|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 92 No. 5 (September 1), 1998:
pp. 1576-1585
Neutrophils Deficient in PU.1 Do Not Terminally Differentiate or
Become Functionally Competent
By
Karen L. Anderson,
Kent A. Smith,
Frederic Pio,
Bruce E. Torbett, and
Richard A. Maki
From The Burnham Institute and the Department of Immunology, The
Scripps Research Institute, La Jolla, CA.
 |
ABSTRACT |
PU.1 is an ets family transcription factor that is expressed
specifically in hematopoietic lineages. Through gene disruption studies
in mice we have previously shown that the expression of PU.1 is not
essential for early myeloid lineage or neutrophil commitment, but is
essential for monocyte/macrophage development. We have also shown that
PU.1-null (deficient) neutrophils have neutrophil morphology and
express neutrophil-specific markers such as Gr-1 and chloroacetate
esterase both in vivo and in vitro. We now demonstrate that although
PU.1-null mice develop neutrophils, these cells fail to terminally
differentiate as shown by the absence of messages for neutrophil
secondary granule components and the absence or deficiency of cellular
responses to stimuli that normally invoke neutrophil function.
Specifically, PU.1-deficient neutrophils fail to respond to selected
chemokines, do not generate superoxide ions, and are ineffective at
bacterial uptake and killing. The failure to produce superoxide could,
in part, be explained by the absence of the gp91 subunit of
nicotinamide adenine dinucleotide phosphate oxidase, as shown by our
inability to detect messages for the gp91phox
gene. Incomplete maturation of PU.1-deficient neutrophils is cell
autonomous and persists in cultured PU.1-deficient cells. Our results
indicate that PU.1 is not necessary for neutrophil lineage commitment
but is essential for normal development, maturation, and function of
neutrophils.
© 1998 by The American Society of Hematology.
 |
INTRODUCTION |
NEUTROPHILS ARE key effector cells in the
host defense response to microbial invasion. These cells are highly
specialized for their function, which is to detect and neutralize
primarily bacteria, but also fungi and parasites. Successful
containment and elimination of microbial invasion requires an intact
and coordinated cascade of events within neutrophils, from attraction
and movement to the site of infection, to recognition and uptake of the
organism, and effective killing mechanisms. The genes for a number of
molecules involved in these processes have been cloned and have been
shown by in vitro assays to be potentially regulated by the ets
family transcription factor PU.1. Such genes include the 2 integrin components CD11b1 and CD18,2 neutrophil
elastase,3 and Fc receptors I and III.4,5
PU.1 is also implicated in the regulation of receptors for key myeloid
growth factors including macrophage (M)-, granulocyte (G)-, and
granulocyte-macrophage (GM)- colony-stimulating factor (CSF).6-8 These receptors influence the survival,
proliferation, maturation, and functional capacity of
neutrophils.9-11
Mice with a targeted disruption of the PU.1 gene exhibit multiple
hematopoietic abnormalities. Although erythroid and megakaryocytic lineages are intact, PU.1-null mice are born with no detectable leukocytes. There is a delayed formation of the thymus, with T cells
absent until approximately 1 week after birth.12
Neutrophils, as defined by their segmented nuclear morphology content
of chloroacetate esterase (CAE)13 and expression of
Gr-114 are not apparent at birth in these mice, but do
begin to appear in hematopoietic tissues several days afterward. The
mice die within 2 days after birth of overwhelming systemic bacterial
infection. They can be kept alive for up to 2 weeks with
intensive antibiotic therapy during which time neutrophil numbers
increase slightly but remain severely depressed compared with normal
littermates.12 Mature macrophages and B cells are not
detectable in PU.1-null mice of any age.
In our previous study15 we found that myeloid progenitors
can give rise to cells with segmented nuclear morphology that are CAE-
and Gr-1-positive. However, unlike normal neutrophils, interleukin-3
(IL-3), but not G-CSF, will support their survival and
growth.15 Furthermore, PU.1-deficient neutrophils fail to express surface CD11b12 and PU.1-deficient myeloid cells
either directly from mice or after short-term culture and have
virtually undetectable levels of receptors for the myeloid growth
factors G-, GM-, and M-CSF.15 In our current study we
document that neutrophils deficient in PU.1 fail to perform important
effector functions such as response to chemotactic stimuli or
generation of a respiratory burst. We show that the absence of a
respiratory burst (as demonstrated by superoxide production) is
consistent with a failure of PU.1-deficient neutrophils to transcribe
detectable messages for the gp91phox gene, which
encodes a critical subunit of the enzyme nicotinamide adenine
dinucleotide phosphate (NADPH) oxidase. Additionally, these cells are
less efficient at phagocytosis and less effective at bacterial killing
than normal cells. Although PU.1-deficient cells do express primary
(azurophil) granule component genes, they do not express detectable
levels messages for secondary (specific) granule components, the
appearance of which is associated with normal terminal neutrophil
maturation beyond the promyelocyte stage.16,17 Finally, we
have documented that cultured neutrophils derived from PU.1-null mice
do not express PU.1 protein at a detectable level. The results of these
studies are consistent with the interpretation that the PU.1 gene
product is required for normal neutrophil function and terminal
differentiation.
 |
MATERIALS AND METHODS |
Isolation and culture of neonatal hematopoietic cells.
Cultures were derived by mechanically disrupting one to three whole
neonatal livers, lysing red blood cells with 0.15 mol/L ammonium
chloride solution, and plating remaining cells in a T25 tissue culture flask (Costar, Cambridge, MA). Cultures
were maintained in Iscoves's media supplemented with 20% fetal calf
serum, 1% IL-3-conditioned media (from X63 cells, a gift of F. Melchers, Basel Institute), 1 ng/mL G-CSF, and 1 ng/mL GM-CSF (R & D
Systems, Minneapolis, MN).
Separation of neutrophils.
The combination of factors used (IL-3, G-CSF, and GM-CSF; as described
above) yielded predominantly neutrophils from normal individuals
between 5 and 10 days of culture. To separate neutrophils from normal
cultures, nonadherent cells were removed from flasks and placed into a
fresh tissue culture dish. Any remaining macrophages were permitted to
adhere for 1 to 2 hours. After this step, the remaining nonadherent
cells were >95% neutrophils as determined by Wright-Giemsa
morphology. This was further confirmed by Gr-1 immunostaining of
methanol-fixed cytospin preparations as described.12 A
small number of macrophages and megakaryocytes (<5%) comprised the
remainder of cells present.
Cytochemical staining.
Method for CAE staining was previously described.12
Measurement of neutrophil chemotaxis.
Chemotaxis was assessed using a 3-µm pore diameter polycarbonate
membrane transwell apparatus (Costar) as directed by the manufacturer.
