Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jones, P.
Right arrow Articles by Enver, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jones, P.
Right arrow Articles by Enver, T.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, Vol. 92 No. 5 (September 1), 1998: pp. 1505-1511

RAPID COMMUNICATION

Stromal Expression of Jagged 1 Promotes Colony Formation by Fetal Hematopoietic Progenitor Cells

By Philip Jones, Gill May, Lyn Healy, John Brown, Gerald Hoyne, Sylvie Delassus, and Tariq Enver

From the Section of Gene Function and Regulation & Leukaemia Research Fund Centre, Chester Beatty Laboratories, Institute of Cancer Research, London; and the Department of Respiratory Medicine, University of Edinburgh, Edinburgh, UK.


    ABSTRACT
Abstract
Introduction
Methods
Results
Discussion
References

The Notch signaling system regulates proliferation and differentiation in many tissues. Notch is a transmembrane receptor activated by ligands expressed on adjacent cells. Hematopoietic stem cells and early progenitors express Notch, making the stromal cells which form cell-cell contacts with progenitor cells candidate ligand-presenting cells in the hematopoietic microenvironment. Therefore, we examined primary stromal cell cultures for expression of Notch ligands. Using reverse transcription-polymerase chain reaction, in situ hybridization, immunohistochemistry, and Western blotting, we demonstrate expression of Jagged 1 in primary stromal cultures. To investigate if the stromal expression of Jagged 1 has functional effects on hematopoietic progenitors, we cultured CD34+, c-kit+ hematopoietic progenitor cells derived from the aorto gonadal mesonephros region of day 11 mouse embryos on the Jagged 1- stromal cell line S17 and on S17 cells engineered to express Jagged 1. The presence of Jagged 1 increased the number of colonies formed in subsequent methylcellulose culture fourfold. Larger increases in colony numbers were observed under the same culture conditions with CD34+, c-kit+ hematopoietic progenitor cells derived from d11 fetal liver. These results obtained in vitro table Jagged 1 as a candidate regulator of stem cell fate in the context of stromal microenvironments in vivo.

© 1998 by The American Society of Hematology.

    INTRODUCTION
Abstract
Introduction
Methods
Results
Discussion
References

THE NOTCH SIGNALING SYSTEM is highly conserved from Drosophila to vertebrates and regulates cell differentiation and proliferation during development and in proliferating adult tissues.1 The Notch receptor is a transmembrane glycoprotein that binds to ligands expressed on adjoining cells. Once ligand is bound, signal transduction takes place, resulting in the transcription of nuclear target genes, including transcription factors. The net effect of Notch activation is that the cell becomes refractory to differentiation signals. This effect is transient and reversible; once Notch activation ceases the cell is able to differentiate.2

Four different Notch genes have been identified in mice and humans, two of which are known to be expressed in the hematopoietic system.3-7 Notch 1 has been shown to be expressed in CD34+ lineage-negative hematopoietic stem cells in humans.8 Expression has also been found in CD34+ early progenitor cells expressing lineage markers,8 in the spleen, on thymic T cells and peripheral blood lymphocytes, and in a B-cell lymphoma line, FL18.3,4,9 Notch 2 is expressed in the spleen of adult mice and a limited analysis of hematopoietic cell lines has shown expression in the multilineage hematopoietic progenitor cell line FDCP-mix A4, and the myeloid progenitor cell line 32D.7,10

Dysregulation of the balance between self-renewal and differentiation in hematopoiesis is an essential feature of leukemogenesis. In adult T-cell lymphoblastic leukemia a t(7;9)(q34;q34.3) chromosomal translocation has been found to result in the expression of a truncated Notch 1 comprising the transmembrane and cytoplasmic domains. Similar Notch 1 mutations have been found in transgenic mice that develop spontaneous T-cell lymphoma,11 and feline leukemia virus isolates from thymic lymphomas in cats contain truncated Notch 2.12 Such truncated Notch mutants (Nintra) have been shown to be dominant activators of Notch signaling in Drosophila and Caenorhabditis elegans.13 The introduction of Nintra into hematopoietic progenitors results in T-cell lymphoma when the cells are engrafted into lethally irradiated mice14 and expression of Nintra in T cells in transgenic mice results in altered T-cell differentiation.15,16 The effects of Nintra are not confined to T cells; it is also able to block cytokine-induced differentiation when introduced into the 32D myeloid progenitor cell line in vitro, with constitutively active Notch 1 and Notch 2 blocking differentiation in response to granulocyte colony-stimulating factor (G-CSF) and granulocyte-macrophage (GM)-CSF, respectively (ref 10 and references therein).

The role of Notch signaling in regulating the differentiation of normal hematopoietic stem cells and early progenitors remains unclear. The regulation of Notch activation in vivo is at least in part achieved by restricted expression of Notch ligand.1 The ligands described in mouse and human are Delta 1, highly homologous to Drosophila Delta, and Jagged 1 and 2, the homologues of Drosophila Serrate.17-19 These transmembrane proteins have different patterns of expression in development and in adult tissues. Although many cells in a tissue may express Notch, only those adjoining cells expressing Notch ligand show activated Notch signaling.20,21

Hematopoietic stem cells and progenitors form cell-cell contacts with bone marrow (BM) stromal cells in vivo.22,23 In vitro such contacts appear essential for the maintenance of long-term BM cultures.24 Expression of ligand in stromal cells may provide one means of activation of the Notch receptor in the progenitor cell populations that are associated with stromal cells. Therefore, we examined the expression of Notch ligands in normal murine BM stromal cultures. We found Jagged 1 was expressed in murine stroma and went on to investigate if stromal expression of Jagged 1 is able to modulate the functional output of murine fetal hematopoietic progenitor cells in vitro.

    MATERIALS AND METHODS
Abstract
Introduction
Methods
Results
Discussion
References

Cell culture.   Mouse femoral BM was obtained from 6- to 8-week-old C57/Bl6 mice and cultured for 6 to 8 weeks in alpha -minimal essential medium (GIBCO-BRL, Paisley UK) supplemented with 10% fetal bovine serum (FBS; GIBCO), 10% horse serum (TCS, Buckingham, UK), and 10-7 mol/L hydrocortisone (Sigma, Poole, Dorset, UK).25 Cultures were maintained until no hematopoietic colonies were visible on examination with phase microscopy. Stromal cell lines PA6 and S1726,27 were cultured in alpha -minimal essential medium supplemented with 20% FBS. Cells were grown in a humidified 5% CO2 incubator at 37°C.

