|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 92 No. 5 (September 1), 1998:
pp. 1505-1511
RAPID COMMUNICATION
Stromal Expression of Jagged 1 Promotes Colony Formation by Fetal
Hematopoietic Progenitor Cells
By
Philip Jones,
Gill May,
Lyn Healy,
John Brown,
Gerald Hoyne,
Sylvie Delassus, and
Tariq Enver
From the Section of Gene Function and Regulation & Leukaemia Research
Fund Centre, Chester Beatty Laboratories, Institute of Cancer Research,
London; and the Department of Respiratory Medicine, University of
Edinburgh, Edinburgh, UK.
 |
ABSTRACT |
The Notch signaling system regulates proliferation and
differentiation in many tissues. Notch is a transmembrane receptor activated by ligands expressed on adjacent cells. Hematopoietic stem
cells and early progenitors express Notch, making the stromal cells
which form cell-cell contacts with progenitor cells candidate ligand-presenting cells in the hematopoietic microenvironment. Therefore, we examined primary stromal cell cultures for expression of
Notch ligands. Using reverse transcription-polymerase chain reaction,
in situ hybridization, immunohistochemistry, and Western blotting, we
demonstrate expression of Jagged 1 in primary stromal cultures. To
investigate if the stromal expression of Jagged 1 has functional
effects on hematopoietic progenitors, we cultured CD34+,
c-kit+ hematopoietic progenitor cells derived
from the aorto gonadal mesonephros region of day 11 mouse embryos on
the Jagged 1 stromal cell line S17 and on S17 cells
engineered to express Jagged 1. The presence of Jagged 1 increased the
number of colonies formed in subsequent methylcellulose culture
fourfold. Larger increases in colony numbers were observed under the
same culture conditions with CD34+,
c-kit+ hematopoietic progenitor cells derived
from d11 fetal liver. These results obtained in vitro table Jagged 1 as
a candidate regulator of stem cell fate in the context of stromal
microenvironments in vivo.
© 1998 by The American Society of Hematology.
| |
INTRODUCTION |
THE NOTCH SIGNALING SYSTEM is highly
conserved from Drosophila to vertebrates and regulates cell
differentiation and proliferation during development and in
proliferating adult tissues.1 The Notch receptor is a
transmembrane glycoprotein that binds to ligands expressed on adjoining
cells. Once ligand is bound, signal transduction takes place, resulting
in the transcription of nuclear target genes, including transcription
factors. The net effect of Notch activation is that the cell becomes
refractory to differentiation signals. This effect is transient and
reversible; once Notch activation ceases the cell is able to
differentiate.2
Four different Notch genes have been identified in mice and humans, two
of which are known to be expressed in the hematopoietic system.3-7 Notch 1 has been shown to be expressed in
CD34+ lineage-negative hematopoietic stem cells in
humans.8 Expression has also been found in
CD34+ early progenitor cells expressing lineage
markers,8 in the spleen, on thymic T cells and peripheral
blood lymphocytes, and in a B-cell lymphoma line,
FL18.3,4,9 Notch 2 is expressed in the spleen of adult mice
and a limited analysis of hematopoietic cell lines has shown expression
in the multilineage hematopoietic progenitor cell line FDCP-mix A4, and
the myeloid progenitor cell line 32D.7,10
Dysregulation of the balance between self-renewal and differentiation
in hematopoiesis is an essential feature of leukemogenesis. In adult
T-cell lymphoblastic leukemia a t(7;9)(q34;q34.3) chromosomal translocation has been found to result in the expression of a truncated
Notch 1 comprising the transmembrane and cytoplasmic domains. Similar
Notch 1 mutations have been found in transgenic mice that develop
spontaneous T-cell lymphoma,11 and feline leukemia virus
isolates from thymic lymphomas in cats contain truncated Notch
2.12 Such truncated Notch mutants (Nintra) have
been shown to be dominant activators of Notch signaling in
Drosophila and Caenorhabditis elegans.13
The introduction of Nintra into hematopoietic progenitors
results in T-cell lymphoma when the cells are engrafted into lethally
irradiated mice14 and expression of Nintra in T
cells in transgenic mice results in altered T-cell
differentiation.15,16 The effects of Nintra are
not confined to T cells; it is also able to block
cytokine-induced differentiation when introduced into the 32D myeloid
progenitor cell line in vitro, with constitutively active Notch 1 and
Notch 2 blocking differentiation in response to granulocyte
colony-stimulating factor (G-CSF) and granulocyte-macrophage (GM)-CSF,
respectively (ref 10 and references therein).
The role of Notch signaling in regulating the differentiation of normal
hematopoietic stem cells and early progenitors remains unclear. The
regulation of Notch activation in vivo is at least in part achieved by
restricted expression of Notch ligand.1 The ligands
described in mouse and human are Delta 1, highly homologous to
Drosophila Delta, and Jagged 1 and 2, the homologues of
Drosophila Serrate.17-19 These transmembrane
proteins have different patterns of expression in development and in
adult tissues. Although many cells in a tissue may express Notch, only
those adjoining cells expressing Notch ligand show activated Notch
signaling.20,21
Hematopoietic stem cells and progenitors form cell-cell contacts with
bone marrow (BM) stromal cells in vivo.22,23 In vitro such
contacts appear essential for the maintenance of long-term BM
cultures.24 Expression of ligand in stromal cells may
provide one means of activation of the Notch receptor in the progenitor cell populations that are associated with stromal cells. Therefore, we
examined the expression of Notch ligands in normal murine BM stromal
cultures. We found Jagged 1 was expressed in murine stroma and went on
to investigate if stromal expression of Jagged 1 is able to modulate
the functional output of murine fetal hematopoietic progenitor cells in
vitro.
| |
MATERIALS AND METHODS |
Cell culture.