Chemotactic agents added to the lower chamber included fMLP, 50 nmol/L
(Sigma, St Louis, MO); and Gro and IL-8, 50 nmol/L (R & D Systems).
To the upper chamber, 106 cells/mL in media were added and
allowed to migrate in a humidified atmosphere at 37°C
for 90 minutes (and for up to 4 hours). Negative control contained only
media in the upper and lower compartments. Cell migration was assessed
by counting the number of cells present in the bottom chamber after the
incubation period.
Microassay of superoxide ion (O2 )
production by cytochrome c reduction.
In a 96-well plate (Microtest III, Falcon; Becton Dickinson, Franklin
Lakes, NJ) 105 neutrophils per well were suspended in a
100-mL volume of PiCM-G buffer18 containing 150 mmol/L
cytochrome c (horse heart; Sigma). The method is a slight modification
of previously published methods.18,19 Baseline
O2 production was assessed by examining
wells containing cells with no stimulant; blank wells contained cells
plus the inhibitor superoxide dismutase (bovine erythrocyte; Sigma).
Test wells contained cells plus 0.1 mg/mL phorbol myristate acetate
(PMA; Sigma). Plates were incubated for 1 hour at 37°C
and read at 550 nm. Absorbance was converted to nanomoles of O2 using the following extinction
coefficient of cytochrome c: E550 nm = 21 × 103 mol/L 1cm 1
and the formula (nmol O2 per well) = (absorbance at 550 nm × 15.87) for the volume and plate
type used.19
Neutrophil phagocytosis assay.
Heat-killed Staphylococcus aureus (American Type Culture
Collection S aureus 502A) were labeled with 0.01% fluorescein
isothiocyanate (FITC) isomer I (Sigma) for 30 minutes at room
temperature and then washed three times with phosphate-buffered saline
(PBS). In a 1-mL volume of Hanks' balanced salt solution
(HBSS) 107 labeled organisms were incubated with
106 normal or PU.1-deficient neutrophils for 2 hours at
37°C. To distinguish between bacteria adhered to the
cell surface and internalized bacteria, which are a measure of
phagocytosis, cells were then incubated with red cell lysing solution
for 5 minutes, which quenches the signal from externally bound
organisms.20 Cells were then stained with phycoerythrin
(PE)-labeled Gr-1 (Pharmingen, San Diego, CA). Bacterial phagocytosis
by Gr-1+ cells was assessed quantitatively with a Becton
Dickinson FACScan and the two-color flow cytometry results were
analyzed using Cell Quest (Becton Dickinson). General conditions for
flow cytometry analysis were as previously described.12
Neutrophil killing of live bacterial organisms.
Bacterial uptake and killing by neutrophils was assessed as previously
described.21 In HBSS with 107 live S aureus
(502A) or Escherichia coli (JM109), 2 × 106 cells from normal or PU.1-null neonatal liver cultures
were suspended for 2 hours in a volume of 1 mL. Before incubation for 2 hours, 0.1 mL of a 1:10,000 dilution of the cells and bacteria
(equivalent to 100 bacteria) was immediately removed and plated to
serve as a Time 0 (control) colony count. Selection of bacterial growth media was as previously described.21 Time 0 plates were
counted after 24 hours at 37°C. To determine total
viable bacteria, 0.1 mL of the cells and bacteria mixture was diluted
in water to lyse cells, then diluted similarly to Time 0 samples and
plated in appropriate medium. Colonies were counted after a 24-hour
incubation at 37°C. The percent of total viable
bacteria was calculated as: (24-hour colony count of total
intracellular and extracellular bacteria remaining after 2-hour
incubation with cells/colony count for Time 0) × 100. To
determine viable intracellular bacteria, 0.1 mL of the mixture was
incubated with 500 U/mL lysostaphin for 20 minutes at
37°C to kill remaining extracellular bacteria
(S aureus) or differentially centrifuged to pellet
cells but not free bacteria (E coli), diluted, and then cells
were lysed in water and plated. Colonies were counted after a 24-hour
incubation at 37°C. The percent of viable intracellular
bacteria was calculated as: (24-hour colony count of intracellular
bacteria remaining after 2-hour incubation with cells after removal of
extracellular bacteria/colony count for Time 0) × 100. Samples
were run in triplicate and results are reported as mean ± standard
deviation (SD).
Isolation of RNA and reverse transcription polymerase chain reaction
(RT-PCR) analysis.
Total RNA was isolated from 0.5 to 5 × 106 cultured
cells using Trizol (GIBCO-BRL, Gaithersburg, MD) as directed by the
manufacturer and subjected to DNase I treatment (10 U for 30 minutes at
37°C; Boehringer-Mannheim GmbH, Mannheim, Germany).
Total RNA (0.25 µg) was reverse transcribed using Superscript II
(GIBCO-BRL) and one tenth of the reaction subjected to PCR using the
following conditions: 94°C × 1 minute, 55°C
to 65°C × 1 minute, 72°C × 1 minute for 30 cycles in a Perkin-Elmer thermocycler
(GeneAmp 9600; Perkin-Elmer, Norwalk, CT). Negative control reactions
for RT-PCR contained RNA template that had not undergone reverse
transcription. An aliquot (25 µL) of each 50-µL PCR reaction was
run in a 1.5% agarose gel with ethidium bromide and photographed. PCR
primers used included the following (listed 5 to 3 ):
myeloperoxidase: 5 ATGCAGTGGGGACAGTTTCTG; 3
GTCGTTGTAGGATCGGTACTG; elastase: 5 CACCATCAGTCAGGTCTTCC;
3 AGTCTCCGAAGCATATGCC; cathepsin G: 5
CTGACTAAGCAACGGTTCTGG; 3 GATTGTAATCAGGATGGCGG; lysozyme:
5 CTGCAGGATGACATCACTGC; 3 TGCTGAGGCCTGTACTTAGAGG;
lactoferrin: 5 AAGCCAGGCTTGTCCTCTAG; 3
TCTCATCTCGTTCTGCCACC; gelatinase: 5 ACGGTTGGTACTGGAAGTTCC;
3 CCAACTTATCCAGACTCCTGG; gp91: 5 TTGTGAGAGGTTGGTTCGG; 3 TCCAGTCTCCAACAATACGG; p22: 5 AGGGGTCCACCATGGAGCGA;
3 GCTCAATGGGAGTCCACTGC; p47: 5 AACGTAGCTGACATCACAGGC;
3 TCCAGGAGCTTATGAATGACC; p67: 5 GCTATTTGGGTTTGTGCCTG;
3 GGAACAAGCCCCTTCTGCCC.
Western blot detection of PU.1.