Antibodies and probes.   cDNA probes for Jagged 1 and Delta 1 cloned into Bluescript were a gift from Domingos Henrique and David Ish-Horowicz (Imperial Cancer Research Fund, London, UK). For immunohistochemistry, rat polyclonal antiserum raised against the cytoplasmic tail of human Jagged 1 (kind gift of Spyros Artavanis Tsakonas, Bayer Center for Molecular Medicine, Yale University, New Haven, CT) was used at a dilution of 1:50. A cocktail of rat IgG1, IgG2, and IgM immunoglobulins (Serotec, Kidlington, Oxford, UK) was used as a negative control at a concentration of 5 µg/mL. Biotinylated anti-rat IgG (Vector, Peterborough, UK) was used as a second layer antibody at a concentration of 5 µg/mL. For Western blotting a goat polyclonal antibody raised against amino acids 1200-1219 of the carboxy terminus of rat Jagged 1 was used at a concentration of 0.5 µg/mL (Santa Cruz Biotechnology, Autogen Bioclear UK, Carne, Wiltshire, UK); horseradish peroxidase-conjugated anti-goat secondary antibody was used at a concentration of 0.08 µg/mL (Santa Cruz).

Polymerase chain reaction (PCR) primers.   The forward and reverse primers used for PCR were as follows: Delta 1, CTGAGGTGTAAGATGGAAGCG and CAACTGTCCATAGTGCAATGG; Jagged 1, TGCAGCTGTCAATCACTTCG and CAGAATGACGCTTCCTGTCG; Jagged 2, AGAAGACTGCAACAGCTGCC and AACAGACCTGTGGAAGAGCC; beta  actin TGTATGCCTCTGGTCGTACC and CAACGTCACACTTCATGATGG. Primers for mouse beta  actin and mouse Delta 1 were designed from Genbank sequences to amplify bases 505 to 942 and 2172 to 2416, respectively. The mouse Jagged 1 primers were obtained by sequencing the partial cDNA fragment of mouse Jagged 1. The product corresponds to bases 1761 to 2122 of the rat sequence. Primers for Jagged 2 were designed to amplify bases 2523 to 3119 of the published rat sequence (U70050); the mouse PCR product displayed over 90% sequence identity with the corresponding region of rat Jagged 2.

Reverse transcription (RT)-PCR.   Total RNA was isolated using an RNeasy kit (Qiagen, Crawley, West Sussex, UK), incubated with DNAse I (Boehringer Mannheim, Lewes, East Sussex, UK), and reverse transcribed using AMV reverse transcriptase (Boehringer Mannheim) with an oligo dT primer. As a positive control, cDNA was also prepared from polyA RNA from a day 13.5 mouse embryo (gift from A Zelent, Institute of Cancer Research, London, UK). cDNA from 100 ng of total RNA or 10 ng polyA embryo RNA was amplified through 37 cycles comprising 94°C, for 20 seconds, 60°C for 30 seconds, and 72°C for 90 seconds in Perkin Elmer PCR buffer II with 2.0 mmol/L added MgCl2, with Amplitaq Gold DNA polymerase (Perkin Elmer, Warrington, UK), on a GeneAmp 9600 or 9700 thermal cycler (Perkin Elmer). Products were analyzed by electrophoresis through 2% agarose gels with ethidium bromide. Representative samples of each PCR product were gel purified using a Qiaquick gel isolation kit (Qiagen) and then direct sequenced using the appropriate PCR primer and an Amplitaq FS DNA sequencing kit (Perkin Elmer). Sequences were identified using Blastn searches at the National Center for Biotechnology Information (NCBI) database and in all cases corresponded with the predicted product.

In situ hybridization.   Radioactive in situ hybridization was performed essentially as described.28 Briefly, mouse stromal cells were cultured on glass slides (Lab-Tek TC; Nunc, Paisley, UK) as described above, until no hematopoietic colonies remained as assessed by phase microscopy. Cells were washed in phosphate-buffered saline (PBS), fixed in acetone, air dried, and stored at -70°C. Before hybridization, cells were fixed in 4% paraformaldehyde in PBS for 2 minutes at room temperature, washed in PBS, treated with 1 µg/mL proteinase K for 10 minutes at 37°C, acetylated, washed twice in 1× sodium citrate buffer (SSC), dehydrated through graded alcohols, and air dried.

Sense and antisense probes for Delta 1, Serrate 1, and beta  actin, labeled with [alpha 35S] CTP (800 Ci/mmol/L; Amersham International, Amersham, Bucks, UK) were synthesized using a Maxiscript T3/T7 Kit (Ambion; AMS Biotechnology, Witney, Oxon, UK). Probes were dissolved in hybridization buffer at 3 × 104 counts per minute; hybridization buffer consisted of 1× salts (0.3 mol/L NaCl, 0.02 mol/L Tris pH 6.8, 5 mmol/L EDTA, 1 mmol/L sodium phosphate buffer pH 6.8, and 1× Denhardt's solution [Sigma]), 10% dextran sulfate (Sigma), 50% deionized formamide (Sigma), 20 mmol/L dithiothreitol (DTT; IBI Kodak Ltd, Cambridge, UK), and 500 µg/mL yeast tRNA (Boehringer Mannheim). Twenty microliters of probe solution was applied to each slide and allowed to hybridize overnight at 55°C. Slides were washed with 1× salts, 50% formamide, 10 mmol/L DTT for 15 minutes and then 1 hour at 55°C, treated with 20 µg/mL RNAse A (Sigma) in 0.5 mol/L sodium chloride, 10 mmol/L Tris pH 7.5, 5 mmol/L EDTA for 30 minutes at 37°C, washed twice in 2× SSC at room temperature for 15 minutes per wash, once in 0.2× SSC at 50°C for 15 minutes, and then washed in 3 L of 0.2× SSC for 30 minutes at room temperature. After dehydration through graded alcohols containing 0.3 mol/L ammonium acetate, slides were dipped in emulsion (LM-1; Amersham) and then exposed for 2 to 3 weeks at 4°C. After development slides were stained with nuclear fast red (Vector).

