|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 92 No. 4 (August 15), 1998:
pp. 1268-1276
A Novel Human Actin-Binding Protein Homologue That Binds to
Platelet Glycoprotein Ib
By
Wen-feng Xu,
Zhi-wei Xie,
Dominic W. Chung, and
Earl W. Davie
From the Department of Biochemistry, University of Washington,
Seattle, WA.
 |
ABSTRACT |
Glycoprotein (GP)Ib-IX-V is one of the major transmembrane complexes
present on the platelet surface. Its extracellular domain binds von
Willebrand factor (vWF) and thrombin, while its intracellular domain
associates tightly with the cytoskeleton through the actin-binding protein (ABP)-280, also known as filamin. In the present study, a
full-length cDNA coding for a human ABP homologue has been cloned and
sequenced. This protein was identified by the yeast two-hybrid screening procedure via its interaction with the intracellular domain
of GPIb . Initially, a 1.3-kb partial cDNA was isolated from a
megakaryocyte-like cell line (K562) cDNA library followed by a
full-length cDNA of 9.4 kb that was identified in a human placenta
library. The full-length cDNA encoded a protein of 2,578 amino acids
with a calculated molecular weight of 276 kD (ABP-276). The amino
terminal 248 amino acids contained an apparent actin binding domain
followed by 24 tandem repeats each containing about 96 amino acids. The
amino acid sequence of the protein shared a high degree of homology
with human endothelial ABP-280 (70% identity) and chicken filamin
(83% identity). However, the 32 amino acid Hinge I region in ABP-280
that contains a calpain cleavage site conferring flexibility on the
molecule, was absent in the homologue. An isoform containing a 24 amino
acid insertion with a unique sequence at the missing Hinge I region was
also identified (ABP-278). This isoform resulted from alternative RNA
splicing. ABP-276 and/or ABP-278 were present in all tissues
examined, but the relative amount varied in that some tissue contained
both forms, while other tissue contained predominately one or the
other.
© 1998 by The American Society of Hematology.
| |
INTRODUCTION |
THE GLYCOPROTEIN (GP)Ib-IX-V complex is
the major transmembrane receptor for von Willebrand factor (vWF) on the
platelet surface and is present at about 25,000 copies per
platelet.1 It contains four type I single-pass
transmembrane proteins including GPIb, GPIb , GPIX, and GPV
associated in a molar ratio of 2:2:2:1.2 GPIb and
GPIb are linked by a disulfide bond,3 while GPIX is
linked to the complex by noncovalent bonds.4 GPV is weakly associated with two GPIb-IX molecules in the complex.5 The N-terminal extracellular domain of GPIb binds vWF and also contains a high-affinity binding site for thrombin,6,7 while the
extracellular domain of GPV contains cleavage sites for both thrombin
and calpain.5
The GPIb-IX-V complex is involved in mediating several activities
important for normal platelet function, including the initial adhesion
of platelets to the subendothelium after vascular damage, the
activation of platelets by very low concentrations of thrombin, and the
regulation of actin polymerization and subsequent platelet shape
changes.8 The binding of vWF to the GPIb-IX-V complex initiates these specific intracellular signaling pathways that lead to
platelet activation, secretion, and aggregation.9 The intracellular domain of GPIb associates with the platelet
cytoskeleton by a direct interaction with actin-binding protein (ABP,
also known as filamin).10,11 This association affects the
shape of resting platelets and subsequently allows them to spread after activation.12 The GPIb-IX-V complex may also be a
high-affinity thrombin receptor on the platelet surface that is coupled
to platelet activation through the protein 14-3-3  ,13
which has been shown to associate with the GPIb-IX-V complex via the
intracellular domain of the GPIb subunit. The 14-3-3 is known to
activate the Raf-1 signaling pathway.14 An increase in the
cyclic adenosine monophosphate (cAMP) level in platelets
is accompanied by phosphorylation of serine 166 in the intracellular
domain of GPIb by a cAMP-dependent protein kinase,15
mediating the inhibition of actin polymerization.16
ABP-280 is a dimeric protein that self-associates in nonmuscle cells
and defines the three-dimensional organization of actin filaments in
the submembraneous cortex. The N-terminal of each subunit of ABP-280
contains an actin binding domain, followed by a semiflexible rod-like
domain consisting of 24 tandem repeats, each approximately 96 amino
acids in length.17 Each repeat sequence is predicted to
have six to eight short -sheets, and these repeats interact
intramolecularly to form a rigid rod-like structure. The repeats are
interrupted by two insertions located between repeats 15 and 16 and
between repeats 23 and 24. These insertions, which are called the Hinge
I and Hinge II regions respectively, coincide with swivel regions in
the molecule and are believed to confer flexibility to the otherwise
rigid rod-like structure. Repeat 24 contains the self-association
site,17,18 while repeats 17-19 contain the binding site for
the intracellular domain of the GPIb.19 The gene for
ABP-280 has been mapped to Xq28.20 The partial sequence of
a homologue of ABP-280, expressed exclusively in skeletal muscle and
heart, was 72% identical to ABP-280 over two regions of the
molecule.20 The gene for this homologue was mapped to
chromosome 7.20 Several membrane proteins, including the
acetycholine receptor, the immunoglobulin receptor Fc IR, the CD18
subunit of the 2 integrin, and the thyroid stimulating hormone receptor, have been shown to colocalize and interact with ABP-280.21-24
By using the yeast two-hybrid system, a partial cDNA coding for a
protein that interacted with the intracellular domain of GPIb has
been isolated from a megakaryocyte-like cell line K562. Subsequently, a
full-length cDNA for this protein was isolated and characterized from a
human placenta library. These results show that the encoded protein is
a homologue of the two other human ABPs previously
described.17,20
| |
MATERIALS AND METHODS |
Two-hybrid screening.