Cells were cultured and obtained as described above. Total cell
extracts were prepared by lysis in RIPA buffer (PBS, 1% NP40, 0.5%
sodium deoxycholate, 0.1% sodium dodecyl sulfate [SDS]) plus protease inhibitors. Nuclear extracts were prepared from
106 to 107 cells as
described.22 Proteins were resolved in a 10%
to 12% SDS-polyacrylamide gel and transferred to nitrocellulose
membranes (Hybond ECL; Amersham LifeScience, Arlington Heights, IL).
Full-length PU.1-GST fusion protein and anti-PU.1-GST antibody were
made as follows. PU.1 cDNA was amplified by PCR from the plasmid
25.1-123 with primers containing BamHI or
EcoRI ends and gel purified. PGEXKG (a derivative of PGEX2T)
was digested with BamHI and EcoRI. The amplified PU.1
fragment was subcloned into the vector and the insert was sequenced.
Bacteria were transformed and PU.1-GST fusion protein purified from
bacteria using glutathione agarose beads as described.24
Rabbits were immunized repeatedly with the purified PU.1-GST fusion
protein and antiserum collected. This antiserum was affinity purified
before use in Western blotting. Alternately, commercially available
anti-PU.1 polyclonal antibody directed against the C-terminus of PU.1
(Santa Cruz Biotechnology, Santa Cruz, CA) was used. Polyclonal
antiactin antibody was obtained from Sigma. Secondary antibody was
peroxidase-linked anti-rabbit IgG (Santa Cruz). These antibodies were
incubated with the blotted membrane, and immunoreactive proteins
detected by an enhanced chemiluminescence (ECL, Amersham) visualization
method.
 |
RESULTS |
PU.1-deficient neutrophils have an aberrant phenotype in vivo and in
vitro.
Neutrophils typically have multilobed nuclei and light blue to
colorless cytoplasm containing variable sizes and number of azurophilic
granules25 (Fig 1A). Cells
identified as neutrophils in PU.1-null mice shared this basic
morphology. These cells stained positively for the neutrophil surface
marker Gr-112 and for the intracellular enzyme
chloroacetate (specific) esterase (CAE). Gr-1+ cells from
PU.1-null mice were also CD18+.12 However,
unlike normal neutrophils, the majority did not have detectable cell
surface CD11b.12 We previously showed that PU.1-deficient
hematopoietic cells did not survive or grow when cultured in the
presence of either M-CSF, G-CSF, or GM-CSF, and this is due at least in
part to a failure to express surface receptors for these
cytokines.15 In contrast, IL-3 did support PU.1-deficient hematopoietic cell survival and expansion. When PU.1-null neonatal liver, spleen, or bone marrow cells were cultured in IL-3, the majority
of cells produced had neutrophil morphology as shown in Fig 1B and C,
and histochemical and flow cytometric analysis showed these cells to be
CAE+ (Fig 1E and F), Gr-1+
(Fig 2C), CD18+ (Fig 2D), and
primarily CD11b (Fig 2D). Unlike cultures
established from normal neonatal liver in which large numbers of
terminally differentiated neutrophils were produced in the first 2 weeks but then neutrophil production dropped off dramatically, cultures
established from PU.1-null neonates producing neutrophils as the
principal cell type have been maintained for longer than 6 months (Fig
1C and F). The CAE, Gr-1, CD18, and CD11b staining characteristics of
these long-term cultured PU.1-deficient cells were identical to
short-term (<2 weeks) cultured PU.1-deficient cells, as well as cells
isolated directly from older PU.1-null mice (Fig 1 and Fig 2, data not shown).

View larger version (92K):
[in this window]
[in a new window]
| Fig 1.
Wright-Giemsa morphology and CAE staining characteristics
of PU.1-deficient neutrophils are similar to neutrophils from normal
individuals. Neutrophils cultured from normal neonates as described in
Materials and Methods are shown (A). Cells cultured from neonatal
PU.1-null mice after 12 days (B) and >6 months (C) have similar
polymorphonuclear morphology. Note presence of mitotic cells in
PU.1-deficient cultures (B and F). Abundant CAE activity as indicated
by red granules in PU.1-deficient cells (E and F) is also evident, as
in normal neutrophils (D).
|
|

View larger version (54K):
[in this window]
[in a new window]
| Fig 2.
Gr-1+ PU.1-deficient neutrophils are
deficient in CD11b, but not CD18 expression. Short-term cultured (see
Materials and Methods) liver-derived hematopoietic cells from normal
(panels A and B) or PU.1-null (panels C and D) neonatal mice were
assessed by two-color flow cytometry for CD11b (FITC) and Gr-1 (PE)
(panels A and C) or CD11b (FITC) and CD18 (PE) (panels B and D)
expression. Note the vastly reduced expression of CD11b on
PU.1-deficient cells (compare panels A and C) but the presence of CD18
on the majority (86%) of the PU.1-deficient cells (compare panels B
and D).
|
|
Neutrophils lacking PU.1 fail to respond to chemotactic stimuli.
To effectively control infection, neutrophils must detect and respond
to bacterial invasion. Many different molecules associated with the
inflammatory process can attract peripheral blood neutrophils to the
affected tissue site. These chemotactic factors include products
released from the invading organisms themselves (such as
N-formyl-methionyl-leucyl-phenylalanine [fMLP] or lipopolysaccharide) as well as those produced by the host, including plasma-derived components like complement fragment 5a, and cell-secreted molecules such as IL-8.26 To test the responsiveness of
PU.1-deficient versus normal cells in vitro three different chemokines
were used. Neutrophils that were isolated and expanded as described
(see Materials and Methods) were assessed for their ability to respond to IL-8, Gro , and fMLP by using standard migration assays.
PU.1-deficient cells did not respond to any of these chemotactic agents
at any significant level above background (media only)
(Fig 3). In comparison, normal cells
migrated at a higher level in the wells with media alone, and increased
their migration threefold to fourfold on exposure to chemokines (Fig
3). When the migration period was extended to as long as 4 hours, PU.1-deficient cells still did not migrate above background
levels (data not shown). We detected expression of messages for IL-8
and fMLP receptors in both normal and PU.1-deficient neutrophils using
RT-PCR (data not shown). This suggests that absence of receptor gene
expression did not account for the loss of chemotactic response of
PU.1-deficient cells. However, the presence of IL-8 and fMLP surface
receptors was not directly assessed. Interestingly, when exposed to
fMLP or PMA, PU.1-deficient cells could be induced to adhere to
untreated plastic dishes at a level comparable to normal cells (data
not shown). Thus this aspect of chemotaxis was not demonstrably
affected.