Immunohistochemistry.   Cultured stromal cells were detached from the culture dish using cell dissociation buffer (Sigma), washed in PBS, resuspended in alpha -medium with 10% FBS, and then plated onto superfrost plus slides (BDH) previously coated with rat tail type I collagen (Sigma) by incubating the slides for 2 hours at 37°C with a 100 µg/mL solution of collagen type I in PBS. Cells were allowed to adhere for 6 hours at 37°C. Nonadherent cells were removed by washing with PBS. After fixation in 1% paraformaldehyde (Sigma) at room temperature for 10 minutes, slides were washed in PBS, incubated with 0.1% Triton X-100 (Sigma) in PBS for 10 minutes at room temperature, washed in PBS, incubated for 30 minutes at room temperature with PBS containing 0.1% hydrogen peroxide, washed in PBS, and incubated for 1 hour at room temperature with PBS containing 5% heat-inactivated sheep serum (PBS-HS). Cells were incubated overnight at 4°C with primary antibody diluted in PBS-HS, washed three times for 10 minutes each in PBS, incubated with secondary antibody diluted in PBS-HS for 1 hour at room temperature, and washed as before. Slides were developed using a Vector Stain ABC Elite kit with diaminobenzidine according to the manufacturer's instructions. Slides were counterstained with hematoxylin.

Western blotting.   Cultured mouse stromal cells were boiled in sample buffer (10% glycerol, 1% sodium dodecyl sulfate [SDS], 5% beta -mercaptoethanol, 50 mmol/L Tris pH 6.8), and electrophoresed through a 3% to 12% gradient SDS gel and transferred to Immobilon-P membrane (Millipore). The blot was then blocked with 5% milk in Tris-buffered saline containing 0.1% Tween 20 (TBS-T) for 2 hours at room temperature, incubated with primary anti-Jagged 1 antibody overnight at 4°C overnight, washed five times in TBS-T, incubated with secondary antibody for 1 hour at room temperature, washed five times in TBS-T, and visualized with an ECL or an ECL Plus kit (Amersham International) using Biomax MR film (Kodak).

Introduction of Jagged 1 into 3T3 and S17 cells.   Full-length human Jagged 1 cDNA in pBluescript (a gift from Spyros Artavanis Tsakonas, Bayer Center for Molecular Medicine, Yale University, New Haven, CT) was released by digestion with Not 1 and EcoR1 and inserted into the retroviral vector p50-M-X-neo (gift of J. Hanneman, Institute of Cancer Research). S17 and NIH 3T3 cells were stably transfected with this construct as follows. Cells were trypsinized, pelleted, and 107 cells resuspended in 0.4-mL culture medium. Cells were then incubated with 40 µg linearized DNA for 10 minutes at room temperature, electroporated at 260 V, 960 µF using a Biorad Gene Pulser (pulse time 27 ms) transferred into 30 mL culture media and split between three 9-cm dishes. After 20 hours the medium was replaced with fresh medium containing 1 mg/mL Geneticin (GIBCO-BRL). After 10 days' culture, each plate contained 50 to 100 colonies. Plates were maintained independently to provide three pools of stably transfected cells. Expression of Jagged 1 was confirmed by Western blot as described above.

Sorting and culture of murine fetal hematopoietic progenitors.   Single-cell suspensions were prepared from aorto gonadal mesonephros (AGM) and fetal liver, dissected from day 11 postcoitum CBA × C57/BL10 embryos, stained for c-kit and CD34 and CD34+, c-kit+ cells sorted using a FACStar cell sorter (Beckton Dickinson). Fifty cells per well were plated onto irradiated stromal layers comprising either untransfected S17 cells or S17 cells transfected with Jagged 1 (pool 1). After 1 week of culture in the presence of interleukin-7 (IL-7), c-kit ligand, and 2-mercaptoethanol as previously described,29 all cells from each well were counted and passaged into three methlyl cellulose cultures (methocult M3430; Stem Cell Technologies Inc, Northampton, UK). The morphology and number of colonies comprising more than 50 cells was scored at 1, 2, 3, and 4 weeks.

    RESULTS
Abstract
Introduction
Methods
Results
Discussion
References

Expression of Notch ligands in primary murine stromal cell cultures.   We began our study by examining Notch ligand expression in cultures of mouse primary stromal cells. Mouse femoral BM from 6- to 8-week-old mice was cultured for 6 to 8 weeks until no hematopoietic colonies were visible on examination with phase microscopy. Two independent stromal cultures were analyzed for expression of the Notch ligands Delta 1, Jagged 1, and Jagged 2 by RT-PCR, using conditions similar to those previously described for the analysis of Notch ligand expression.17 We used day 13.5 mouse embryo cDNA---in which all three ligands are known to be expressed---as a positive control, and the identity of all PCR products was confirmed by sequencing. Delta 1 and Jagged 1 mRNAs were detectable by RT-PCR in both stromal cultures, one of which is shown in Fig 1 (top panel). Trace levels of Jagged 2 were also detected in this culture (Fig 1) but absent from the other (not shown). The presence of Jagged 2 may therefore be due to contamination with hematopoietic cells because Jagged 2 is readily detectable in a variety of immunopurified myeloid and erythroid cells (P. Jones, unpublished observations, July 1997).


View larger version (36K):
[in this window]
[in a new window]
 
Fig 1. Expression of Notch ligands in primary mouse stromal cell cultures. RT-PCR analysis of Delta 1 (D1), Jagged 1 (J1), and Jagged 2 (J2) mRNAs in primary murine stromal cell culture. RT-PCR was performed on cultures that contained no visible hematopoietic elements (top panel) and on day 13.5 mouse embryo RNA (bottom panel), with (+) or without (-) reverse transcription. Products were analyzed on a 2% agarose gel. Lane M contains a pBR322 HaeIII marker (Sigma), the visible fragment sizes are 587, 540, 504, 458, 434, 267, 234, 213, 192, and 184 bp. All RT-PCR products were of the predicted size and their identity was further confirmed by sequencing.