The sequence encoding the intracellular domain of GPIb
(His515-Leu610) was amplified by polymerase chain reaction (PCR) from a
human erythroleukemia cell (HEL) cDNA library.25 The PCR
product was cloned directly into the yeast two-hybrid vector PAS2-1
(Clontech, Palo Alto, CA), creating a fusion of the GAL4
DNA binding domain with the intracellular domain of GPIb. This
fusion bait construct (GPIb/PAS2-1) was transformed into the yeast
strain CG-1945, and the resulting Trp+ strain was used
subsequently to screen a K562 cDNA library (Clontech), in which cDNAs
were cloned into the PACT2 (Clontech) vector. This generated a hybrid
protein with the GAL4 activation domain. Interaction of the cDNA hybrid
protein with the GPIb-GAL4 DNA binding fusion protein led
to reconstitution of a functional GAL4 transcription activator and
expression of the reporter His3 gene. For further confirmation,
transformants with the His+ phenotype were tested for
expression of a second reporter gene lacZ using a filter assay
for -galactosidase activity. All yeast manipulations, as well as
-galactosidase enzyme activity assays, were performed as
recommended by the supplier (Clontech).
Nucleotide sequencing.
cDNA inserts were sequenced by the dideoxy chain termination
method26 using the Sequenase Kit from US Biochemical,
Cleveland, OH. All sequences reported were determined on
both strands.
Cloning of full-length cDNA.
A subdivided human placenta cDNA library (ZymoGenetics Inc, Seattle,
WA) was screened by a combination of PCR and colony
hybridization using the partial cDNA sequence as a probe. Briefly,
human placenta cDNA was synthesized and cloned into a plasmid vector
pZP9 (ZymoGenetics Inc). A total of 500 miniprep DNAs (HPA001-500) were
prepared from 500 plates, each containing about 10,000 colonies. The
miniprep DNAs were combined into 50 DNA mixtures (HPB01-50) and
subsequently into five DNA mixtures (HPC1-5). For library screening,
PCR amplification was first performed with a pair of primers at the
5 end of the partial cDNA sequence, using DNA mixtures HPC1-5 as
templates. The positive PCR signal was further traced by screening the
corresponding constituent DNA mixtures in the HPB01-50 collection.
Eventually, single miniprep DNA in the HPA001-500 collection containing
the positive clone was identified. One microgram of DNA from this miniprep was transformed into E. coli strain INV'F
(Invitrogen, Carlsbad, CA), plated, and screened with a
radioactively-labeled DNA probe using conventional colony hybridization
method.
Analysis of alternative RNA splicing.
To study the presence or absence of a 24 amino acid Hinge I region in
ABP-278 or ABP-276, fragments of genomic sequence encompassing the
Hinge I region were amplified by PCR with primers P3, P4, P5, and P6,
using human genomic DNA (GIBCO/BRL, Gaithersburg, MD) as a
template. The primers P3 and P4 were located at the flanking regions of
Hinge I and were specific for the ABP homologue, but not ABP-280. The
PCR products were cloned into the PCR cloning vector (Invitrogen) and
sequenced. Two internal PCR primers (P5 and P6) were also used to
determine the size of the introns.
To analyze the tissue distribution of ABP-276 and ABP-278, cDNAs from
various tissues (Clontech) were used as templates for PCR amplification
with primers P3 and P4. The glyceraldehyde-3-phosphate dehydrogenase
(G3PDH) sequence, amplified with primers P7 and P8 and ABP-280 with
primers 9 and 10 were used as positive controls for reverse
transcriptase (RT)-PCR and a rough estimate of cDNA template.
Oligonucleotides.
Oligonucleotides and their sequences were as follows: P1,
GAAATGCCCTTTGACCCCTCTAAAG; P2, CTGGTCCAAAGACTTTGATCCTGCTG; P3,
GTGCGCTTCGGTGGTGTTGATA; P4, CACAATCTCAGGTGTGGCTGT; P5,
TGAAGGTCGGAGTCAACGGATTTGGT; P6, CATGTGGGCCATGAGGTCCACCAC; P7, TGAAGGTCGGAGTCAACGGATTTGGT; P8, CATGTGGGCCATGAGGTCCACCAC; P9, GGCAAAGTGACGTGCACCGTGTGC; P10,
CTGTGATCTCGCCCTTCTTGATGGTG.
| |
RESULTS |
Cloning of an ABP homologue of ABP-280.
The yeast two-hybrid system, developed originally by Fields et
al,27 is a genetic assay to detect specific protein-protein interactions in vivo and to isolate novel genes encoding proteins that
associate with a known protein of interest. To identify the protein(s)
interacting with the intracellular domain of platelet GPIb,
nucleotides coding for His515-Leu610 were cloned into a vector to form
a fusion protein with the GAL4 DNA binding domain (GPIb/PAS2-1). The
human erythroleukemia cell line K562, which exhibits megakaryocytic
characteristics, has been shown to express several subunits of platelet
surface glycoproteins including GPIb, GPIIb, and
GPIIIa.28 Thus, it seemed likely that the same cell line
would express protein(s) that interact with the intracellular domains
of these platelet receptors. Accordingly, a K562 cDNA library,
consisting of about one million clones, was screened by the yeast
two-hybrid method. Four colonies showed histidine prototrophy and one
of the four had -galactosidase reporter activity. The recovered
plasmid from this single isolate conferred His+ prototrophy
and expression of -galactosidase only in the presence of
GPIb/PAS2-1. Characterization and sequencing of the insert (K1.3,
Fig 1) showed a cDNA fragment of 1.3 kb in length
encoding a peptide that was 74% identical to the human ABP-280
isolated from endothelial cells.17
View larger version (13K):
[in this window]
[in a new window]
| Fig 1.