View larger version (31K):
[in this window]
[in a new window]
| Fig 3.
PU.1-deficient neutrophils fail to respond to chemokines.
Normal ( , ) or PU.1-deficient ( , ) cells migrating across a
transwell device were counted after 90 minutes in the presence of IL-8,
fMLP, GRO , or media alone. Samples were run in triplicate and the
results of a representative experiment are presented as mean ± SD.
|
|
PU.1-deficient cells fail to undergo normal neutrophil activation.
On exposure to various molecules associated with inflammation,
including bacterial components and other soluble factors such as IgG
immune complexes in vivo or PMA in vitro, the normally glycolytic
neutrophil rapidly undergoes a dramatic increase in oxygen consumption.
This is referred to as the neutrophil "respiratory burst,"27 during which reactive oxygen metabolites are
generated. To test the ability of PU.1-deficient neutrophils to produce
the crucial metabolite superoxide (O2 ),
deficient and normal neutrophils were stimulated with PMA and scored
for their ability to reduce the dye nitroblue tetrazolium. Microscopic
assessment of cells revealed that 50% of neutrophils from normal mice
were positive for the reaction product after stimulation, whereas no
detectable black precipitate was seen in the PU.1-deficient cells (data
not shown). To specifically quantitate production of
O2 , a superoxide dismutase-inhibitable
cytochrome c reduction assay was performed. Baseline and PMA-stimulated
O2 production by PU.1-deficient
neutrophils was minimal and identical, and less than baseline
production by normal neutrophils as well (Fig 4). In comparison, normal cells
increased O2 production roughly 10-fold
after stimulation with PMA (Fig 4).

View larger version (15K):
[in this window]
[in a new window]
| Fig 4.
Absence of production of O2 by
PU.1-deficient neutrophils in response to activation by PMA.
O2 production was assessed in normal
( , ) and PU.1-deficient ( , ) neutrophils by colorimetric
detection of cytochrome c reduction. Baseline (A) and post-PMA
stimulation (B) levels of O2 were measured.
Samples were run in triplicate and the results of a representative
experiment are presented as mean ± SD.
|
|
Message for gp91phox is undetectable in PU.1-deficient
neutrophils.
A single enzyme, NADPH oxidase, is responsible for
O2 production in myeloid cells. This
enzyme is composed of two membrane bound subunits, gp91 and p22, and
two cytoplasmic subunits, p47 and p67, which are synthesized
constitutively in myeloid cells. When the cells receive an appropriate
stimulus, the subunits are assembled on the membrane to form an active
complex. To determine whether any or all of the subunits were absent,
cultured PU.1-deficient neutrophils were assessed for message for the
various subunits by RT-PCR. We selected message- rather than
protein-based detection of NADPH oxidase components, given the
instability of p22 or gp91 proteins in the absence of its respective
partner and the possibility of low amounts of protein components in
cultured PU.1-deficient neutrophils. As can be seen in
Fig 5, messages for all subunits were
detectable with the exception of gp91phox. Our
results from RT-PCR do not allow us to determine if the loss of PU.1
alters p22phox, p47phox, and
p67phox message levels. Thus, failure to generate
O2 by PU.1-deficient cells (Fig 4)
seems, at least in part, to be due to the absence of detectable message
for the gp91 subunit of NADPH oxidase.

View larger version (53K):
[in this window]
[in a new window]
| Fig 5.
Neutrophils deficient in PU.1 fail to transcribe the
gp91phox gene. RNA was prepared, reverse
transcribed, and subjected to PCR as described in Materials and
Methods. These samples were obtained from 2-week cultures. All NADPH
oxidase component subunits were detectable in one normal (lane 4) and
three different PU.1-deficient cultured neutrophil samples (lanes 1 through 3) by this method except for gp91, which was only found in
normal cells. Controls for amplification of DNA in the absence of
reverse transcription for each reaction were negative; these data are
not shown. bp, base pairs.
|
|
PU.1-deficient neutrophils are less efficient phagocytes.
We used flow cytometry to assess the ability of Gr-1+
neutrophils to ingest FITC-labeled, heat-killed S
aureus (SAFITC) in vitro. After incubation with
labeled bacteria, neutrophils were treated with an agent to
differentiate between surface-bound and internalized
bacteria.20 As shown in Table
1, Gr-1+ PU.1-deficient neutrophils were capable of
bacterial uptake (12% and 6% v 16%
SAFITC+/Gr-1PE+ cells), with only slight
differences in the numbers of Gr-1+ PU.1-deficient
neutrophils capable of bacterial uptake as compared with controls. More
striking was the difference in quantity of SAFITC ingested,
as reflected by higher median FITC channel fluorescence of normal
neutrophils (217) as compared with PU.1-deficient samples (83 and 160). Addition of IgG or serum as an opsonin to the reaction mix did not increase the level of phagocytosis (data not shown). We
subsequently determined whether receptors for IgG (Fc R) were present
on Gr-1+ cells. Similar percentages of
Gr-1+/Fc R+ cells were seen in normal and
PU.1-deficient cultured cells (data not shown), although the antibody
used did not allow distinction between Fc R types II and III.
Therefore, the reduced uptake of bacteria by PU.1-deficient cells does
not seem to be the consequence of failure to express any surface
receptors for IgG, although each type was not specifically assessed and
quantified. Furthermore, uptake of unopsonized bacteria by
PU.1-deficient cells was also reduced compared with normal cells and
this is not dependent on Fc receptors. These results indicate that
Gr-1+ PU.1-deficient neutrophils are somewhat less
efficient phagocytes than their normal counterparts.
Neutrophils deficient in PU.1 are less effective at uptake and
killing of live bacteria.
The uptake of bacteria by neutrophils is normally followed by killing
of the organisms within the phagocytic vacuole. The microbicidal
capabilities of neutrophils are broadly grouped into oxygen-dependent
and oxygen-independent mechanisms. The former group includes NADPH
oxidase and myeloperoxidase, and its effectiveness centers on the
ability to generate reactive oxygen radicals. The latter group includes
an array of antimicrobial cationic proteins and hydrolytic enzymes,
such as cathepsin G, lactoferrin, and lysozyme. PU.1-deficient
neutrophils lack the ability to generate O2 ; therefore we tested the ability of
PU.1-deficient and normal cells to kill live S aureus and E
coli organisms in vitro. As summarized in
Table 2, PU.1-deficient cells are notably
less effective in the uptake (with 1.7 to 4.6 times greater total
viable bacteria remaining in PU.1-deficient samples) and killing (with 2 to 20 times greater viable intracellular bacteria recovered from
PU.1-deficient samples) of both gram-negative and gram-positive bacteria.
