Applied Thrombosis/Hemostasis,
July 1, 2004;
10(3):
225 - 232.
[Abstract]
[PDF]
|
|
|
|
|
|
|
G. G. Neely, S. Epelman, L. L. Ma, P. Colarusso, C. J. Howlett, E. K. Amankwah, A. C. McIntyre, S. M. Robbins, and C. H. Mody
Monocyte Surface-Bound IL-15 Can Function as an Activating Receptor and Participate in Reverse Signaling
J. Immunol.,
April 1, 2004;
172(7):
4225 - 4234.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Minami, A. Sugiyama, S.-Q. Wu, R. Abid, T. Kodama, and W. C. Aird
Thrombin and Phenotypic Modulation of the Endothelium
Arterioscler Thromb Vasc Biol,
January 1, 2004;
24(1):
41 - 53.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. E. Szmitko, C.-H. Wang, R. D. Weisel, J. R. de Almeida, T. J. Anderson, and S. Verma
New Markers of Inflammation and Endothelial Cell Activation: Part I
Circulation,
October 21, 2003;
108(16):
1917 - 1923.
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. D. Major, R. J. Santulli, C. K. Derian, and P. Andrade-Gordon
Extracellular Mediators in Atherosclerosis and Thrombosis: Lessons From Thrombin Receptor Knockout Mice
Arterioscler Thromb Vasc Biol,
June 1, 2003;
23(6):
931 - 939.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
W. C. Aird
The role of the endothelium in severe sepsis and multiple organ dysfunction syndrome
Blood,
May 15, 2003;
101(10):
3765 - 3777.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J.-C. Murciano, S. Muro, L. Koniaris, M. Christofidou-Solomidou, D. W. Harshaw, S. M. Albelda, D. N. Granger, D. B. Cines, and V. R. Muzykantov
ICAM-directed vascular immunotargeting of antithrombotic agents to the endothelial luminal surface
Blood,
May 15, 2003;
101(10):
3977 - 3984.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. L. Copple, F. Moulin, U. M. Hanumegowda, P. E. Ganey, and R. A. Roth
Thrombin and Protease-Activated Receptor-1 Agonists Promote Lipopolysaccharide-Induced Hepatocellular Injury in Perfused Livers
J. Pharmacol. Exp. Ther.,
May 1, 2003;
305(2):
417 - 425.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S.-Q. Wu, T. Minami, D. J. Donovan, and W. C. Aird
The proximal serum response element in the Egr-1 promoter mediates response to thrombin in primary human endothelial cells
Blood,
December 15, 2002;
100(13):
4454 - 4461.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Rahman, A. L. True, K. N. Anwar, R. D. Ye, T. A. Voyno-Yasenetskaya, and A. B. Malik
G{alpha}q and G{beta}{gamma} Regulate PAR-1 Signaling of Thrombin-Induced NF-{kappa}B Activation and ICAM-1 Transcription in Endothelial Cells
Circ. Res.,
September 6, 2002;
91(5):
398 - 405.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Minami and W. C. Aird
Thrombin Stimulation of the Vascular Cell Adhesion Molecule-1 Promoter in Endothelial Cells Is Mediated by Tandem Nuclear Factor-kappa B and GATA Motifs
J. Biol. Chem.,
December 7, 2001;
276(50):
47632 - 47641.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
V. Marin, F. A. Montero-Julian, S. Gres, V. Boulay, P. Bongrand, C. Farnarier, and G. Kaplanski
The IL-6-Soluble IL-6R{alpha} Autocrine Loop of Endothelial Activation as an Intermediate Between Acute and Chronic Inflammation: an Experimental Model Involving Thrombin
J. Immunol.,
September 15, 2001;
167(6):
3435 - 3442.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Kaur, R. C. Woodman, L. Ostrovsky, and P. Kubes
Selective recruitment of neutrophils and lymphocytes by thrombin: a role for NF-{kappa}B
Am J Physiol Heart Circ Physiol,
August 1, 2001;
281(2):
H784 - H795.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
V. Marin, C. Farnarier, S. Gres, S. Kaplanski, M. S.-S. Su, C. A. Dinarello, and G. Kaplanski
The p38 mitogen-activated protein kinase pathway plays a critical role in thrombin-induced endothelial chemokine production and leukocyte recruitment
Blood,
August 1, 2001;
98(3):
667 - 673.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G. Asimakopoulos, E. A. Lidington, J. Mason, D. O. Haskard, K. M. Taylor, and R. C. Landis
Effect of aprotinin on endothelial cell activation
J. Thorac. Cardiovasc. Surg.,
July 1, 2001;
122(1):
123 - 128.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. von Kanel, P. J. Mills, C. Fainman, and J. E. Dimsdale
Effects of Psychological Stress and Psychiatric Disorders on Blood Coagulation and Fibrinolysis: A Biobehavioral Pathway to Coronary Artery Disease?
Psychosom Med,
July 1, 2001;
63(4):
531 - 544.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. R. Goth and R. S. Stephens
Rapid, Transient Phosphatidylserine Externalization Induced in Host Cells by Infection with Chlamydia spp.
Infect. Immun.,
February 1, 2001;
69(2):
1109 - 1119.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. A. Lidington, D. O. Haskard, and J. C. Mason
Induction of decay-accelerating factor by thrombin through a protease-activated receptor 1 and protein kinase C-dependent pathway protects vascular endothelial cells from complement-mediated injury
Blood,
October 15, 2000;
96(8):
2784 - 2792.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Stefanec
Endothelial Apoptosis: Could It Have a Role in the Pathogenesis and Treatment of Disease?
Chest,
March 1, 2000;
117(3):
841 - 854.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. K. Henke, L. A. DeBrunye, R. M. Strieter, J. S. Bromberg, M. Prince, A. M. Kadell, M. Sarkar, F. Londy, and T. W. Wakefield
Viral IL-10 Gene Transfer Decreases Inflammation and Cell Adhesion Molecule Expression in a Rat Model of Venous Thrombosis
J. Immunol.,
February 15, 2000;
164(4):
2131 - 2141.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Abstract
Introduction
Abstract