cDNA clones that span the full-length actin-binding
protein homologue sequence. Clone K1.3 was isolated by the yeast
two-hybrid screening, clones 1-4 were obtained by rapid amplification
of 5 cDNA ends (5 RACE), and clones 5 and 6 were the cDNA
clones isolated from a human placenta library. The diagram shows an
alignment of the ABP cDNA with characteristic functional domains of the ABP subunit. The asterisk indicates the position of the 24 amino acid
Hinge I insertion in ABP-278.
|
|
By use of the 5 rapid amplification of cDNA ends
(RACE) technique with several marathon cDNA libraries
(Clontech), sequences extending to 3.8 kb were obtained (clones 1-4, Fig 1). Sequences from the immediate 5 end of clone 4 were then
used to screen a subdivided placenta cDNA library by PCR (primers P1
and P2) and colony hybridization. Two positive clones (clones 5 and 6, Fig 1) were identified, isolated, and sequenced. Clone 6 was an apparent full-length cDNA, with an open reading frame encoding a
protein of 2,578 amino acids. Clone 5 was a partial cDNA that lacked
2,936 bp at the 5 end. Clone 5 also differed from clone 6 in
having an internal insertion of 72 bp, which coded for 24 additional
amino acids. This insertion was also present in the partial cDNA clone
2 and was an alternatively spliced isoform (see below). The composite
sequence with the 72-bp insertion is shown in
Fig 2, in which the 72-bp insertion is
highlighted by a double underline.
View larger version (121K):
[in this window]
[in a new window]
View larger version (116K):
[in this window]
[in a new window]
| Fig 2.
The nucleotide and predicted amino acid sequence of
ABP-276 and ABP-278. The upstream in-frame stop codon (TAG) is
underlined. The 24 amino acid Hinge I insertion in ABP-278 is
double-underlined. These data are available from GenBank under the
accession number AF043045.
|
|
The composite cDNA was 9,473 bp in length and contained an open reading
frame of 7,809 nucleotides (nucleotides 166-7974, Fig 2), encoding a
protein of 2,602 amino acids with a calculated molecular weight of 278 kD. Clone 6, which did not contain the 72-bp insertion, encoded a
protein with a calculated molecular weight of 276 kD. The putative
translation initiation site at nucleotide 166 was preceded by an
upstream in-frame stop codon, and was flanked by sequences that
conformed to the Kozak consensus sequence.29 The 3
untranslated region (7975-9473) contained a single polyadenylation
site. The predicted amino acid sequence was 70% identical to human
endothelial ABP-28017 and 83% identical to chicken
filamin.30 Accordingly, the encoded protein was a homologue
of ABP-280. Clone 6, which coded for the short form, was designated as
ABP-276, while the isoform with the 72-bp (24 amino acids) insertion
was designated as ABP-278. Both isoforms contained an apparent
N-terminal actin-binding domain of 248 amino acids followed by a series
of 24 repeats, each about 96 amino acids in length and homologous to
those found in human ABP-280. The apparent actin-binding domain also
shared substantial similarity with the actin binding domains in chicken
filamin,30 and Dictyostelium gelation
factor,31 as well as -actinins,32,33 spectrins,34,35 and dystrophins36,37
(Fig 3). This domain may be derived from
gene duplication and exon shuffling. The actin binding domain in both
isoforms was followed by 24 repeats (Fig 4), which interact in a
staggered interlocking manner to form a backbone with mechanical
resilience. Although endothelial ABP-280 contains two hinge regions,
ABP-276, analogous to chicken filamin, lacks a Hinge I region. The 24 amino acid insertion in ABP-278 was located between repeats 15 and 16 and formed an alternative Hinge I sequence. This hinge sequence bore no
sequence similarity to the 32 amino acid Hinge I sequence in ABP-280.
The Hinge II region, which plays a role in the dimerization of ABP-280,
was present in both isoforms ABP-276 and ABP-278, although its sequence was considerably less conserved (43% identity with ABP-280). It is of
interest to note that the initial clone K1.3 identified by the yeast
two-hybrid technique encoded the region encompassing repeats 20 to 24. This suggests that the binding site on ABP-278 or ABP-276 for GPIb
is located in this region.
View larger version (99K):
[in this window]
[in a new window]
| Fig 3.
Comparison of ABP-278 and ABP-276 amino terminal 248 amino acids with the actin-binding domains of other ABPs. Amino acids conserved in five or more members of the group are
highlighted in bold. The group of ABPs includes: human
-spectrin (HSpec),34 Drosophila
spectrin (DrSpec),35 human dystrophin
(HDys),37 chicken dystrophin
(CDys),36 chicken -actinin
(CAct),32 Dictyostelium -actinin
(DAct),33 Dictyostelium gelation factor
(DGF),31 human ABP-280,17
chicken filamin protein (MCFil),47 and human ABP homologues ABP-276 and ABP-278.
|
|
ABP-276 and ABP-278 were formed by alternative RNA splicing.
In ABP-280, the 32 amino acid Hinge I region was encoded by a single
exon.20 Because the primary structure of ABP-280 and ABP-278 are highly homologous, it seemed likely that the deletion of
the Hinge I region in ABP-276 was due to alternative RNA splicing. To
investigate the mechanism for the presence or absence of the Hinge I
region in the two isoforms, human genomic sequences encompassing the
Hinge I region and partial sequences of the flanking repeats, namely
repeats 15 and 16, were amplified by PCR and sequenced (Fig
5). These data confirmed that the 24 amino acid Hinge
I region of ABP-278 was encoded by a single exon of 72 bp. The lengths of intron sequences before and after this exon were about 3 kb and 1 kb, respectively, and were significantly longer than those in ABP-280
(113 bp and 134 bp)38 (Fig 5A). The exon-intron junctions showed the invariant GT-AG dinucleotides (Fig 5C). The genomic structure clearly indicated that alternative RNA splicing lead to the
formation of ABP-278 and ABP-276 (Fig 5B).