PU.1-deficient neutrophils express primary granule genes but fail to
express specific granule genes.
The promyelocyte stage of neutrophil development is characterized by
the appearance of azurophil (primary) granule components such as
myeloperoxidase, neutrophil elastase, and cathepsin G. Messages for
these components were readily detected in both PU.1-deficient and
normal cultured neutrophils (Fig 6 and data
not shown). Normal and PU.1-deficient neutrophils also had comparable
levels of myeloperoxidase enzyme activity (data not shown). However,
certain genes that are normally expressed at the later myelocyte stage,
encoding the secondary (or specific) granule components neutrophil
gelatinase and lactoferrin, were either not detected (gelatinase) or
expressed episodically at a virtually undetectable level (lactoferrin)
in PU.1-deficient cells as compared with normal cells (Fig 6).
Interestingly, lysozyme, another component of neutrophil granules found
in both primary and secondary granules,27 did not appear to
be expressed in PU.1-deficient cells at a detectable level (Fig 6).

View larger version (56K):
[in this window]
[in a new window]
| Fig 6.
Primary but not secondary granule genes are expressed in
PU.1-deficient neutrophils. RNA was prepared, reverse transcribed, and
subjected to PCR as described in Materials and Methods. Data shown are
from representative normal (+/+) and PU.1-deficient ( / ) cells
cultured for 2 weeks as described in Materials and Methods. Controls
for amplification of DNA in the absence of reverse transcription for
each reaction were negative; these data are not shown. act, actin; NE, neutrophil elastase; MPO, myeloperoxidase; LF, lactoferrin;
NG, neutrophil gelatinase; LZ, lysozyme.
|
|
PU.1 protein is undetectable in cultured neutrophils from PU.1-null
mice.
Given the possibility in gene-disrupted mice of read-through or
splicing-out of the targeting cassette in the targeted gene, thus
generating a partial or aberrant protein or reduced amount of
full-length protein, we assessed PU.1 expression in PU.1-deficient cultured cells by Western blotting. Because PU.1 messages are normally
highly expressed in neutrophils,28 these cells represent an
ideal population to examine. We used antisera recognizing both the
C-terminal portion of PU.1 as well as one raised against an entire
PU.1-GST fusion protein.
Figure 7A depicts PU.1 expression in normal
and PU.1-deficient cultured neutrophil total cell extracts using the
anti-C-terminal antibody. Whereas a PU.1 signal was detected in 50 µg of whole cell extract from normal neutrophils (lane 3) and the
B-cell line A20-2J (lane 2), it was not detected in 50 (lanes 4 and 6),
100 (lane 5), or 250 µg (lane 7) of PU.1-deficient cell extract.
Using a polyclonal anti-PU.1-GST antisera, we were able to detect a
PU.1 signal using 2.5 µg of nuclear extract from normal neutrophils
(Fig 7B, lane 4). In contrast, even when a fivefold excess of nuclear
protein from PU.1-deficient cultured neutrophils was probed, no PU.1
signal was evident (Fig 7B, lanes 2 and 3). Thus, we conclude that PU.1
gene targeting has effectively resulted in undetectable levels of the
PU.1 gene product in this lineage.

View larger version (39K):
[in this window]
[in a new window]
| Fig 7.
PU.1 protein is detectable in normal neutrophils but not
PU.1-deficient neutrophils. (A) Total protein prepared from cultured
neutrophils was separated on a 10% SDS-polyacrylamide gel, blotted,
and probed with an antibody directed against the C-terminus of PU.1
(Santa Cruz). Note PU.1 signal around 40 kD in 50 µg of extract from
the B-cell line A20-2J (lane 2) and normal neutrophils (lane 3), but
not in lanes 4 through 7 containing 50 µg (lanes 4 and 6), 100 µg
(lane 5), and 250 µg (lane 7) from PU.1-deficient neutrophil cell
lines (#503 and #897) derived from two different PU.1-null mice.
Although lane 4 containing #503 did not react with the antiactin
antibody, lanes 5 and 7 (containing a twofold and fivefold excess of
the same extract) clearly reflect an excess of protein present and show
no PU.1 signal. Lane 1 contains the T-cell line BW.5147.7 that does not
express PU.1. (B) Nuclear protein, 2.5 to 12.5 µg, prepared from
cultured cells was separated on a 12% SDS-polyacrylamide gel, blotted,
and probed with a polyclonal anti-PU.1-GST fusion protein antibody. No
signal was detectable in PU.1-deficient cell lines in lanes 2 and 3 even at a fivefold excess of nuclear protein compared with normal
neutrophils in lane 4. Lane 1 contains the T-cell line EL-4 which does
not express PU.1.
|
|
 |
DISCUSSION |
The neutrophil lineage is affected in multiple ways by loss of PU.1
expression. Cells displaying neutrophil markers do not appear in
PU.1-null mice until 2 to 3 days after birth, compared with appearance
in normal mice around embryonic day 12. Additionally, neutrophil
numbers remain extremely low (10- to 100-fold reduced depending on the
tissue) in PU.1-null mice by 10 days after birth (K.L.A. and
B.E.T., unpublished data, February 1996). The cells that develop
in the PU.1-null mouse have segmented nuclear morphology, express
Gr-1,14 and the neutrophil enzyme CAE.13
However, unlike normal neutrophils, very few Gr-1+
PU.1-deficient cells express CD11b, although most
Gr-1+ cells from these mice express
CD1812 (Fig 2). As we have recently documented,
PU.1-deficient hematopoietic cells have virtually undetectable surface
receptors for the myeloid growth factors M-, G-, and
GM-CSF.15 These characteristics persist when PU.1-deficient cells are expanded in in vitro cultures using IL-3.15
The stages of neutrophil differentiation are identified by the
acquisition of characteristic morphological features and the expression
of various surface receptors and intracellular proteins. As necessary
molecular components are synthesized, the developing neutrophils attain
functional competency. The capacity for cell division is normally lost
as the cells achieve later stages of differentiation. One of the
earliest recognizable stages, the promyelocyte, is associated with
active primary granule component synthesis. At the subsequent myelocyte
stage, secondary or specific granule components are produced.