Mouse femoral BM was obtained from 6- to 8-week-old C57/Bl6 mice and
cultured for 6 to 8 weeks in  -minimal essential medium (GIBCO-BRL,
Paisley UK) supplemented with 10% fetal bovine serum (FBS; GIBCO),
10% horse serum (TCS, Buckingham, UK), and 107
mol/L hydrocortisone (Sigma, Poole, Dorset, UK).25 Cultures were maintained until no hematopoietic colonies were visible on examination with phase microscopy. Stromal cell lines PA6 and S1726,27 were cultured in -minimal essential
medium supplemented with 20% FBS. Cells were grown in a
humidified 5% CO2 incubator at 37°C.
Antibodies and probes.
cDNA probes for Jagged 1 and Delta 1 cloned into Bluescript were a gift
from Domingos Henrique and David Ish-Horowicz (Imperial Cancer Research
Fund, London, UK). For immunohistochemistry, rat polyclonal antiserum
raised against the cytoplasmic tail of human Jagged 1 (kind gift of
Spyros Artavanis Tsakonas, Bayer Center for Molecular Medicine, Yale
University, New Haven, CT) was used at a dilution of 1:50. A cocktail
of rat IgG1, IgG2, and IgM immunoglobulins (Serotec, Kidlington,
Oxford, UK) was used as a negative control at a concentration of 5 µg/mL. Biotinylated anti-rat IgG (Vector, Peterborough, UK) was used
as a second layer antibody at a concentration of 5 µg/mL. For Western
blotting a goat polyclonal antibody raised against amino acids
1200-1219 of the carboxy terminus of rat Jagged 1 was used at a
concentration of 0.5 µg/mL (Santa Cruz Biotechnology, Autogen
Bioclear UK, Carne, Wiltshire, UK); horseradish peroxidase-conjugated anti-goat secondary antibody was used at a concentration of 0.08 µg/mL (Santa Cruz).
Polymerase chain reaction (PCR) primers.
The forward and reverse primers used for PCR were as follows: Delta 1, CTGAGGTGTAAGATGGAAGCG and CAACTGTCCATAGTGCAATGG; Jagged 1, TGCAGCTGTCAATCACTTCG and CAGAATGACGCTTCCTGTCG; Jagged 2, AGAAGACTGCAACAGCTGCC and AACAGACCTGTGGAAGAGCC;  actin
TGTATGCCTCTGGTCGTACC and CAACGTCACACTTCATGATGG. Primers for mouse actin and mouse Delta 1 were designed from Genbank sequences to amplify
bases 505 to 942 and 2172 to 2416, respectively. The mouse Jagged 1 primers were obtained by sequencing the partial cDNA fragment of mouse
Jagged 1. The product corresponds to bases 1761 to 2122 of the rat
sequence. Primers for Jagged 2 were designed to amplify bases 2523 to
3119 of the published rat sequence (U70050); the mouse PCR product
displayed over 90% sequence identity with the corresponding region of
rat Jagged 2.
Reverse transcription (RT)-PCR.
Total RNA was isolated using an RNeasy kit (Qiagen, Crawley, West
Sussex, UK), incubated with DNAse I (Boehringer Mannheim, Lewes, East Sussex, UK), and reverse transcribed using AMV
reverse transcriptase (Boehringer Mannheim) with an oligo dT primer. As a positive control, cDNA was also prepared from polyA RNA from a day
13.5 mouse embryo (gift from A Zelent, Institute of Cancer Research,
London, UK). cDNA from 100 ng of total RNA or 10 ng polyA embryo RNA
was amplified through 37 cycles comprising 94°C, for 20 seconds,
60°C for 30 seconds, and 72°C for 90 seconds in Perkin Elmer
PCR buffer II with 2.0 mmol/L added MgCl2, with Amplitaq Gold DNA polymerase (Perkin Elmer, Warrington, UK), on a GeneAmp 9600 or 9700 thermal cycler (Perkin Elmer). Products were analyzed by
electrophoresis through 2% agarose gels with ethidium bromide. Representative samples of each PCR product were gel purified using a
Qiaquick gel isolation kit (Qiagen) and then direct sequenced using the
appropriate PCR primer and an Amplitaq FS DNA sequencing kit (Perkin
Elmer). Sequences were identified using Blastn searches at the National
Center for Biotechnology Information (NCBI) database and
in all cases corresponded with the predicted product.
In situ hybridization.
Radioactive in situ hybridization was performed essentially as
described.28 Briefly, mouse stromal cells were cultured on glass slides (Lab-Tek TC; Nunc, Paisley, UK) as described above, until
no hematopoietic colonies remained as assessed by phase microscopy.