View larger version (71K):
[in this window]
[in a new window]
| Fig 4.
Alignment of the 24 internal repeats in the ABP-276 and
ABP-278 backbone. Alignment of amino acid residues 249-2602 of ABP-278 are shown. The 24 amino acid Hinge I sequence of ABP-278 was inserted between repeats 15 and 16; a 34 amino acid Hinge II sequence of both
ABP-276 and ABP-278 was inserted between repeats 23 and 24. A consensus
sequence for the repeating unit in ABP-278, derived from residues
common to at least 10 of the repeats is listed at the bottom, together
with a similar consensus sequence from ABP-28017 and
chicken filamin (MCFil).47
|
|
View larger version (22K):
[in this window]
[in a new window]
| Fig 5.
Alternative splicing of the Hinge I region. (A) Schematic
representation of the genomic structure encoding the Hinge I region and
the PCR products amplified with specific primers P3, P4, P5, and P6.
The genomic sequences encoding the Hinge I region and partial sequences
of adjacent repeats 15 and 16 are boxed. Intron sequences are
represented by dashed lines. The PCR primers specific for ABP-278 (P3,
P4, P5, and P6) are labeled. The position of exon-intron junctions are
indicated by vertical arrows and numbered. (B) Diagram of the formation
of ABP-278 and its isoform ABP-276 by alternative RNA splicing. (C)
Partial sequences of exon-intron junctions as numbered in (A). Splice
juntions are indicated by slash. The consensus donor (gt) and acceptor
(ag) dinucleotides are underlined.
|
|
Tissue distribution of ABP-276 and ABP-278.
Distribution of the two isoforms in various human tissues was assessed
by RT-PCR with various human cDNA libraries as templates using primers
that flank the Hinge I region. With these primers, amplification of
ABP-278 produced a PCR product of 349 bp in length, while amplification
of ABP-276 produced a product of 277 bp
(Fig 6). The PCR products were separated
according to size by electrophoresis in a 1.5% agarose gel. As shown
in Fig 6, cDNAs from prostate, uterus, lung, liver, thyroid, stomach,
lymph node, small intestine, and spleen contained predominantly the
ABP-278 isoform, while Daudi cells and spinal cord contained
predominantly the ABP-276 isoform. The placenta, bone marrow, brain,
umbilical vein endothelial cells (HUVEC), retina, and skeletal muscle
contained appreciable or detectable levels of both forms. ABP-280 was
present in all tissues and cell types examined (Fig 6) as previously
reported.17 An analysis of mRNA from human platelets by
RT-PCR indicated the presence of predominantly the ABP-276 isoform,
which was about 10-fold less abundant than ABP-280. Little or no
ABP-278 isoform was detectable (M. Ling and E. Davie, unpublished
observation). Although RT-PCR does not provide a quantitative
measurement of mRNA levels, it clearly showed that this homologue to
ABP-280 was expressed in all tissues and the predominant isoform varied in each tissue.
View larger version (66K):
[in this window]
[in a new window]
| Fig 6.
Tissue distribution of ABP-276 and ABP-278 by RT-PCR. PCR
products, amplified with primers P3 and P4 using various marathon cDNAs
(Clontech) as templates, were fractionated on 1.5% agarose gel. The
upper band (349 bp) represents the PCR products of ABP-278, while the
lower band (277 bp) represents the PCR products of ABP-276. The
difference in size is due to the presence and absence of the 72 bp exon
sequence encoding the 24 amino acid Hinge I region. The PCR
amplification of ABP-280 (P9 and P10) and G3PDH (P7 and P8) sequences
were used as controls.
|
|
| |
DISCUSSION |
Human ABP is a ubiquitous dimeric phosphoprotein that binds to and
promotes orthogonal branching of actin filaments. By associating with
the intracellular domain of the GPIb subunit of the GPIb-IX-V complex, it links the cytoskeleton to the platelet membrane. Several studies showed that ABPs consist of a family of closely related homologues and isoforms. Thus, the gene for ABP-280, located on the X
chromosome, is expressed and differentially spliced to give rise to an
isoform with an eight amino acid deletion in repeat 15.20
In the same study, a partial cDNA for an ABP homologue, highly
expressed in skeletal muscle and heart, was also identified. This
homologue lacked a Hinge I region and its gene was mapped to chromosome
7. The homologue identified in this study was different in sequence
from both of these two ABPs and represents a third member of this gene
family. In a preliminary report, Takafuta et al,39 using a
similar approach, isolated and cloned a cDNA coding for a human ABP
homologue from human placenta. This homologue, designated as hFH-1,
appears to be identical to the ABP-278 isoform described in the present
study. Chicken filamin, which showed the highest percent identity with
ABP-276, appeared to be the equivalent orthologue in chicken. A
homologue of chicken filamin, located predominantly at sites of focal
adhesion and in the ends of stress fibers, also has been
identified.40 However, no sequence information has been
presented for this homologue. These results show that several different
homologues and isoforms of ABP exist and suggest that they may have
specialized functions within different cells.