We next used radioactive in situ hybridization to gain an appreciation of the level and cellular distribution of Jagged 1 and Delta 1 expression in the primary stromal cell cultures. With an antisense Jagged 1 probe, there was a clear increase in grain deposition over the majority of cells (Fig 2C) whereas a sense (control) probe gave no such increase (Fig 2B). An antisense beta actin probe provides a positive control for the technique (Fig 2A). There was no difference in the pattern of grain deposition between sense and antisense probes for Delta 1 (data not shown). Thus, Jagged 1 is transcribed in the majority of stromal cells in primary culture while Delta 1 transcription appears to be at a low level or confined to very few cells in the stromal population.


View larger version (86K):
[in this window]
[in a new window]
 
Fig 2. In situ hybridization for Jagged 1 in mouse stromal cell cultures. Radioactive in situ hybridization of primary mouse stromal cell cultures prepared as described in the text. The probe is visualized by grain deposition in the emulsion layer overlying the cells, which have been counterstained with nuclear fast red. (A) Positive control anti-sense actin probe, 1 week exposure. Grain deposition over cells in excess of background indicates RNA is intact. (B) Negative control, sense Jagged 1 probe, 3-week exposure. Grain deposition over cells is not increased over background, indicating no nonspecific hybridization of control probe. (C) Experimental sample, Jagged 1 anti-sense probe, 3-week exposure. Grain deposition over cells indicates Jagged 1 RNA is transcribed by the majority of stromal cells.

Finally, we investigated whether Jagged 1 mRNA was translated into protein in primary cultures of stromal cells. Immunohistochemistry using a polyclonal antibody raised against the cytoplasmic domain of human Jagged 1 gave staining clearly in excess of control in stromal cells (Fig 3A and B). However, because such staining may be partially caused by binding of epitopes in proteins other than Jagged 1, we confirmed Jagged 1 protein expression in extracts of mouse stromal cultures by Western blotting using a second polyclonal anti-Jagged 1 antibody. A single band was seen running at the predicted molecular weight for Jagged 1 of 170 kD (Fig 3C).


View larger version (55K):
[in this window]
[in a new window]
 
Fig 3. Expression of Jagged 1 protein in cultured mouse stromal cells. (A and B) Cultured primary mouse stromal cells were allowed to adhere to slides coated with type I collagen and then stained immunohistochemically with a rat anti-Jagged 1 polyclonal antiserum (A) or with control anti-rat Ig (B). Antibody binding was visualized by staining with diaminobenzidine, and the cells were counterstained with hematoxylin. (C) Western blot of cultured primary mouse stromal cell extract, which was separated on a 3% to 12% gradient SDS-polyacrylamide gel electrophoresis under reducing conditions, transferred, and probed with a goat anti-Jagged 1 antibody. The lefthand column shows the position of molecular weight markers (Amersham); the figures are molecular weights in kilodaltons. The single band detected at approximately 170 to 180 kD corresponds to Jagged 1. 

In summary, of the three Notch ligands examined, Jagged 1 is the major ligand expressed in primary stromal cells in culture as assessed by RT-PCR, in situ hybridization, immunohistochemistry, and Western blotting.

Functional effects of stromal Jagged 1 expression on murine fetal hematopoietic progenitors.   These results raise the possibility that the Notch receptors expressed on hematopoietic progenitors bind to Jagged on stromal cells, resulting in activation of the Notch signal transduction pathway. In other cell systems, Notch activation results in a transient block to differentiation and, consistent with this, constitutively active mutants of Notch are associated with leukemia and able experimentally to block G-CSF-induced differentiation of granulocytic cell lines (see introduction). We next performed functional experiments to explore the possibility that expression of the Notch ligand Jagged 1 on stromal cells could modulate the behavior of primary hematopoietic progenitor cells cultured in vitro.

As a source of progenitor cells for our study, we have used CD34+, c-kit+ cells from the AGM region of the developing mouse embryo. This population contains the first detectable stem cells capable of long-term reconstitution of adult irradiated recipients.30 Consistent with this capacity, CD34+, c-kit+ AGM cells are multipotential in vitro (S. Delassus, unpublished observations, April 1997). The in vitro culture system used to support multilineage differentiation of AGM-derived CD34+, c-kit+ cells utilizes the stromal cell line S17 as one of its components.29 S17 do not express Jagged 1 mRNA as judged by Northern blotting (data not shown); Western blotting confirmed the absence of Jagged 1 protein expression in S17 (Fig 4A). We exploited the fact that S17 cells do not express Jagged 1 to assess the role of this Notch ligand in modulating hematopoietic progenitor cell behavior.


View larger version (26K):
[in this window]
[in a new window]
 


View larger version (20K):
[in this window]
[in a new window]
 
Fig 4. Colony-forming activity of fetal hematopoietic progenitors. (A) Western blot of cell extracts from the stromal cell lines PA6 (lefthand lane) and S17 (righthand lane), separated on a 6% SDS gel under reducing conditions, transferred, and probed with the same anti-Jagged 1 antibody used in Fig 3. Note that while PA6 expresses Jagged 1, S17 cells do not. (B) Western blot of cell extracts from three independent pools (lanes 1 through 3) of S17 cells stably transfected with a human Jagged 1-containing expression vector. (C and D) Colony production by fetal CD34+, c-kit+ hematopoietic progenitor cells from d11 AGM (C) or fetal liver (D) after culture for 1 week on irradiated wild-type or Jagged 1-transfected S17 cells. CD34+, c-kit+ cells from AGM and fetal liver were sorted and cultured on irradiated S17 cells or pool 1 of the Jagged 1-transfected S17 cells (S17 Jagged). The numbers of cells generated after 1 week of stromal culture were as follows: AGM on S17 = 104; AGM S17 Jagged = 104; fetal liver on S17 = 6 × 103; fetal liver on S17 Jagged = 4 × 104. All cells derived from each stromal culture were passaged into methylcellulose suspension cultures as described in the text. Colonies of over 50 cells were counted after 1, 2, 3, and 4 weeks in culture. The mean number of colonies formed per dish from triplicate dishes at each time point is shown; error bars show the standard deviation.