Cells were washed in phosphate-buffered saline (PBS), fixed in acetone,
air dried, and stored at  70°C. Before hybridization, cells
were fixed in 4% paraformaldehyde in PBS for 2 minutes at room
temperature, washed in PBS, treated with 1 µg/mL proteinase K for 10 minutes at 37°C, acetylated, washed twice in 1× sodium citrate buffer (SSC), dehydrated through graded alcohols, and air
dried.
Sense and antisense probes for Delta 1, Serrate 1, and actin,
labeled with [35S] CTP (800 Ci/mmol/L; Amersham
International, Amersham, Bucks, UK) were synthesized using
a Maxiscript T3/T7 Kit (Ambion; AMS Biotechnology, Witney, Oxon, UK).
Probes were dissolved in hybridization buffer at 3 × 104 counts per minute; hybridization buffer consisted of
1× salts (0.3 mol/L NaCl, 0.02 mol/L Tris pH 6.8, 5 mmol/L EDTA,
1 mmol/L sodium phosphate buffer pH 6.8, and 1× Denhardt's
solution [Sigma]), 10% dextran sulfate (Sigma), 50% deionized
formamide (Sigma), 20 mmol/L dithiothreitol (DTT; IBI Kodak Ltd,
Cambridge, UK), and 500 µg/mL yeast tRNA (Boehringer Mannheim).
Twenty microliters of probe solution was applied to each slide and
allowed to hybridize overnight at 55°C. Slides were washed with
1× salts, 50% formamide, 10 mmol/L DTT for 15 minutes and then 1 hour at 55°C, treated with 20 µg/mL RNAse A (Sigma) in 0.5 mol/L
sodium chloride, 10 mmol/L Tris pH 7.5, 5 mmol/L EDTA for 30 minutes at
37°C, washed twice in 2× SSC at room temperature for 15 minutes per wash, once in 0.2× SSC at 50°C for 15 minutes,
and then washed in 3 L of 0.2× SSC for 30 minutes at room
temperature. After dehydration through graded alcohols containing 0.3 mol/L ammonium acetate, slides were dipped in emulsion (LM-1; Amersham)
and then exposed for 2 to 3 weeks at 4°C. After development slides
were stained with nuclear fast red (Vector).
Immunohistochemistry.
Cultured stromal cells were detached from the culture dish using cell
dissociation buffer (Sigma), washed in PBS, resuspended in -medium
with 10% FBS, and then plated onto superfrost plus slides (BDH)
previously coated with rat tail type I collagen (Sigma) by incubating
the slides for 2 hours at 37°C with a 100 µg/mL solution of
collagen type I in PBS. Cells were allowed to adhere for 6 hours at
37°C. Nonadherent cells were removed by washing with PBS. After
fixation in 1% paraformaldehyde (Sigma) at room temperature for 10 minutes, slides were washed in PBS, incubated with 0.1% Triton X-100
(Sigma) in PBS for 10 minutes at room temperature, washed in PBS,
incubated for 30 minutes at room temperature with PBS containing 0.1%
hydrogen peroxide, washed in PBS, and incubated for 1 hour at room
temperature with PBS containing 5% heat-inactivated sheep serum
(PBS-HS). Cells were incubated overnight at 4°C with primary
antibody diluted in PBS-HS, washed three times for 10 minutes each in
PBS, incubated with secondary antibody diluted in PBS-HS for 1 hour at
room temperature, and washed as before. Slides were developed using a
Vector Stain ABC Elite kit with diaminobenzidine according to the
manufacturer's instructions. Slides were counterstained with
hematoxylin.
Western blotting.
Cultured mouse stromal cells were boiled in sample buffer (10%
glycerol, 1% sodium dodecyl sulfate [SDS], 5% -mercaptoethanol, 50 mmol/L Tris pH 6.8), and electrophoresed through a 3% to 12% gradient SDS gel and transferred to Immobilon-P membrane (Millipore). The blot was then blocked with 5% milk in Tris-buffered saline containing 0.1% Tween 20 (TBS-T) for 2 hours at room temperature, incubated with primary anti-Jagged 1 antibody overnight at 4°C overnight, washed five times in TBS-T, incubated with secondary antibody for 1 hour at room temperature, washed five times in TBS-T,
and visualized with an ECL or an ECL Plus kit (Amersham International)
using Biomax MR film (Kodak).
Introduction of Jagged 1 into 3T3 and S17 cells.
Full-length human Jagged 1 cDNA in pBluescript (a gift from Spyros
Artavanis Tsakonas, Bayer Center for Molecular Medicine, Yale
University, New Haven, CT) was released by digestion with Not 1 and EcoR1 and inserted into the retroviral vector p50-M-X-neo (gift of J. Hanneman, Institute of Cancer Research). S17
and NIH 3T3 cells were stably transfected with this construct as
follows. Cells were trypsinized, pelleted, and 107 cells
resuspended in 0.4-mL culture medium. Cells were then incubated with 40 µg linearized DNA for 10 minutes at room temperature, electroporated
at 260 V, 960 µF using a Biorad Gene Pulser (pulse time 27 ms)
transferred into 30 mL culture media and split between three 9-cm
dishes. After 20 hours the medium was replaced with fresh medium
containing 1 mg/mL Geneticin (GIBCO-BRL). After 10 days' culture, each
plate contained 50 to 100 colonies. Plates were maintained
independently to provide three pools of stably transfected cells.
Expression of Jagged 1 was confirmed by Western blot as described
above.