Myelocytes also begin to acquire the capacity for the functions of
mobility and phagocytosis. Furthermore, mitosis is still possible at
this stage but not at subsequent stages. The more mature, nonmitotic
stages (metamyelocytes, bands, and mature neutrophils) are identified
by their increasingly segmented nuclear morphology, decreasing granule
content, and increasing glycogen accumulation.27
Gr-1+ CAE+ neutrophils that develop with no
detectable PU.1 protein can be expanded in vitro. These cells have
characteristics of immature neutrophil stages but lack certain features
and abilities associated with mature neutrophils. In comparison to
neutrophils cultured from normal animals which achieve terminal
differentiation and die, cells derived from PU.1-null mice continue to
proliferate indefinitely. PU.1-deficient cells are unresponsive to G-
and GM-CSF, and will only survive and grow in IL-3-containing
medium.15 Their phenotypic and functional characteristics
are summarized in Table 3. We have detected
expression of primary granule genes, including myeloperoxidase,
elastase, and cathepsin G. Expression of elastase is notable because
this promoter has been shown to be regulated by PU.1 in vitro; however,
these investigators also found transactivation of their promoter
construct by ets-2,3 a ubiquitously expressed ets
protein.29 Thus, in vivo complementation to some degree by
other ets family members may account for our observation of
elastase messages in PU.1-deficient neutrophils. Although Spi-B is more
closely related to PU.1 than other ets family members, and
shares the ability to bind to a number of the same promoter elements in
vitro, this transcription factor is not detectably expressed in
normal28 or PU.1-deficient neutrophils (K.L.A., unpublished
results). Finally, the absence of detectable messages for
lysozyme, a granule protein found in both primary and secondary
granules, is notable. Given the presence of messages for other primary
granule genes in PU.1-deficient neutrophils, and the demonstration that
PU.1 can activate the myeloid-specific enhancer of the chicken lysozyme
gene,30 it is tempting to speculate that transcription of
the lysozyme gene, in contrast to the elastase gene, requires PU.1.
Unlike messages for primary granule component genes, however, those
encoding secondary or specific granule components are not detectably
expressed in PU.1-deficient cells. Because the onset of transcription
of these genes occurs at a stage-specific point of neutrophil
maturation, it has been hypothesized that all of these genes are
regulated by a common trans-acting factor.31 Furthermore,
individuals with the rare congenital disorder specific granule
deficiency that have absent or abnormal specific granules and severely
deficient or absent granule proteins have no or minimal mRNA for any of
the specific granule components, lending further credence to this
theory.32,33 The episodic and virtually undetectable message for lactoferrin might be consistent with the possibility that
PU.1-deficient neutrophils are attempting to initiate programs for
later stages of development, but cannot do so because of a developmental arrest. Myeloid leukemia cells such as HL60 do not express these proteins even when induced to differentiate along the
granulocyte pathway.34 Thus, the appearance of these
components is associated with late stages of normal neutrophil
maturation. To date, PU.1 regulatory elements have not been shown in
the promoter regions of specific granule genes, and it is not known
whether PU.1 plays a direct or indirect role in the normal regulation of these genes. Conceivably, signaling through CD11b or G- or GM-CSF
receptors, which are not expressed on PU.1-deficient neutrophils, may
be required for activation of specific granule genes in developing neutrophils via other transcription factors. Mice that have been gene
disrupted for these individual receptors or their corresponding cytokines35-39 have not been specifically assessed for
expression of these genes; however, descriptions of their respective
phenotypes do not support a specific granule deficiency. Alternatively,
PU.1 may be responsible for regulating the transcription or activity of
factor(s) that directly regulate these promoters. Complementation experiments with PU.1 as well as CD11b and G- and GM-CSF receptors are
underway to address these questions.
The acquisition of full functional competency is also associated with
the final stages of neutrophil maturation. The functional deficiencies
of neutrophils lacking PU.1 are summarized in Table 3. Although we
could show adherence of PU.1-deficient cells in response to PMA or
fMLP, these cells failed to migrate when stimulated with IL-8, Gro ,
or fMLP. We were able to detect messages for IL-8 and fMLP chemokine
receptors, suggesting that PU.1 loss does not abrogate receptor gene
expression. Members of this family of receptors mediate their effects
via a multitude of signaling molecules including heterotrimeric G
proteins, phospholipase C, small GTP-binding proteins,
phosphoinositol 3-kinase, and the MAP kinase
cascade.40 The possibility of abnormalities in cell surface
IL-8 and fMLP receptor expression, downstream signaling, or cellular
processes governing motility in PU.1-deficient neutrophils has not been
further explored at this time.
PU.1-deficient cells also failed to generate a respiratory burst. This
phenomenon represents the conversion of molecular oxygen to the radical
superoxide (O2 ) that is mediated by the
phagocyte-specific enzyme NADPH oxidase. O2 is the precursor to a number of
potent oxidants (including H2O2, HOCl, and
OH.) with antimicrobial activity.27 NADPH
oxidase is composed of four subunits; two membrane components, p22 and
gp91; and two cytoplasmic subunits, p47 and p67. Genes for these
subunits are expressed early in myeloid development.41,42
When the neutrophil receives an appropriate external stimulus, the
preexisting component subunits become assembled on the membrane to form
an active enzyme. Although PU.1-deficient cells lack some of the
receptors that are used for initiating the respiratory burst (such as
CD11b and G- and GM-CSF receptors), this cannot account for their
failure to respond to PMA. Our studies demonstrate the absence of
detectable messages for gp91phox, but not other
subunits of NADPH oxidase, in PU.1-deficient neutrophils. Thus, our
studies would suggest that a critical subunit of NADPH oxidase is
absent, which, in turn, would prevent O2
generation. However, we cannot fully discount additional disruptions in
the respiratory burst pathway caused by the absence of PU.1. The loss
of gp91 is also reported in 60% of the cases of chronic granulomatous
disease, a disorder that can be caused by mutations in any of the
oxidase's four subunits. These mutations typically result in absent or
severely reduced expression of the mutated subunit, and affected people
have ineffective phagocytes that lack respiratory burst
activity.43 Our results show that PU.1 directly or
indirectly affects gp91phox gene transcription.
Although earlier promoter studies have suggested that PU.1 binding
sites might not be present in the promoter of the
gp91phox gene,44 recent studies on
human neutrophils, monocytes, and B lymphocytes suggest that PU.1 is
essential for transcription of the gp91phox
gene.45 Thus, our studies support a pivotal role for PU.1
in regulating the expression of early myeloid (M-CSF and G-CSF
receptors and gp91phox ) as well as later
neutrophil (lysozyme, gelatinase, and lactoferrin) genes.
The functions of phagocytosis and bacterial killing were also severely
compromised in PU.1-deficient cells. Fc receptor-mediated (stimulated)
phagocytosis was markedly reduced compared with normal phagocytosis,
possibly because of the absence of CD11b, which has been shown to play
an indirect but essential role in this process.46 Still,
baseline (unstimulated) phagocytosis, which is not dependent on
CD11b,46 by PU.1-deficient cells was below the level of
normal neutrophils. Reduced uptake and reduced killing of live
bacterial organisms by PU.1-deficient neutrophils was reflected in the
higher recovery of viable bacteria after incubation with these cells.