S17 cells were stably transfected with a human Jagged 1-containing expression vector and expression was confirmed by Western blotting (Fig 4B). AGM regions were dissected from day 11 mouse embryos and CD34+, c-kit+ cells isolated by fluorescence-activated cell sorting. These AGM cells were cultured on wild-type or Jagged 1-expressing S17 stromal layers for 6 days before replating in methylcellulose cultures. Colony formation was monitored over a period of 4 weeks and the results obtained are presented in Fig 4C. After 1 week in methylcellulose culture, few colonies were observed in either S17 or S17-Jagged samples. At the 2-, 3-, and 4-week timepoints, more colonies were observed in the S17-Jagged than the S17 samples. In the case of the 2- and 3-week time points, the increase in colony formation was highly significant (P < .01 by two-tailed t-test). However, at the latest (4-week) time point, the increase seen was less statistically significant (P = .08). The results indicate that colony-forming activity is significantly enhanced in the samples pre-exposed to Jagged 1-expressing stroma. The colonies produced in the methylcellulose cultures were large mixed-lineage and their morphology and kinetics of appearance are consistent with a high proliferative potential-colony-forming cells (HPP-CFC)-like potential31 as might be expected for primitive progenitors of AGM origin.30

Figure 4D shows the results of a similar analysis conducted using CD34+, c-kit+ progenitors derived from fetal liver. Few replated colonies were obtained from the S17 samples at any time point. Pre-incubation on S17-Jagged stroma resulted in considerably increased colony formation. Note that these colonies derived from fetal liver progenitors appeared earlier in the culture than those derived from AGM. The increase in the number of colonies seen after 1 week of methylcellulose culture was highly significant (P < .001 by two-tailed t-test). Enhanced colony formation in the S17-Jagged samples was also seen after longer periods of culture but overall colony numbers were lower, and it should be noted that the increase observed was no longer statistically significant. These kinetics of colony formation are consistent with the less primitive nature of the CD34+, c-kit+ progenitor population isolated from fetal liver.

    DISCUSSION
Abstract
Introduction
Methods
Results
Discussion
References

Our results show that ligands for the Notch receptor, in particular Jagged 1, are indeed expressed by primary stromal cells in culture. Furthermore, we have conducted functional experiments which suggest that the stromal presentation of Jagged 1 ligand to hematopoietic progenitors modulates their behavior in vitro.

Confirming heterotypic activation of Notch by Jagged 1 in vivo is complex because of the numerous potential interactions between stromal cells of different types and between hematopoietic progenitors themselves. Given this cellular complexity in the BM it is hard to speculate as to the nature of the cell-cell interactions that might bring the Notch signaling pathway into play and sophisticated in vivo manipulations of these pathways will presumably be required to address this issue.

With regard to the apparent selective expression of Jagged 1 by stroma, it is important to note that the current survey has been limited to Notch ligands for which probes and reagents are readily available. Our results do not exclude the possibility that Notch ligands other than those investigated here may also be expressed by stromal cells. In this context it is worth noting that Jagged 1 mutations have recently been reported to be associated with Alagille syndrome, a rare human inherited disorder characterized by liver, skeletal, facial, eye, and cardiac defects, but apparently normal hematopoiesis.32,33 However, the effects of the mutations on Jagged 1 function are unknown, and it is possible that expression of other Notch ligands in stroma compensates for the Jagged 1 deficiency. The recent isolation of the new Notch ligands Delta 2 in Xenopus and Delta 3 in mouse34,35 may be important in this regard.

We show here that culture on Jagged 1-expressing stroma increases colony formation by AGM- and fetal liver-derived hematopoietic progenitors. The exact nature of the hematopoietic progenitors in which Notch signaling is activated by Jagged 1 is not clear from these experiments. Cellular targets for Notch activation may be either the progenitors originally present in the AGM and fetal liver or a later population of progenitors derived from them during the 6 days of stromal culture, or both. The increase in colony-forming activity we observed in these experiments using normal hematopoietic progenitors is broadly speaking consistent with observations obtained using hematopoietic cell lines and published during revision of this manuscript. Thus, Li et al36 have shown that activation of an ectopically expressed Notch receptor on 32D cells by Jagged 1 blocks G-CSF-induced differentiation of this cell line. Also interesting in this context are the recent observations of Moore et al,37 who have shown that expression of dlk in stromal cells promotes cobblestone area formation by stem/progenitor cells. Although dlk shares many structural features with Notch ligands such as EGF repeats, it is unlikely that it functions through Notch because it lacks the DSL domain shared by all authentic Notch ligands and thought to be necessary for interaction with the Notch receptor. In conclusion, our results raise the possibility that stromal cells contribute to maintaining hematopoietic cells in an undifferentiated or self-renewing state through activation of Notch signaling via Jagged 1. If so, such an interaction could well be exploited in the context of ex vivo expansion or maintenance of stem cell populations in vitro for clinical purposes.

    NOTE ADDED IN PROOF

We would like to draw the reader's attention to the recently published work of B. Varnum-Finney, et al (Blood 91:4084, 1998).

    FOOTNOTES

   Submitted September 24, 1997; accepted June 5, 1998.
   Supported by the Leukaemia Research Fund and the Institute of Cancer Research:Royal Cancer Hospital. P.J. acknowledges a Senior Clinical Fellowship at the Institute of Cancer Research.
   Address correspondence to Tariq Enver, PhD, Section of Gene Function and Regulation, Chester Beatty Laboratories, Institute of Cancer Research, Fulham Rd, London, SW3 6JB, UK; email: <tariq{at}icr.ac.uk>.
   The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.

    ACKNOWLEDGMENT

We thank Domingos Henrique, David Ish-Horowicz, and Spyros Artavanis-Tsakonas for reagents.