Sorting and culture of murine fetal hematopoietic progenitors.
Single-cell suspensions were prepared from aorto gonadal mesonephros
(AGM) and fetal liver, dissected from day 11 postcoitum CBA × C57/BL10 embryos, stained for c-kit and
CD34 and CD34+, c-kit+ cells sorted
using a FACStar cell sorter (Beckton Dickinson). Fifty cells per well
were plated onto irradiated stromal layers comprising either
untransfected S17 cells or S17 cells transfected with Jagged 1 (pool
1). After 1 week of culture in the presence of interleukin-7 (IL-7),
c-kit ligand, and 2-mercaptoethanol as previously
described,29 all cells from each well were counted and
passaged into three methlyl cellulose cultures (methocult M3430; Stem
Cell Technologies Inc, Northampton, UK). The morphology and number of
colonies comprising more than 50 cells was scored at 1, 2, 3, and 4 weeks.
| |
RESULTS |
Expression of Notch ligands in primary murine stromal cell cultures.
We began our study by examining Notch ligand expression in cultures of
mouse primary stromal cells. Mouse femoral BM from 6- to 8-week-old
mice was cultured for 6 to 8 weeks until no hematopoietic colonies were
visible on examination with phase microscopy. Two independent stromal
cultures were analyzed for expression of the Notch ligands Delta 1, Jagged 1, and Jagged 2 by RT-PCR, using conditions similar to those
previously described for the analysis of Notch ligand
expression.17 We used day 13.5 mouse embryo cDNA in which
all three ligands are known to be expressedas a positive control, and
the identity of all PCR products was confirmed by sequencing. Delta 1 and Jagged 1 mRNAs were detectable by RT-PCR in both stromal cultures,
one of which is shown in Fig 1 (top panel).
Trace levels of Jagged 2 were also detected in this culture (Fig 1) but
absent from the other (not shown). The presence of Jagged 2 may
therefore be due to contamination with hematopoietic cells because
Jagged 2 is readily detectable in a variety of immunopurified myeloid
and erythroid cells (P. Jones, unpublished observations, July
1997).
View larger version (36K):
[in this window]
[in a new window]
| Fig 1.
Expression of Notch ligands in primary mouse stromal cell
cultures. RT-PCR analysis of Delta 1 (D1), Jagged 1 (J1), and Jagged 2 (J2) mRNAs in primary murine stromal cell culture. RT-PCR was performed
on cultures that contained no visible hematopoietic elements (top
panel) and on day 13.5 mouse embryo RNA (bottom panel), with (+) or
without () reverse transcription. Products were analyzed on a 2%
agarose gel. Lane M contains a pBR322 HaeIII marker (Sigma),
the visible fragment sizes are 587, 540, 504, 458, 434, 267, 234, 213, 192, and 184 bp. All RT-PCR products were of the predicted size and
their identity was further confirmed by sequencing.
|
|
We next used radioactive in situ hybridization to gain an appreciation
of the level and cellular distribution of Jagged 1 and Delta 1 expression in the primary stromal cell cultures. With an antisense
Jagged 1 probe, there was a clear increase in grain deposition over the
majority of cells (Fig 2C) whereas a sense (control) probe gave no such increase (Fig 2B). An antisense actin
probe provides a positive control for the technique (Fig 2A). There was
no difference in the pattern of grain deposition between sense and
antisense probes for Delta 1 (data not shown). Thus, Jagged 1 is
transcribed in the majority of stromal cells in primary culture while
Delta 1 transcription appears to be at a low level or confined to very
few cells in the stromal population.
View larger version (86K):
[in this window]
[in a new window]
| Fig 2.
In situ hybridization for Jagged 1 in mouse stromal cell
cultures. Radioactive in situ hybridization of primary mouse stromal
cell cultures prepared as described in the text. The probe is
visualized by grain deposition in the emulsion layer overlying the
cells, which have been counterstained with nuclear fast red. (A)
Positive control anti-sense actin probe, 1 week exposure. Grain
deposition over cells in excess of background indicates RNA is intact.
(B) Negative control, sense Jagged 1 probe, 3-week exposure. Grain
deposition over cells is not increased over background, indicating no
nonspecific hybridization of control probe. (C) Experimental sample,
Jagged 1 anti-sense probe, 3-week exposure. Grain deposition over cells
indicates Jagged 1 RNA is transcribed by the majority of stromal cells.
|
|
Finally, we investigated whether Jagged 1 mRNA was translated into
protein in primary cultures of stromal cells. Immunohistochemistry using a polyclonal antibody raised against the cytoplasmic domain of
human Jagged 1 gave staining clearly in excess of control in stromal
cells (Fig 3A and B). However, because such
staining may be partially caused by binding of epitopes in proteins
other than Jagged 1, we confirmed Jagged 1 protein expression in
extracts of mouse stromal cultures by Western blotting using a second
polyclonal anti-Jagged 1 antibody. A single band was seen running at
the predicted molecular weight for Jagged 1 of 170 kD (Fig 3C).
View larger version (55K):
[in this window]
[in a new window]
| Fig 3.