Variations in the function of ABP isoforms may be attributed in part to
variations in the Hinge I region. The Hinge I region of ABP-280, which
consisted of 32 amino acids, was postulated to increase the flexibility
of ABP and facilitate cross-linking of actin filaments into orthogonal
arrays.17 Chicken gizzard filamin, which lacked a Hinge I
region, promoted cross-linking of actin filaments into parallel
bundles.41 The presence of a 24 amino acid Hinge I region
in ABP-278 with no apparent sequence similarity to ABP-280 suggested
that it may have a cytoplasmic localization that was different from
ABP-280 and may cross-link actin filaments into arrays with different
geometric characteristics. Experiments are in progress to determine the
intracellular distribution of the various isoforms of ABPs. The Hinge I
region in ABP-280 also contained a cleavage site for calpain, a
calcium-dependent protease derived from activated platelets.
Phosphorylation of the platelet ABP in situ by cAMP-dependent protein
kinase protected ABP from proteolysis by calpain, and blocked
cytoskeleton reorganization.42 It is unclear if the
homologue ABP-276 or ABP-278 contains a comparable calpain cleavage
site(s) and phosphorylation site and whether phosphorylation modulates
their sensitivity to cleavage by calpain.
Several membrane receptors directly associate with the cytoskeleton and
mediate important functions such as shape changes, focal adhesion,
motility, signaling, and receptor clustering in response to external
ligand binding. This association involves components of the
submembraneous skeleton, which lines the cytoplasmic face of the plasma
membrane, and includes ABPs, short actin filaments, spectrin,
-actinin, as well as myosin and tropomyosin.43,44 The
GPIb-IX-V complex associates with the cytoskeleton through binding to
ABP-280, and may also interact with other homologues and isoforms of
this family, namely ABP-276 and ABP-278, as suggested by this study.
ABP has also been shown to colocalize and directly associate with
several membrane receptors, including the acetycholine receptors in
chicken myoblasts,21 the immunoglobulin receptor FcIR,22 and the CD18 subunit of the 2-integrin in
leukocytes,23 and the thyroid stimulating hormone receptor
(TSH receptor) in endocrine cells.24 In the leukocyte, ABP
directly associates with the intracellular domain of the Fc receptor
FcIR when the receptor is not occupied. The binding of IgG to the
receptor lowers the affinity of ABP for the Fc receptor and initiates
immune defense functions and cell surface changes.42 In
cultured thyroid follicular cells, the binding of thyroid-stimulating
hormone (TSH) to the TSH receptor induces a rapid and striking
reduction in intracellular actin microfilament bundles, accompanied by
a dramatic change in the shape of the cell from a flattened to a
rounded appearance.45 This reorganization of the actin
filaments is apparently mediated in part by association of the
intracellular domain of the TSH receptor with a truncated form of ABP,
which is identical in sequence to the C-terminal region of ABP-276 and
ABP-278, except two single base deletions at nt 7455 and 7922. This
truncated form of ABP-276, encompassing a part of repeat 23 and the
entire repeat 24, contains the dimerization domain and presumably a
region that interacts with the TSH receptor. However, without the
N-terminal actin binding domain, this truncated form of ABP-276 may
compete with the full-length ABP-276 or other members of the ABP family
in binding to the TSH receptor and may modulate association of the
receptor to the cytoskeleton.
Although it has been shown that ABP-280 can interact with the
cytoplasmic tail of GPIb, a recent study in an ABP-280-deficient melanoma cell line showed that insertion of the GPIb-IX complex into
the membrane did not depend on the GPIb cytoplasmic tail or the
GPIb-binding site in ABP-280.46 These results suggested that direct cross-linking of actin filaments or direct interaction with
receptors may not be necessary for ABP-280 to promote receptor insertion into the membrane. The role of ABP-276 and ABP-278 in this
process needs to be further defined and characterized.
ABP-276 and ABP-278, identified in this study, and the truncated form
of ABP-276, identified in thyroid cells, together with ABP-280 and its
differentially spliced isoform, form a family of structurally and
functionally related proteins that may play an important role in
linking specific receptors to actin filaments and the cytoskeleton in
nonmuscle cells such as platelets. The cloning and identification of
these homologues and isoforms makes it possible to further characterize
the cell-type specific function of each member and the role they play
in response to extracellular ligand binding.
| |
FOOTNOTES |
Submitted February 6, 1998;
accepted April 9, 1998.
Supported by Grant No. HL16919 from the National Institutes of Health,
Bethesda, MD.
Address reprint requests to Earl W. Davie, PhD, Department
of Biochemistry, Box 357350, University of Washington, Seattle, WA
98195.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.
| |
ACKNOWLEDGMENT |
The authors are grateful to ZymoGenetics Inc for gifts of HEL cell
library, human placenta library, and various cDNAs of human tissues. We
also thank Wendy Tsien and Jeff Harris for excellent technical
assistance.
| |
REFERENCES |
1.
Berndt MC,
Gregory C,
Zola H,
Fournier D,
Castaldi PA:
Purification and preliminary characterization of the glycoprotein Ib complex in the human platelet membrane.
Eur J Biochem
151:637,
1985[Medline]
[Order article via Infotrieve]
2.
Clemetson KJ:
Platelet GPIb-V-IX complex.
Thromb Haemost
78:266,
1997[Medline]
[Order article via Infotrieve]
3.
Phillips DR,
Agin PP:
Platelet plasma membrane glycoproteins. Evidence for the presence of nonequivalent disulfide bonds using nonreduced-reduced two-dimensional gel electrophoresis.
J Biol Chem
252:2121,
1977[Free Full Text]
4.
Du X,
Beutler L,
Ruan CH,
Castaldi PA,
Berndt MC:
Glycoprotein Ib and glycoprotein IX are fully complexed in the intact platelet membrane.
Blood
69:1524,
1987[Abstract/Free Full Text]
5.