Defective bacterial killing may be a reflection of the absence of
O2 , as it is documented that individuals
with chronic granulomatous disease (that fail to produce this
metabolite as a consequence of mutations in various subunits of NADPH
oxidase) suffer from severe and repeated bacterial
infections.43 However, the notion that considerable
redundancy exists in the neutrophil's antimicrobial defense system is
supported by the ability of PU.1-deficient neutrophils to kill
organisms despite their numerous deficiencies.
Similar to CD11b, myeloid growth factor receptors are also believed to
mediate many functions of mature neutrophils. G-CSF receptor
stimulation in particular is reported to stimulate arachidonic acid
release and myeloperoxidase production, and prime mature neutrophils
for activation. The number of receptors per cell for G- and GM-CSF
increases with neutrophil maturation.11,47 Interestingly, G-CSF cytokine- and receptor-gene-disrupted mice were noted to have
ineffective neutrophilopoiesis in response to infection, and to handle
infection inefficiently; however, individual neutrophil functions were
not assessed.35,36 GM-CSF cytokine- and receptor-deficient mice were also not specifically assessed for neutrophil functions but
had resting and infection-challenged cell counts comparable with normal
mice.37,38 These results indicate a role for these cytokines/receptors in neutrophil expansion, yet their role in neutrophil maturation and acquisition of functionality is not completely resolved. In PU.1-deficient mice, there is clearly defective
neutrophil expansion. Additionally, however, individual functions of
neutrophils as well as other indicators of neutrophil maturity such as
specific granule gene expression are lacking. The failure of PMA to
activate PU.1-deficient neutrophils is evidence for effects of the PU.1
mutation that are independent of CD11b or growth factor receptors,
because phorbol esters activate neutrophils directly. Certainly the
absence of CD11b and growth factor receptors contributes to the overall
phenotype; however, none of the phenotypes of these individual
"knockout" mice matches that of the PU.1-null mouse with respect
to the neutrophil lineage. Thus, a simple arrest of otherwise normal
development does not adequately describe PU.1-deficient neutrophils.
Recently, the genes for several other myeloid-specific transcription
factors have been disrupted in mice. These factors, specifically AML1,
c-myb, and C/EBP , are proposed to be regulators of many of the same
myeloid genes as PU.1, including the myeloid growth factor receptors.
Whereas disruption of c-myb and AML1 causes severe defects in fetal
liver hematopoiesis with marked reductions or loss of multipotent
hematopoietic progenitors in that compartment,48,49 C/EBP disruption is far more selective with its effects limited to
the granulocyte (neutrophil and eosinophil) lineages,50
which is consistent with its pattern of expression. C/EBP -null mice have circulating Sudan black+ Gr-1
myeloblast-like cells but no mature neutrophils in vivo at birth. In in
vitro colony-forming assays, C/EBP -null cells can develop comparable
numbers of granulocyte-containing colonies, yet only immature
granulocytes are present. These cells share a common molecular defect
with PU.1-deficient cells in that they fail to express the G-CSF
receptor and do not respond to this cytokine.50 Both
transcription factors have previously been reported to regulate the
G-CSF receptor promoter.6 Despite this deficiency,
commitment to the neutrophil lineage occurs in C/EBP -null mice as in
PU.1-null mice. It is clear that molecular defects other than
dysregulation of cytokine receptor gene(s) must exist in
both of these models. Comparison of the neutrophil lineage cells
generated by PU.1- and C/EBP -null mice should yield valuable
information regarding crucial differentiation-controlling genes in
neutrophils.
In summary, we have shown that the absence of the PU.1 gene product
results in the development of the neutrophil lineage to an abnormal and
incompletely mature stage. In addition to their failure to express
CD11b and G- and GM-CSF receptors, the cells that develop are defective
in their ability to migrate in response to selected chemokines, to
ingest particles, and to kill live bacteria. Superoxide production,
critical for neutrophil function, does not occur in PU.1-deficient
neutrophils, most likely because of their inability to express
gp91phox. Furthermore, messages for specific
granule components are undetectable, suggesting that in the absence of
PU.1, neutrophils do not terminally differentiate, and/or do
not regulate specific granule component genes. PU.1-null mice can only
be maintained for approximately 2 weeks with antibiotic treatment
before they die.12 This is most likely due in large part to
lack of or ineffective response to infection by the neutrophils that do
develop in vivo. Our results convincingly show that the PU.1 gene
product is essential for normal neutrophil maturation and function.
 |
FOOTNOTES |
Submitted December 3, 1997;
accepted April 27, 1998.
Supported by National Institutes of Health Grants DK49886 (B.E.T.) and
AI30656 (R.A.M.).
Address reprint requests to Bruce E. Torbett, PhD, Department of
Immunology, IMM-7, The Scripps Research Institute, 10550 N Torrey Pines
Rd, La Jolla, CA 92037; e-mail: betorbet{at}scripps.edu.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
 |
ACKNOWLEDGMENT |
We gratefully acknowledge the technical assistance of Kari Carver, the
animal facility personnel at both the Burnham Institute and The Scripps
Research Institute, and the secretarial assistance of Bonnie Towle. We
also thank Drs Mary Dinauer and Bernie Babior for helpful discussions
and Dr Michio Nakamura for sharing with us the results of his in-press
manuscript. We thank Scott McKercher for critically reading the
manuscript, and Greg Henkel for both critically reading the manuscript
and affinity purification of the PU.1-GST antibody. This is publication
11314-IMM from The Scripps Research Institute.
 |
REFERENCES |
1.
Pahl HL,
Scheibe RJ,
Zhang D-E,
Chen H-M,
Galson DL,
Maki RA,
Tenen DG:
The proto-oncogene PU.1 regulates expression of the myeloid-specific CD11b promoter.
J Biol Chem
268:5014,
1993[Abstract/Free Full Text]
2.
Rosmarin AG,
Caprio D,
Levy R,
Simkevitch C:
CD18 ( 2 leukocyte integrin) promoter requires PU.1 transcription factor for myeloid activity.
Proc Natl Acad Sci USA
92:801,
1995[Abstract/Free Full Text]
3.
Oelgeschlager M,
Nuchprayoon I,
Luscher B,
Friedman A:
C/EBP, c-myb, and PU.1 cooperate to regulate the neutrophil elastase promoter.
Mol Cell Biol
16:4717,
1996[Abstract]
4.
Perez C,
Coeffier E,
Moreau-Gachelin F,
Weitzerbin J,
Benech PD:
Involvement of the transcription factor PU.1/Spi-1 in myleoid cell-restricted expression of an interferon-inducible gene encoding the human high-affinity Fc receptor.