Expression of Jagged 1 protein in cultured mouse stromal
cells. (A and B) Cultured primary mouse stromal cells were allowed to
adhere to slides coated with type I collagen and then stained
immunohistochemically with a rat anti-Jagged 1 polyclonal antiserum
(A) or with control anti-rat Ig (B). Antibody binding was visualized by
staining with diaminobenzidine, and the cells were counterstained with
hematoxylin. (C) Western blot of cultured primary mouse stromal cell
extract, which was separated on a 3% to 12% gradient
SDS-polyacrylamide gel electrophoresis under reducing conditions,
transferred, and probed with a goat anti-Jagged 1 antibody. The
lefthand column shows the position of molecular weight markers
(Amersham); the figures are molecular weights in kilodaltons. The
single band detected at approximately 170 to 180 kD corresponds to
Jagged 1.
|
|
In summary, of the three Notch ligands examined, Jagged 1 is the major
ligand expressed in primary stromal cells in culture as assessed by
RT-PCR, in situ hybridization, immunohistochemistry, and Western
blotting.
Functional effects of stromal Jagged 1 expression on murine fetal
hematopoietic progenitors.
These results raise the possibility that the Notch receptors expressed
on hematopoietic progenitors bind to Jagged on stromal cells, resulting
in activation of the Notch signal transduction pathway. In other cell
systems, Notch activation results in a transient block to
differentiation and, consistent with this, constitutively active
mutants of Notch are associated with leukemia and able experimentally
to block G-CSF-induced differentiation of granulocytic cell lines (see
introduction). We next performed functional experiments to explore the
possibility that expression of the Notch ligand Jagged 1 on stromal
cells could modulate the behavior of primary hematopoietic progenitor
cells cultured in vitro.
As a source of progenitor cells for our study, we have used
CD34+, c-kit+ cells from the AGM region
of the developing mouse embryo. This population contains the first
detectable stem cells capable of long-term reconstitution of adult
irradiated recipients.30 Consistent with this capacity,
CD34+, c-kit+ AGM cells are
multipotential in vitro (S. Delassus, unpublished observations, April
1997). The in vitro culture system used to support
multilineage differentiation of AGM-derived CD34+,
c-kit+ cells utilizes the stromal cell line S17 as
one of its components.29 S17 do not express Jagged 1 mRNA
as judged by Northern blotting (data not shown); Western blotting
confirmed the absence of Jagged 1 protein expression in S17
(Fig 4A). We exploited the fact that S17
cells do not express Jagged 1 to assess the role of this Notch ligand
in modulating hematopoietic progenitor cell behavior.
View larger version (26K):
[in this window]
[in a new window]
View larger version (20K):
[in this window]
[in a new window]
| Fig 4.
Colony-forming activity of fetal hematopoietic
progenitors. (A) Western blot of cell extracts from the stromal cell
lines PA6 (lefthand lane) and S17 (righthand lane), separated on a 6%
SDS gel under reducing conditions, transferred, and probed with the
same anti-Jagged 1 antibody used in Fig 3. Note that while PA6
expresses Jagged 1, S17 cells do not. (B) Western blot of cell extracts
from three independent pools (lanes 1 through 3) of S17 cells stably
transfected with a human Jagged 1-containing expression vector. (C and
D) Colony production by fetal CD34+,
c-kit+ hematopoietic progenitor cells from d11
AGM (C) or fetal liver (D) after culture for 1 week on irradiated
wild-type or Jagged 1-transfected S17 cells. CD34+,
c-kit+ cells from AGM and fetal liver were sorted
and cultured on irradiated S17 cells or pool 1 of the Jagged
1-transfected S17 cells (S17 Jagged). The numbers of cells generated
after 1 week of stromal culture were as follows: AGM on S17 = 104; AGM S17 Jagged = 104; fetal liver on S17
= 6 × 103; fetal liver on S17 Jagged = 4 × 104. All cells derived from each stromal culture were
passaged into methylcellulose suspension cultures as described in the
text. Colonies of over 50 cells were counted after 1, 2, 3, and 4 weeks
in culture. The mean number of colonies formed per dish from triplicate
dishes at each time point is shown; error bars show the standard
deviation.
|
|
S17 cells were stably transfected with a human Jagged 1-containing
expression vector and expression was confirmed by Western blotting (Fig
4B). AGM regions were dissected from day 11 mouse embryos and
CD34+, c-kit+ cells isolated by
fluorescence-activated cell sorting. These AGM cells were cultured on
wild-type or Jagged 1-expressing S17 stromal layers for 6 days before
replating in methylcellulose cultures. Colony formation was monitored
over a period of 4 weeks and the results obtained are presented in Fig
4C. After 1 week in methylcellulose culture, few colonies were observed
in either S17 or S17-Jagged samples. At the 2-, 3-, and 4-week
timepoints, more colonies were observed in the S17-Jagged than the S17
samples. In the case of the 2- and 3-week time points, the increase in colony formation was highly significant (P < .01 by
two-tailed t-test). However, at the latest (4-week) time point,
the increase seen was less statistically significant (P = .08).