Hickey MJ,
Hagen FS,
Yagi M,
Roth GJ:
Human platelet glycoprotein V: characterization of the polypeptide and the related Ib-V-IX receptor system of adhesive, leucine-rich glycoproteins.
Proc Natl Acad Sci USA
90:8327,
1993[Abstract/Free Full Text]
6.
Gralnick HR,
Williams S,
McKeown LP,
Hansmann K,
Fenton II JW,
Krutzsch H:
Human platelet glycoprotein V: Characterization of the polypeptide and the related Ib-V-IX receptor system of adhesive, leucine-rich glycoproteins.
Proc Natl Acad Sci USA
91:6334,
1994[Abstract/Free Full Text]
7.
Katagiri Y,
Hayashi Y,
Yamamoto K,
Tanoue K,
Kosaki G,
Yamazaki H:
Localization of von Willebrand factor and thrombin-interactive domains on human platelet glycoprotein Ib.
Thromb Haemost
63:122,
1990[Medline]
[Order article via Infotrieve]
8.
Lopez JA:
The platelet glycoprotein Ib-IX complex.
Blood Coagul Fibrinol
5:97,
1994[Medline]
[Order article via Infotrieve]
9.
Kroll MH,
Harris TS,
Moake JL,
Handin RI,
Schafer AI:
von Willebrand factor binding to platelet GpIb initiates signals for platelet activation.
J Clin Invest
88:1568,
1991
10.
Fox JEB:
Linkage of a membrane skeleton to integral membrane glycoproteins in human platelets. Identification of one of the glycoproteins as glycoprotein Ib.
J Clin Invest
76:1673,
1985
11.
Andrews RK,
Fox JEB:
Identification of a region in the cytoplasmic domain of the platelet membrane glycoprotein Ib-IX complex that binds to purified actin-binding protein.
J Biol Chem
267:18605,
1992[Abstract/Free Full Text]
12.
Hartwig JH,
DeSisto M:
The cytoskeleton of the resting human blood platelet: Structure of the membrane skeleton and its attachment to actin filaments.
J Cell Biol
112:407,
1991[Abstract/Free Full Text]
13.
Greco NJ,
Tandon NN,
Jones GD,
Kornhauser R,
Jackson B,
Yamamoto N,
Tanoue K,
Jamieson GA:
Contributions of glycoprotein Ib and the seven transmembrane domain receptor to increases in platelet cytoplasmic [Ca2+] induced by -thrombin.
Biochemistry
35:906,
1996[Medline]
[Order article via Infotrieve]
14.
Fantl WJ,
Muslin AJ,
Kikuchi A,
Martin JA,
MacNicol AM,
Gross RW,
Williams LT:
Activation of Raf-1 by 14-3-3 proteins.
Nature
371:612,
1994[Medline]
[Order article via Infotrieve]
15.
Wardell MR,
Reynolds CC,
Berndt MC,
Wallace RW,
Fox JEB:
Platelet glycoprotein Ib is phosphorylated on serine 166 by cyclic AMP-dependent protein kinase.
J Biol Chem
264:15656,
1989[Abstract/Free Full Text]
16.
Fox JEB,
Berndt MC:
Cyclic AMP-dependent phosphorylation of glycoprotein Ib inhibits collagen-induced polymerization of actin in platelets.
J Biol Chem
264:9520,
1989[Abstract/Free Full Text]
17.
Gorlin JB,
Yamin R,
Egan S,
Stewart M,
Stossel TP,
Kwiatkowski DJ,
Hartwig JH:
Human endothelial actin-binding protein (ABP-280, nonmuscle filamin): A molecular leaf spring.
J Cell Biol
111:1089,
1990[Abstract/Free Full Text]
18.
Weihing RR:
Actin-binding and dimerization domains of HeLa cell filamin.
Biochemistry
27:1865,
1988[Medline]
[Order article via Infotrieve]
19.
Meyer SC,
Zuerbig S,
Cunningham CC,
Hartwig JH,
Bissell T,
Gardner K,
Fox JEB:
Identification of the region in actin-binding protein that binds to the cytoplasmic domain of glycoprotein Ib.
J Biol Chem
272:2914,
1997[Abstract/Free Full Text]
20.
Maestrini E,
Patrosso C,
Mancini M,
Rivella S,
Rocchi M,
Repetto M,
Villa A,
Frattini A,
Zoppe M,
Vezzoni P,
Toniolo D:
Mapping of two genes encoding isoforms of the actin binding protein ABP-280, a dystrophin like protein, to Xq28 and to chromosome 7.
Hum Mol Genet
2:761,
1993[Abstract/Free Full Text]
21.
Shadiack AM,
Nitkin RM:
Agrin induces -actinin, filamin, and vinculin to co-localize with AChR clusters on cultured chick myotubes.
J Neurobiol
22:617,
1991[Medline]
[Order article via Infotrieve]
22.
Ohta Y,
Stossel T,
Hartwig J:
Ligand-sensitive binding of actin-binding protein to immunoglobulin G Fc receptor I (FcRI).
Cell
67:275,
1991[Medline]
[Order article via Infotrieve]
23.
Sharma CP,
Ezzell RM,
Arnaout MA:
Direct interaction of filamin (ABP-280) with the 2-integrin subunit CD18.
J Immunol
154:3461,
1995[Abstract]
24.
Leedman PJ,
Faulkner-Jones B,
Cram DS,
Harrison PJ,
West J,
O'Brien E,
Simpson R,
Coppel RL,
Harrison LC:
Cloning from the thyroid of a protein related to actin binding protein that is recognized by Graves disease immunoglobulins.
Proc Natl Acad Sci USA
90:5994,
1993[Abstract/Free Full Text]
25.