    REFERENCES
Abstract
Introduction
Methods
Results
Discussion
References

1. Robey E: Notch in vertebrates. Curr Opin Gen Dev 7:551, 1997[Medline] [Order article via Infotrieve]

2. Fortini ME, Rebay I, Caron LA, Artavanis-Tsakonas S: An activated notch receptor blocks cell-fate commitment in the developing Drosophila eye. Nature 365:555, 1993[Medline] [Order article via Infotrieve]

3. Weinmaster G, Roberts VJ, Lemke G: A homolog of Drosophila Notch expressed during mammalian development. Development 113:199, 1991[Abstract]

4. Ellisen LW, Bird J, West DC, Soreng AL, Reynolds TC, Smith SD, Sklar J: TAN-1, the human homolog of the Drosophila notch gene, is broken by chromosomal translocations in T lymphoblastic neoplasms. Cell 66:649, 1991[Medline] [Order article via Infotrieve]

5. Lardelli M, Dahlstrand J, Lendahl U: The novel Notch homologue mouse Notch 3 lacks specific epidermal growth factor-repeats and is expressed in proliferating neuroepithelium. Mech Dev 46:123, 1994[Medline] [Order article via Infotrieve]

6. Uyttendale H, Marazzi G, Wu G, Yan Q, Sassoon D: Notch4/Int3, a mammary proto-oncogene, is an endothelial specific mammalian Notch gene. Development 122:2251, 1996[Abstract]

7. Weinmaster G, Roberts VJ, Lemke G: Notch2: A second mammalian Notch gene. Development 116:931, 1992[Abstract]

8. Milner LA, Kopan R, Martin DI, Bernstein ID: A human homologue of the Drosophila developmental gene, Notch, is expressed in CD34+ hematopoietic precursors. Blood 83:2057, 1994[Abstract/Free Full Text]

9. Hasserjian RP, Aster JC, Davi F, Weinberg DS, Sklar J: Modulated expression of Notch 1 during thymocyte development. Blood 88:970, 1996[Abstract/Free Full Text]

10. Bigas A, Martin DIK, Milner LA: Notch1 and Notch2 inhibit myeloid differentiation in response to different cytokines. Mol Cell Biol 18:2324, 1998[Abstract/Free Full Text]

11. Girard L, Hanna Z, Baeulieu N, Hoemann CD, Cimard C, Kozak CA, Jolicoeur P: Frequent provirus insertional mutagenesis of Notch 1 in thymomas of MMTVD/myc transgenic mice suggests a collaboration of c-myc and Notch1 for oncogenesis. Genes Dev 10:1930, 1996[Abstract/Free Full Text]

12. Rohn JL, Lauring AS, Linenberger ML, Overbaugh J: Transduction of Notch 2 in feline leukemia virus-induced thymic lymphoma. J Virol 70:8071, 1996[Abstract]

13. Struhl G, Fitzgerald K, Greenwald I: Intrinsic activity of the Lin-12 and Notch intracellular domains in vivo. Cell 74:331, 1993[Medline] [Order article via Infotrieve]

14. Pear WS, Aster JC, Scott ML, Hasserjian RP, Soffer B, Sklar J, Baltimore D: Exclusive development of T cell neoplasms in mice transplanted with bone marrow expressing activated Notch alleles. J Exp Med 183:2283, 1996[Abstract/Free Full Text]

15. Robey E, Chang D, Itano A, Cado D, Alexander H, Lands D, Weinmaster G, Salmon P: An activated form of Notch influences the choice between CD4 and CD8 T cell lineages. Cell 87:483, 1996[Medline] [Order article via Infotrieve]

16. Washburn T, Schweighoffer E, Griddley T, Chang D, Fowlkes BJ, Cado D, Robey E: Notch activity influences the alpha beta versus gamma delta T cell lineage decision. Cell 88:833, 1997[Medline] [Order article via Infotrieve]

17. Bettenhausen B, de AM, Simon D, Guenet JL, Gossler A: Transient and restricted expression during mouse embryogenesis of Dll1, a murine gene closely related to Drosophila Delta. Development 121:2407, 1995[Abstract]

18. Lindsell CE, Shawber CJ, Boulter J, Weinmaster G: Jagged: A mammalian ligand that activates Notch 1. Cell 80:909, 1995[Medline] [Order article via Infotrieve]

19. Shawber C, Boulter J, Lindsell CE, Weinmaster G: Jagged2: A serrate like gene expressed during rat embryogenesis. Dev Biol 180:370, 1996[Medline] [Order article via Infotrieve]

20. Jennings B, Preiss A, Delidakis C, Bray S: The Notch signalling pathway is required for enhancer of split bHLH protein expression during neurogenesis in the Drosophila embryo. Development 120:3537, 1994[Abstract]

21. Jennings B, de Celis J, Delidakis C, Preiss A, Bray S: The role of Notch and achaete-scute complex in the expression of enhancer of split bHLH proteins. Development 121:3745, 1995[Abstract]

22. Allen TD, de Winter E, Liu J-W, in Testa NG, Lord BI, Dexter TM (eds): Bone marrow stroma: Its role in hematopoiesis, in: Hematopoietic Lineages in Health and Disease. New York, NY, Dekker, 1997, p 29

23. Lemischka I: Microenvironmental regulation of hematopoietic stem cells. Stem Cells 15:63, 1997[Abstract/Free Full Text]

24. Bentley SA: A close cell range: Cell interaction required for stem cell maintenance in continuous bone marrow cultures. Exp Haematol 9:303, 1981

25. Dexter TM: Long-term mouse bone marrow cultures , in Testa NG, Molineaux G (eds): Haemopoiesis: A Practical Approach. Oxford, UK, IRL , 1993 , p 54

26. Henderson AJ, Johnson A, Dorshkind K: Functional characterization of two stromal cell lines that support B lymphopoiesis. J Immunol 145:423, 1990[Abstract]

27. Kodama HA, Amagai Y, Koyama H, Kasai S: A new preadipose cell line derived from newborn mouse calvaria can promote the proliferation of pluripotent hemopoietic stem cells in vitro. J Cell Physiol 112:89, 1982[Medline] [Order article via Infotrieve]

28. Dolle P: In situ hybridisation of nucleic acid probes to cellular RNA , in Hames BD, Higgins SJ (eds): Gene Probes 2: A Practical Approach. Oxford, UK, IRL , 1995 , p 169