The results indicate that colony-forming activity is significantly
enhanced in the samples pre-exposed to Jagged 1-expressing stroma. The colonies produced in the methylcellulose cultures were large
mixed-lineage and their morphology and kinetics of appearance are
consistent with a high proliferative potential-colony-forming cells
(HPP-CFC)-like potential31 as might be
expected for primitive progenitors of AGM origin.30
Figure 4D shows the results of a similar analysis conducted using
CD34+, c-kit+ progenitors derived from
fetal liver. Few replated colonies were obtained from the S17 samples
at any time point. Pre-incubation on S17-Jagged stroma resulted in
considerably increased colony formation. Note that these colonies
derived from fetal liver progenitors appeared earlier in the culture
than those derived from AGM. The increase in the number of colonies
seen after 1 week of methylcellulose culture was highly significant
(P < .001 by two-tailed t-test). Enhanced colony
formation in the S17-Jagged samples was also seen after longer periods
of culture but overall colony numbers were lower, and it should be
noted that the increase observed was no longer statistically
significant. These kinetics of colony formation are consistent with the
less primitive nature of the CD34+,
c-kit+ progenitor population isolated from fetal
liver.
| |
DISCUSSION |
Our results show that ligands for the Notch receptor, in particular
Jagged 1, are indeed expressed by primary stromal cells in culture.
Furthermore, we have conducted functional experiments which suggest
that the stromal presentation of Jagged 1 ligand to hematopoietic
progenitors modulates their behavior in vitro.
Confirming heterotypic activation of Notch by Jagged 1 in vivo is
complex because of the numerous potential interactions between stromal
cells of different types and between hematopoietic progenitors themselves. Given this cellular complexity in the BM it is hard to
speculate as to the nature of the cell-cell interactions that might
bring the Notch signaling pathway into play and sophisticated in vivo
manipulations of these pathways will presumably be required to address
this issue.
With regard to the apparent selective expression of Jagged 1 by stroma,
it is important to note that the current survey has been limited to
Notch ligands for which probes and reagents are readily available. Our
results do not exclude the possibility that Notch ligands other than
those investigated here may also be expressed by stromal cells. In this
context it is worth noting that Jagged 1 mutations have recently been
reported to be associated with Alagille syndrome, a rare human
inherited disorder characterized by liver, skeletal, facial, eye, and
cardiac defects, but apparently normal hematopoiesis.32,33
However, the effects of the mutations on Jagged 1 function are unknown,
and it is possible that expression of other Notch ligands in stroma
compensates for the Jagged 1 deficiency. The recent isolation of the
new Notch ligands Delta 2 in Xenopus and Delta 3 in
mouse34,35 may be important in this regard.
We show here that culture on Jagged 1-expressing stroma increases
colony formation by AGM- and fetal liver-derived hematopoietic progenitors. The exact nature of the hematopoietic progenitors in which
Notch signaling is activated by Jagged 1 is not clear from these
experiments. Cellular targets for Notch activation may be either the
progenitors originally present in the AGM and fetal liver or a later
population of progenitors derived from them during the 6 days of
stromal culture, or both. The increase in colony-forming activity we
observed in these experiments using normal hematopoietic progenitors is
broadly speaking consistent with observations obtained using
hematopoietic cell lines and published during revision of this
manuscript. Thus, Li et al36 have shown that activation of
an ectopically expressed Notch receptor on 32D cells by Jagged 1 blocks
G-CSF-induced differentiation of this cell line. Also interesting in
this context are the recent observations of Moore et al,37
who have shown that expression of dlk in stromal cells promotes
cobblestone area formation by stem/progenitor cells. Although dlk
shares many structural features with Notch ligands such as EGF repeats,
it is unlikely that it functions through Notch because it lacks the DSL
domain shared by all authentic Notch ligands and thought to be
necessary for interaction with the Notch receptor. In conclusion, our
results raise the possibility that stromal cells contribute to
maintaining hematopoietic cells in an undifferentiated or self-renewing
state through activation of Notch signaling via Jagged 1. If so, such an interaction could well be exploited in the context of ex vivo expansion or maintenance of stem cell populations in vitro for clinical
purposes.
| |
NOTE ADDED IN PROOF |
We would like to draw the reader's attention to the recently published
work of B. Varnum-Finney, et al (Blood 91:4084, 1998).
| |
FOOTNOTES |
Submitted September 24, 1997;
accepted June 5, 1998.
Supported by the Leukaemia Research Fund and the Institute of Cancer
Research:Royal Cancer Hospital. P.J. acknowledges a Senior Clinical
Fellowship at the Institute of Cancer Research.
Address correspondence to Tariq Enver, PhD, Section of Gene
Function and Regulation, Chester Beatty Laboratories,
Institute of Cancer Research, Fulham Rd, London, SW3 6JB, UK;
email: <tariq{at}icr.ac.uk>.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.
| |
ACKNOWLEDGMENT |
We thank Domingos Henrique, David Ish-Horowicz, and Spyros
Artavanis-Tsakonas for reagents.
| |
REFERENCES |
1.
Robey E:
Notch in vertebrates.
Curr Opin Gen Dev
7:551,
1997[Medline]
[Order article via Infotrieve]
2.
Fortini ME,
Rebay I,
Caron LA,
Artavanis-Tsakonas S:
An activated notch receptor blocks cell-fate commitment in the developing Drosophila eye.
Nature
365:555,
1993[Medline]
[Order article via Infotrieve]
3.
Weinmaster G,
Roberts VJ,
Lemke G:
A homolog of Drosophila Notch expressed during mammalian development.
Development
113:199,
1991[Abstract]
4.
Ellisen LW,
Bird J,
West DC,
Soreng AL,
Reynolds TC,
Smith SD,
Sklar J:
TAN-1, the human homolog of the Drosophila notch gene, is broken by chromosomal translocations in T lymphoblastic neoplasms.