Lopez JA,
Chung DW,
Fujikawa K,
Hagen FS,
Papayannopoulou T,
Roth GJ:
Cloning of the alpha chain of human platelet glycoprotein Ib: A transmembrane protein with homology to leucine-rich 2-glycoprotein.
Proc Natl Acad Sci USA
84:5615,
1987[Abstract/Free Full Text]
26.
Sanger F,
Nicklen S,
Coulson AR:
DNA sequencing with chain-terminating inhibitors.
Proc Natl Acad Sci USA
74:5463,
1977[Abstract/Free Full Text]
27.
Fields S,
Song O:
A novel genetic system to detect protein-protein interactions.
Nature
340:245,
1989[Medline]
[Order article via Infotrieve]
28.
Yasunaga M,
Ryo R,
Sugano W,
Yamaguchi N:
Detection of platelet-specific protein mRNAs in different megakaryoblasts using the reverse transcriptase polymerase chain reaction.
Leuk Lymphoma
7:505,
1992[Medline]
[Order article via Infotrieve]
29.
Kozak M:
Compilation and analysis of sequences upstream from the translational start site in eukaryotic mRNAs.
Nucleic Acids Res
12:857,
1984[Abstract/Free Full Text]
30.
Matsudaira P:
Modular organization of actin crosslinking proteins.
Trends Biochem Sci
16:87,
1991[Medline]
[Order article via Infotrieve]
31.
Noegel AA,
Rapp S,
Lottspeich F,
Schleicher M,
Stewart M:
The Dictyostelium gelation factor shares a putative actin binding site with -actinins and dystrophin and also has a rod domain containing six 100-residue motifs that appear to have a cross-beta conformation.
J Cell Biol
109:607,
1989[Abstract/Free Full Text]
32.
Baron MD,
Davison MD,
Jones PA,
Critchley DR:
The sequence of chick -actinin reveals homologies to spectrin and calmodulin.
J Biol Chem
262:17623,
1987[Abstract/Free Full Text]
33.
Noegel A,
Witke W,
Schleicher M:
Calcium-sensitive non-muscle -actinin contains EF-hand structures and highly conserved regions.
FEBS Lett
221:391,
1987[Medline]
[Order article via Infotrieve]
34.
Winkelmann JC,
Chang JG,
Tse WT,
Scarpa AL,
Marchesi VT,
Forget GT:
Full-length sequence of the cDNA for human erythroid -spectrin.
J Biol Chem
265:11827,
1990[Abstract/Free Full Text]
35.
Byers TJ,
Brandin E,
Lue RA,
Winograd E,
Branton D:
The complete sequence of Drosophila -spectrin reveals supra-motifs comprising eight 106-residue segments.
Proc Natl Acad Sci USA
89:6187,
1992[Abstract/Free Full Text]
36.
Lemaire C,
Heilig R,
Mandel JL:
Nucleotide sequence of chicken dystrophin cDNA.
Nucleic Acids Res
16:11815,
1987[Free Full Text]
37.
Koenig M,
Hoffman EP,
Bertelson CJ,
Monaco AP,
Feener C,
Kunkel LM:
Complete cloning of the Duchenne muscular dystrophy (DMD) cDNA and preliminary genomic organization of the DMD gene in normal and affected individuals.
Cell
50:509,
1987[Medline]
[Order article via Infotrieve]
38.
Maestrini E,
Patrosso C,
Mancini M,
Rivella S,
Rocchi M,
Repetto M,
Villa A,
Frattini A,
Zoppe M,
Vezzoni P,
Toniolo D:
The exon-intron organization of the human X-linked gene (FLN1) encoding actin-binding protein 280.
Hum Mol Genet
2:761,
1993
39. (suppl 1, abstr 1278)
Takafuta T,
Wu G,
Shapiro SS:
Human filamin homolog-1, a new protein interacting with the cytoplasmic tail of glycoprotein Ib.
Blood
90:290a,
1997
40.
Pavalko FM,
Otey CA,
Burridge KJ:
Identification of a filamin isoform enriched at the ends of stress fibers in chicken embryo fibroblasts.
Cell Sci
94:109,
1989[Abstract/Free Full Text]
41.
Cortese JD,
Frieden C:
Microheterogeneity of actin gels formed under controlled linear shear.
J Cell Biol
107:1477,
1988[Abstract/Free Full Text]
42.
Chen M,
Stracher A:
In situ phosphorylation of platelet actin-binding protein by cAMP-dependent protein kinase stabilizes it against proteolysis by calpain.
J Biol Chem
264:14282,
1989[Abstract/Free Full Text]
43.
Fox JE,
Reynolds CC,
Morrow JS,
Phillips DR:
Spectrin is associated with membrane-bound actin filaments in platelets and is hydrolyzed by the Ca2+-dependent protease during platelet activation.
Blood
69:537,
1987[Abstract/Free Full Text]
44.
Fox JE,
Boyles JK,
Berndt MC,
Steffen PK,
Anderson LK:
Identification of a membrane skeleton in platelets.
J Cell Biol
106:1525,
1988[Abstract/Free Full Text]
45.
Tramontano D,
Avivi A,
Ambesi-Impiombato FS,
Barak L,
Geiger B,
Schlessinger J:
Thyrotropin induces changes in the morphology and the organization of microfilament structures in cultured thyroid cells.
Exp Cell Res
137:269,
1982[Medline]
[Order article via Infotrieve]
46.
Meyer SC,
Sanan DA,
Fox JEB:
Role of actin-binding protein in insertion of adhesion receptors into the membrane.
J Biol Chem
273:3013,
1998[Abstract/Free Full Text]
47.
Barry CP,
Xie J,
Lemmon V,
Young AP:
Molecular characterization of a multi-promoter gene encoding a chicken filamin protein.