29. Godin I, Dieterlen-Lievre F, Cumano A: Emergence of multipotent hemopoietic cells in the yolk sac and paraaortic splanchnopleura in mouse embryos, beginning at 8.5 days postcoitus. Proc Natl Acad Sci USA 92:773, 1995[Abstract/Free Full Text]

30. Sanchez M-J, Holmes A, Miles C, Dzierzak E: Characterisation of the first definitive hematopoietic stem cells in the AGM and liver of the mouse embryo. Immunity 5:513, 1996[Medline] [Order article via Infotrieve]

31. Kriegler A, Verschoor SM, Bernardo D, Bertoncello I: The relationship between different high proliferative potential colony forming cells in mouse bone marrow. Exp Hematol 22:432, 1994[Medline] [Order article via Infotrieve]

32. Li L: Alagille syndrome is caused by mutations in human Jagged1, which encodes a ligand for Notch 1. Nature Genet 16:243, 1997[Medline] [Order article via Infotrieve]

33. Oda T, Elkahloun AG, Pike BL, Okajimi K, Krantz ID, Genin A, Piccoli DA, Meltzer PS, Spinner NB, Collins FS, Chandrasekharappa SC: Mutations in the human Jagged 1 gene are responsible for Alagille Syndrome. Nature Genet 16:235, 1997[Medline] [Order article via Infotrieve]

34. Jen W-C, Wettstein D, Turner D, Chitnis A, Kintner C: The Notch ligand, X-Delta 2, mediates segmentation of the paraxial mesoderm in Xenopus embryos. Development 124:1169, 1997[Abstract]

35. Dunwoodie SL, Henrique D, Harrison SM, Beddington RSP: Mouse Dll3: a novel divergent Delta gene which may complement the function of other delta homologues during early pattern formation in the mouse embryo. Development 124:3065, 1997[Abstract]

36. Li L, Milner LA, Deng Y, Iwata M, Banta A, Graf L, Marcovina S, Friedman C, Trask BJ, Hood L, Torok-Storb B: The human homolog of rat Jagged1 expressed by marrow stroma inhibits differentiation of 32D cells through interaction with Notch1. Immunity 8:43, 1998[Medline] [Order article via Infotrieve]

37. Moore K, Pytowski B, Witte L, Hicklin D, Lemischka IR: Hematopoietic activity of a stromal cell transmembrane protein containing epidermal growth factor like repeat motifs. Proc Natl Acad Sci USA 94:4011, 1997[Abstract/Free Full Text]


© 1998 by the American Society of Hematology.
 
0006-4971/98/92-0040$3.00/0

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Stem CellsHome page
M. Lahmar, C. Catelain, S. Poirault, M. Dorsch, J.-L. Villeval, W. Vainchenker, O. Albagli, and E. Lauret
Distinct Effects of the Soluble Versus Membrane-Bound Forms of the Notch Ligand Delta-4 on Human CD34+CD38low Cell Expansion and Differentiation
Stem Cells, March 1, 2008; 26(3): 621 - 629.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
S. Strehl, K. Nebral, M. Konig, J. Harbott, H. Strobl, R. Ratei, S. Struski, B. Bielorai, M. Lessard, M. Zimmermann, et al.
ETV6-NCOA2: A Novel Fusion Gene in Acute Leukemia Associated with Coexpression of T-Lymphoid and Myeloid Markers and Frequent NOTCH1 Mutations
Clin. Cancer Res., February 15, 2008; 14(4): 977 - 983.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
C. Delaney, B. Varnum-Finney, K. Aoyama, C. Brashem-Stein, and I. D. Bernstein
Dose-dependent effects of the Notch ligand Delta1 on ex vivo differentiation and in vivo marrow repopulating ability of cord blood cells
Blood, October 15, 2005; 106(8): 2693 - 2699.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
M. H. Dallas, B. Varnum-Finney, C. Delaney, K. Kato, and I. D. Bernstein
Density of the Notch ligand Delta1 determines generation of B and T cell precursors from hematopoietic stem cells
J. Exp. Med., May 2, 2005; 201(9): 1361 - 1366.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
J. S. Dando, M. Tavian, C. Catelain, S. Poirault, A. Bennaceur-Griscelli, F. Sainteny, W. Vainchenker, B. Peault, and E. Lauret
Notch/Delta4 Interaction in Human Embryonic Liver CD34+ CD38- Cells: Positive Influence on BFU-E Production and LTC-IC Potential Maintenance
Stem Cells, April 1, 2005; 23(4): 550 - 560.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
R. N. La Motte-Mohs, E. Herer, and J. C. Zuniga-Pflucker
Induction of T-cell development from human cord blood hematopoietic stem cells by Delta-like 1 in vitro
Blood, February 15, 2005; 105(4): 1431 - 1439.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
N. Tanimizu and A. Miyajima
Notch signaling controls hepatoblast differentiation by altering the expression of liver-enriched transcription factors
J. Cell Sci., July 1, 2004; 117(15): 3165 - 3174.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
V. Vas, L. Szilagyi, K. Paloczi, and F. Uher
Soluble Jagged-1 is able to inhibit the function of its multivalent form to induce hematopoietic stem cell self-renewal in a surrogate in vitro assay
J. Leukoc. Biol., April 1, 2004; 75(4): 714 - 720.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
C. M. Witt, V. Hurez, C. S. Swindle, Y. Hamada, and C. A. Klug
Activated Notch2 Potentiates CD8 Lineage Maturation and Promotes the Selective Development of B1 B Cells
Mol. Cell. Biol., December 1, 2003; 23(23): 8637 - 8650.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
G. F. Hoyne
Notch signaling in the immune system
J. Leukoc. Biol., December 1, 2003; 74(6): 971 - 981.
[Abstract] [Full Text]