Cell
66:649,
1991[Medline]
[Order article via Infotrieve]
5.
Lardelli M,
Dahlstrand J,
Lendahl U:
The novel Notch homologue mouse Notch 3 lacks specific epidermal growth factor-repeats and is expressed in proliferating neuroepithelium.
Mech Dev
46:123,
1994[Medline]
[Order article via Infotrieve]
6.
Uyttendale H,
Marazzi G,
Wu G,
Yan Q,
Sassoon D:
Notch4/Int3, a mammary proto-oncogene, is an endothelial specific mammalian Notch gene.
Development
122:2251,
1996[Abstract]
7.
Weinmaster G,
Roberts VJ,
Lemke G:
Notch2: A second mammalian Notch gene.
Development
116:931,
1992[Abstract]
8.
Milner LA,
Kopan R,
Martin DI,
Bernstein ID:
A human homologue of the Drosophila developmental gene, Notch, is expressed in CD34+ hematopoietic precursors.
Blood
83:2057,
1994[Abstract/Free Full Text]
9.
Hasserjian RP,
Aster JC,
Davi F,
Weinberg DS,
Sklar J:
Modulated expression of Notch 1 during thymocyte development.
Blood
88:970,
1996[Abstract/Free Full Text]
10.
Bigas A,
Martin DIK,
Milner LA:
Notch1 and Notch2 inhibit myeloid differentiation in response to different cytokines.
Mol Cell Biol
18:2324,
1998[Abstract/Free Full Text]
11.
Girard L,
Hanna Z,
Baeulieu N,
Hoemann CD,
Cimard C,
Kozak CA,
Jolicoeur P:
Frequent provirus insertional mutagenesis of Notch 1 in thymomas of MMTVD/myc transgenic mice suggests a collaboration of c-myc and Notch1 for oncogenesis.
Genes Dev
10:1930,
1996[Abstract/Free Full Text]
12.
Rohn JL,
Lauring AS,
Linenberger ML,
Overbaugh J:
Transduction of Notch 2 in feline leukemia virus-induced thymic lymphoma.
J Virol
70:8071,
1996[Abstract]
13.
Struhl G,
Fitzgerald K,
Greenwald I:
Intrinsic activity of the Lin-12 and Notch intracellular domains in vivo.
Cell
74:331,
1993[Medline]
[Order article via Infotrieve]
14.
Pear WS,
Aster JC,
Scott ML,
Hasserjian RP,
Soffer B,
Sklar J,
Baltimore D:
Exclusive development of T cell neoplasms in mice transplanted with bone marrow expressing activated Notch alleles.
J Exp Med
183:2283,
1996[Abstract/Free Full Text]
15.
Robey E,
Chang D,
Itano A,
Cado D,
Alexander H,
Lands D,
Weinmaster G,
Salmon P:
An activated form of Notch influences the choice between CD4 and CD8 T cell lineages.
Cell
87:483,
1996[Medline]
[Order article via Infotrieve]
16.
Washburn T,
Schweighoffer E,
Griddley T,
Chang D,
Fowlkes BJ,
Cado D,
Robey E:
Notch activity influences the versus   T cell lineage decision.
Cell
88:833,
1997[Medline]
[Order article via Infotrieve]
17.
Bettenhausen B,
de AM,
Simon D,
Guenet JL,
Gossler A:
Transient and restricted expression during mouse embryogenesis of Dll1, a murine gene closely related to Drosophila Delta.
Development
121:2407,
1995[Abstract]
18.
Lindsell CE,
Shawber CJ,
Boulter J,
Weinmaster G:
Jagged: A mammalian ligand that activates Notch 1.
Cell
80:909,
1995[Medline]
[Order article via Infotrieve]
19.
Shawber C,
Boulter J,
Lindsell CE,
Weinmaster G:
Jagged2: A serrate like gene expressed during rat embryogenesis.
Dev Biol
180:370,
1996[Medline]
[Order article via Infotrieve]
20.
Jennings B,
Preiss A,
Delidakis C,
Bray S:
The Notch signalling pathway is required for enhancer of split bHLH protein expression during neurogenesis in the Drosophila embryo.
Development
120:3537,
1994[Abstract]
21.
Jennings B,
de Celis J,
Delidakis C,
Preiss A,
Bray S:
The role of Notch and achaete-scute complex in the expression of enhancer of split bHLH proteins.
Development
121:3745,
1995[Abstract]
22. Allen TD, de Winter E, Liu J-W, in Testa NG, Lord BI, Dexter TM
(eds): Bone marrow stroma: Its role in hematopoiesis, in: Hematopoietic
Lineages in Health and Disease. New York, NY, Dekker, 1997, p
29
23.
Lemischka I:
Microenvironmental regulation of hematopoietic stem cells.
Stem Cells
15:63,
1997[Abstract/Free Full Text]
24.
Bentley SA:
A close cell range: Cell interaction required for stem cell maintenance in continuous bone marrow cultures.
Exp Haematol
9:303,
1981
25.
Dexter TM:
Long-term mouse bone marrow cultures
, in Testa NG,
Molineaux G
(eds):
Haemopoiesis: A Practical Approach.
Oxford, UK, IRL
, 1993
, p 54
26.