J Biol Chem
268:25577,
1993[Abstract/Free Full Text]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
X. Zhou, F. Tian, J. Sandzen, R. Cao, E. Flaberg, L. Szekely, Y. Cao, C. Ohlsson, M. O. Bergo, J. Boren, et al.
Filamin B deficiency in mice results in skeletal malformations and impaired microvascular development
PNAS,
March 6, 2007;
104(10):
3919 - 3924.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. S Bicknell, C. Farrington-Rock, Y. Shafeghati, P. Rump, Y. Alanay, Y. Alembik, N. Al-Madani, H. Firth, M. H. Karimi-Nejad, C. A. Kim, et al.
A molecular and clinical study of Larsen syndrome caused by mutations in FLNB
J. Med. Genet.,
February 1, 2007;
44(2):
89 - 98.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F. Nakamura, R. Pudas, O. Heikkinen, P. Permi, I. Kilpelainen, A. D. Munday, J. H. Hartwig, T. P. Stossel, and J. Ylanne
The structure of the GPIb-filamin A complex
Blood,
March 1, 2006;
107(5):
1925 - 1932.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Gontier, A. Taivainen, L. Fontao, A. Sonnenberg, A. van der Flier, O. Carpen, G. Faulkner, and L. Borradori
The Z-disc proteins myotilin and FATZ-1 interact with each other and are connected to the sarcolemma via muscle-specific filamins
J. Cell Sci.,
August 15, 2005;
118(16):
3739 - 3749.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
I. Onoprishvili, M. L. Andria, H. K. Kramer, N. Ancevska-Taneva, J. M. Hiller, and E. J. Simon
Interaction Between the {micro} Opioid Receptor and Filamin A Is Involved in Receptor Regulation and Trafficking
Mol. Pharmacol.,
November 1, 2003;
64(5):
1092 - 1100.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. M. Dyson, A. D. Munday, A. M. Kong, R. D. Huysmans, M. Matzaris, M. J. Layton, H. H. Nandurkar, M. C. Berndt, and C. A. Mitchell
SHIP-2 forms a tetrameric complex with filamin, actin, and GPIb-IX-V: localization of SHIP-2 to the activated platelet actin cytoskeleton
Blood,
August 1, 2003;
102(3):
940 - 948.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. van der Flier, I. Kuikman, D. Kramer, D. Geerts, M. Kreft, T. Takafuta, S. S. Shapiro, and A. Sonnenberg
Different splice variants of filamin-B affect myogenesis, subcellular distribution, and determine binding to integrin {beta} subunits
J. Cell Biol.,
January 21, 2002;
156(2):
361 - 376.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. M. Dyson, C. J. O'Malley, J. Becanovic, A. D. Munday, M. C. Berndt, I. D. Coghill, H. H. Nandurkar, L. M. Ooms, and C. A. Mitchell
The SH2-containing inositol polyphosphate 5-phosphatase, SHIP-2, binds filamin and regulates submembraneous actin
J. Cell Biol.,
December 10, 2001;
155(6):
1065 - 1080.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. F.M. van der Ven, S. Wiesner, P. Salmikangas, D. Auerbach, M. Himmel, S. Kempa, K. Haye{beta}, D. Pacholsky, A. Taivainen, R. Schroder, et al.
Indications for a Novel Muscular Dystrophy Pathway: {gamma}-Filamin, the Muscle-specific Filamin Isoform, Interacts with Myotilin
J. Cell Biol.,
October 9, 2000;
151(2):
235 - 248.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. M. Ozanne, M. E. Brady, S. Cook, L. Gaughan, D. E. Neal, and C. N. Robson
Androgen Receptor Nuclear Translocation Is Facilitated by the f-Actin Cross-Linking Protein Filamin
Mol. Endocrinol.,
October 1, 2000;
14(10):
1618 - 1626.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
S. Krief, J.-F. Faivre, P. Robert, B. Le Douarin, N. Brument-Larignon, I. Lefrere, M. M. Bouzyk, K. M. Anderson, L. D. Greller, F. L. Tobin, et al.
Identification and Characterization of cvHsp. A NOVEL HUMAN SMALL STRESS PROTEIN SELECTIVELY EXPRESSED IN CARDIOVASCULAR AND INSULIN-SENSITIVE TISSUES
J. Biol. Chem.,
December 17, 1999;
274(51):
36592 - 36600.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
V. Ramakrishnan, P. S. Reeves, F. DeGuzman, U. Deshpande, K. Ministri-Madrid, R. B. DuBridge, and D. R. Phillips
Increased thrombin responsiveness in platelets from mice lacking glycoprotein V
PNAS,
November 9, 1999;
96(23):
13336 - 13341.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M.-g. Li, M. Serr, K. Edwards, S. Ludmann, D. Yamamoto, L. G. Tilney, C. M. Field, and T. S. Hays
Filamin Is Required for Ring Canal Assembly and Actin Organization during Drosophila Oogenesis
J. Cell Biol.,
September 6, 1999;
146(5):
1061 - 1074.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Ohta, N. Suzuki, S. Nakamura, J. H. Hartwig, and T. P. Stossel
The small GTPase RalA targets filamin to induce filopodia
PNAS,
March 2, 1999;
96(5):
2122 - 2128.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. van der Flier, I. Kuikman, D. Kramer, D. Geerts, M. Kreft, T. Takafuta, S. S. Shapiro, and A. Sonnenberg
Different splice variants of filamin-B affect myogenesis, subcellular distribution, and determine binding to integrin {beta} subunits
J. Cell Biol.,
January 21, 2002;
156(2):
361 - 376.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Abstract
Introduction
Abstract