Home page
BloodHome page
K. Klarmann, M. Ortiz, M. Davies, and J. R. Keller
Identification of in vitro growth conditions for c-Kit-negative hematopoietic stem cells
Blood, November 1, 2003; 102(9): 3120 - 3128.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
S. Vigouroux, E. Yvon, H.-J. Wagner, E. Biagi, G. Dotti, U. Sili, C. Lira, C. M. Rooney, and M. K. Brenner
Induction of Antigen-Specific Regulatory T Cells following Overexpression of a Notch Ligand by Human B Lymphocytes
J. Virol., October 15, 2003; 77(20): 10872 - 10880.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Schroeder, H. Kohlhof, N. Rieber, and U. Just
Notch Signaling Induces Multilineage Myeloid Differentiation and Up-Regulates PU.1 Expression
J. Immunol., June 1, 2003; 170(11): 5538 - 5548.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
B. Varnum-Finney, C. Brashem-Stein, and I. D. Bernstein
Combined effects of Notch signaling and cytokines induce a multiple log increase in precursors with lymphoid and myeloid reconstituting ability
Blood, March 1, 2003; 101(5): 1784 - 1789.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Stier, T. Cheng, D. Dombkowski, N. Carlesso, and D. T. Scadden
Notch1 activation increases hematopoietic stem cell self-renewal in vivo and favors lymphoid over myeloid lineage outcome
Blood, April 1, 2002; 99(7): 2369 - 2378.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
I.-K. Park, Y. He, F. Lin, O. D. Laerum, Q. Tian, R. Bumgarner, C. A. Klug, K. Li, C. Kuhr, M. J. Doyle, et al.
Differential gene expression profiling of adult murine hematopoietic stem cells
Blood, January 15, 2002; 99(2): 488 - 498.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. Kumano, S. Chiba, K. Shimizu, T. Yamagata, N. Hosoya, T. Saito, T. Takahashi, Y. Hamada, and H. Hirai
Notch1 inhibits differentiation of hematopoietic cells by sustaining GATA-2 expression
Blood, December 1, 2001; 98(12): 3283 - 3289.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
L. Walker, A. Carlson, H. T. Tan-Pertel, G. Weinmaster, and J. Gasson
The Notch Receptor and Its Ligands Are Selectively Expressed During Hematopoietic Development in the Mouse
Stem Cells, November 1, 2001; 19(6): 543 - 552.
[Abstract] [Full Text]


Home page
JEMHome page
A. C. Jaleco, H. Neves, E. Hooijberg, P. Gameiro, N. Clode, M. Haury, D. Henrique, and L. Parreira
Differential Effects of Notch Ligands Delta-1 and Jagged-1 in Human Lymphoid Differentiation
J. Exp. Med., October 1, 2001; 194(7): 991 - 1002.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. Ohishi, B. Varnum-Finney, R. E. Serda, C. Anasetti, and I. D. Bernstein
The Notch ligand, Delta-1, inhibits the differentiation of monocytes into macrophages but permits their differentiation into dendritic cells
Blood, September 1, 2001; 98(5): 1402 - 1407.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
F. N. Karanu, B. Murdoch, T. Miyabayashi, M. Ohno, M. Koremoto, L. Gallacher, D. Wu, A. Itoh, S. Sakano, and M. Bhatia
Human homologues of Delta-1 and Delta-4 function as mitogenic regulators of primitive human hematopoietic cells
Blood, April 1, 2001; 97(7): 1960 - 1967.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. Bennaceur-Griscelli, C. Pondarre, V. Schiavon, W. Vainchenker, and L. Coulombel
Stromal cells retard the differentiation of CD34+CD38low/neg human primitive progenitors exposed to cytokines independent of their mitotic history
Blood, January 15, 2001; 97(2): 435 - 441.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
N. Ohno, A. Izawa, M. Hattori, R. Kageyama, and T. Sudo
dlk Inhibits Stem Cell Factor-Induced Colony Formation of Murine Hematopoietic Progenitors: Hes-1-Independent Effect
Stem Cells, January 1, 2001; 19(1): 71 - 79.
[Abstract] [Full Text]


Home page
J. Immunol.Home page
H. T. Tan-Pertel, L. Walker, D. Browning, A. Miyamoto, G. Weinmaster, and J. C. Gasson
Notch Signaling Enhances Survival and Alters Differentiation of 32D Myeloblasts
J. Immunol., October 15, 2000; 165(8): 4428 - 4436.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. Ohishi, B. Varnum-Finney, D. Flowers, C. Anasetti, D. Myerson, and I. D. Bernstein
Monocytes express high amounts of Notch and undergo cytokine specific apoptosis following interaction with the Notch ligand, Delta-1
Blood, May 1, 2000; 95(9): 2847 - 2854.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
G. F. Hoyne, I. Le Roux, M. Corsin-Jimenez, K. Tan, J. Dunne, L. M. G. Forsyth, M. J. Dallman, M. J. Owen, D. Ish-Horowicz, and J. R. Lamb
Serrate1-induced Notch signalling regulates the decision between immunity and tolerance made by peripheral CD4+ T cells
Int. Immunol., February 1, 2000; 12(2): 177 - 185.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
J. Domen, S. H. Cheshier, and I. L. Weissman
The Role of Apoptosis in the Regulation of Hematopoietic Stem Cells: Overexpression of BCL-2 Increases Both Their Number and Repopulation Potential
J. Exp. Med., January 17, 2000; 191(2): 253 - 264.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
H. Harada, P. Kettunen, H.-S. Jung, T. Mustonen, Y. A. Wang, and I. Thesleff
Localization of Putative Stem Cells in Dental Epithelium and Their Association with Notch and FGF Signaling
J. Cell Biol., October 4, 1999; 147(1): 105 - 120.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
L. Walker, M. Lynch, S. Silverman, J. Fraser, J. Boulter, G. Weinmaster, and J. C. Gasson
The Notch/Jagged Pathway Inhibits Proliferation of Human Hematopoietic Progenitors In Vitro
Stem Cells, May 1, 1999; 17(3): 162 - 171.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
J. Ingles-Esteve, L. Espinosa, L. A. Milner, C. Caelles, and A. Bigas
Phosphorylation of Ser2078 Modulates the Notch2 Function in 32D Cell Differentiation
J. Biol. Chem., November 21, 2001; 276(48): 44873 - 44880.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jones, P.
Right arrow Articles by Enver, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jones, P.
Right arrow Articles by Enver, T.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 1998 by American Society of Hematology         Online ISSN: 1528-0020