Henderson AJ,
Johnson A,
Dorshkind K:
Functional characterization of two stromal cell lines that support B lymphopoiesis.
J Immunol
145:423,
1990[Abstract]
27.
Kodama HA,
Amagai Y,
Koyama H,
Kasai S:
A new preadipose cell line derived from newborn mouse calvaria can promote the proliferation of pluripotent hemopoietic stem cells in vitro.
J Cell Physiol
112:89,
1982[Medline]
[Order article via Infotrieve]
28.
Dolle P:
In situ hybridisation of nucleic acid probes to cellular RNA
, in Hames BD,
Higgins SJ
(eds):
Gene Probes 2: A Practical Approach.
Oxford, UK, IRL
, 1995
, p 169
29.
Godin I,
Dieterlen-Lievre F,
Cumano A:
Emergence of multipotent hemopoietic cells in the yolk sac and paraaortic splanchnopleura in mouse embryos, beginning at 8.5 days postcoitus.
Proc Natl Acad Sci USA
92:773,
1995[Abstract/Free Full Text]
30.
Sanchez M-J,
Holmes A,
Miles C,
Dzierzak E:
Characterisation of the first definitive hematopoietic stem cells in the AGM and liver of the mouse embryo.
Immunity
5:513,
1996[Medline]
[Order article via Infotrieve]
31.
Kriegler A,
Verschoor SM,
Bernardo D,
Bertoncello I:
The relationship between different high proliferative potential colony forming cells in mouse bone marrow.
Exp Hematol
22:432,
1994[Medline]
[Order article via Infotrieve]
32.
Li L:
Alagille syndrome is caused by mutations in human Jagged1, which encodes a ligand for Notch 1.
Nature Genet
16:243,
1997[Medline]
[Order article via Infotrieve]
33.
Oda T,
Elkahloun AG,
Pike BL,
Okajimi K,
Krantz ID,
Genin A,
Piccoli DA,
Meltzer PS,
Spinner NB,
Collins FS,
Chandrasekharappa SC:
Mutations in the human Jagged 1 gene are responsible for Alagille Syndrome.
Nature Genet
16:235,
1997[Medline]
[Order article via Infotrieve]
34.
Jen W-C,
Wettstein D,
Turner D,
Chitnis A,
Kintner C:
The Notch ligand, X-Delta 2, mediates segmentation of the paraxial mesoderm in Xenopus embryos.
Development
124:1169,
1997[Abstract]
35.
Dunwoodie SL,
Henrique D,
Harrison SM,
Beddington RSP:
Mouse Dll3: a novel divergent Delta gene which may complement the function of other delta homologues during early pattern formation in the mouse embryo.
Development
124:3065,
1997[Abstract]
36.
Li L,
Milner LA,
Deng Y,
Iwata M,
Banta A,
Graf L,
Marcovina S,
Friedman C,
Trask BJ,
Hood L,
Torok-Storb B:
The human homolog of rat Jagged1 expressed by marrow stroma inhibits differentiation of 32D cells through interaction with Notch1.
Immunity
8:43,
1998[Medline]
[Order article via Infotrieve]
37.
Moore K,
Pytowski B,
Witte L,
Hicklin D,
Lemischka IR:
Hematopoietic activity of a stromal cell transmembrane protein containing epidermal growth factor like repeat motifs.
Proc Natl Acad Sci USA
94:4011,
1997[Abstract/Free Full Text]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
M. Lahmar, C. Catelain, S. Poirault, M. Dorsch, J.-L. Villeval, W. Vainchenker, O. Albagli, and E. Lauret
Distinct Effects of the Soluble Versus Membrane-Bound Forms of the Notch Ligand Delta-4 on Human CD34+CD38low Cell Expansion and Differentiation
Stem Cells,
March 1, 2008;
26(3):
621 - 629.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Strehl, K. Nebral, M. Konig, J. Harbott, H. Strobl, R. Ratei, S. Struski, B. Bielorai, M. Lessard, M. Zimmermann, et al.
ETV6-NCOA2: A Novel Fusion Gene in Acute Leukemia Associated with Coexpression of T-Lymphoid and Myeloid Markers and Frequent NOTCH1 Mutations
Clin. Cancer Res.,
February 15, 2008;
14(4):
977 - 983.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Delaney, B. Varnum-Finney, K. Aoyama, C. Brashem-Stein, and I. D. Bernstein
Dose-dependent effects of the Notch ligand Delta1 on ex vivo differentiation and in vivo marrow repopulating ability of cord blood cells
Blood,
October 15, 2005;
106(8):
2693 - 2699.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. H. Dallas, B. Varnum-Finney, C. Delaney, K. Kato, and I. D. Bernstein
Density of the Notch ligand Delta1 determines generation of B and T cell precursors from hematopoietic stem cells
J. Exp. Med.,
May 2, 2005;
201(9):
1361 - 1366.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. S. Dando, M. Tavian, C. Catelain, S. Poirault, A. Bennaceur-Griscelli, F. Sainteny, W. Vainchenker, B. Peault, and E. Lauret
Notch/Delta4 Interaction in Human Embryonic Liver CD34+ CD38- Cells: Positive Influence on BFU-E Production and LTC-IC Potential Maintenance
Stem Cells,
April 1, 2005;
23(4):
550 - 560.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
Abstract
Introduction
Abstract