Mol Cell Biol
14:5023,
1994[Abstract/Free Full Text]
5.
Feinman R,
Qiu WQ,
Pearse RN,
Nikolajczyk BS,
Sen R,
Sheffrey M,
Ravetch JV:
PU.1 and an HLH family member contribute to the myeloid-specific transcription of the Fc RIIIA promoter.
EMBO J
13:3852,
1994[Medline]
[Order article via Infotrieve]
6.
Smith LT,
Hohaus S,
Gonzalez DA,
Dziennis SE,
Tenen DG:
PU.1 (Spi-1) and C/EBP alpha regulate the granulocyte colony-stimulating factor receptor promoter in myeloid cells.
Blood
88:1234,
1996[Abstract/Free Full Text]
7.
Hohaus S,
Petrovick MS,
Voso MT,
Sun Z,
Zhang DE,
Tenen DG:
PU.1 (Spi-1) and C/EBP regulate expression of the granulocyte-macrophage colony stimulating factor receptor gene.
Mol Cell Biol
15:5830,
1995[Abstract]
8.
Zhang D-E,
Hetherington CJ,
Chen H-M,
Tenen DG:
The macrophage transcription factor PU.1 directs tissue-specific expression of the macrophage colony-stimulating factor receptor.
Mol Cell Biol
14:373,
1994[Abstract/Free Full Text]
9.
Sherr CJ,
Borzillo GV,
Kato J-Y,
Shurtleff SA,
Downing JR,
Roussel MF:
Regulation of cell growth and differentiation by the colony-stimulating factor 1 receptor.
Semin Hematol
28:143,
1991[Medline]
[Order article via Infotrieve]
10.
Miyajima A,
Mui L-F,
Ogorochi T,
Sakamaki K:
Receptors for granulocyte-macrophage colony-stimulating factor, interleukin 3, and interleukin 5.
Blood
82:1960,
1993[Free Full Text]
11.
Avalos BR:
Molecular analysis of the granulocyte colony-stimulating factor receptor.
Blood
88:761,
1996[Free Full Text]
12.
McKercher SR,
Torbett BE,
Anderson KL,
Henkel GW,
Vestal DJ,
Baribault H,
Klemsz M,
Feeney AJ,
Wu GE,
Paige CJ,
Maki RA:
Targeted disruption of the PU.1 gene results in multiple hematopoietic abnormalities.
EMBO J
15:5647,
1996[Medline]
[Order article via Infotrieve]
13.
Yam LT,
Li CY,
Crosby WH:
Cytochemical identification of monocytes and granulocytes.
Am J Clin Pathol
55:283,
1971[Medline]
[Order article via Infotrieve]
14.
Hestdal K,
Ruscetti FW,
Ihle JN,
Jacobsen SE,
Dubois CM,
Kopp WC,
Longo DL,
Keller JR:
Characterization and regulation of RB6-8C5 antigen expression on murine bone marrow cells.
J Immunol
147:22,
1991[Abstract]
15.
Anderson KL,
Smith KA,
Conners K,
McKercher SR,
Maki RA,
Torbett BE:
Myeloid development is selectively disrupted in PU.1 null mice.
Blood
91:3702,
1998[Abstract/Free Full Text]
16.
Borregaard N,
Cowland JB:
Granules of the human neutrophilic polymorphonuclear leukocyte.
Blood
89:3503,
1997[Free Full Text]
17.
Bainton DF:
Neutrophil granules.
Br J Haematol
29:17,
1975[Medline]
[Order article via Infotrieve]
18. .1-7.23.17
Nauseef WM:
Preparation and functional analysis of human nonlymphoid cells
, in Coligan JE,
Kruisbeek AM,
Margulies DH,
Shevach EM,
Strober W
(eds):
Current Protocols in Immunology, vol 1.
New York, NY, Wiley/Greene
, 1993
, p 7.23
19.
Pick E:
Microassays for superoxide and hydrogen peroxide production and nitroblue tetrazolium reduction using an enzyme immunoassay microplate reader.
Methods Enzymol
132:520,
1986[Medline]
[Order article via Infotrieve]
20.
White-Owen C,
Alexander JW,
Sramkos RM,
Babcock GF:
Rapid whole-blood microassay using flow cytometry for measuring neutrophil phagocytosis.
J Clin Microbiol
30:2071,
1992[Abstract/Free Full Text]
21.
Moore L,
Humbert J:
Intracellular killing of bacteria and fungi.
Methods Enzymol
132:520,
1986
22.
Andrews NC,
Faller DV:
A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells.
Nucleic Acids Res
19:2499,
1991[Free Full Text]
23.
Klemsz MJ,
McKercher SR,
Celada A,
Van Beveren C,
Maki RA:
The macrophage and B-cell specific transcription factor PU.1 is related to the ets oncogene.
Cell
61:113,
1990[Medline]
[Order article via Infotrieve]
24. .1
Corcoran LM:
Protein expression
, in Ausubel FM,
Brent R,
Kingston RE,
Moore DD,
Seidman JG,
Smith JA,
Struhl K
(eds):
Current Protocols in Molecular Biology, vol 2.
New York, NY, Wiley
, 1994
, p 16.7
25. Bainton DF, in Beutler E, Lichtman MA, Coller BS, Kipps TJ
(eds): Williams Hematology. New York, NY, 1995, McGraw-Hill, p
753
26.
Ben-Baruch A,
Michiel DF,
Oppenheim JJ:
Signals and receptors involved in recruitment of inflammatory cells.
J Biol Chem
270:11703,
1995[Free Full Text]
27. Edwards SW: Biochemistry and Physiology of the Neutrophil.
Cambridge, UK, Cambridge University Press, 1994
28.
Chen HM,
Zhang P,
Voso MT,
Gonzalez DA,
Glass CK,
Zhang DE,
Tenen DG:
Neutrophils and monocytes express high levels of PU.1 (Spi-1) but not Spi-B.
Blood
85:2918,
1995[Abstract/Free Full Text]
29.
Bhat NK,
Fisher RJ,
Fujiwara S,
Asione R,
Papas TS:
Temporal and tissue-specific expression of mouse ets genes.
Proc Natl Acad Sci USA
84:3161,
1987[Abstract/Free Full Text]
30.
Ahne B,
Strätling WH:
Characterization of a myeloid-specific enhancer of the chicken lysozyme gene Major role for an Ets transciption factor-binding site.
J Biol Chem
269:17794,
1994[Abstract/Free Full Text]
31.
Khanna-Gupta A,
Zibello T,
Berliner N:
Coordinate regulation of neutrophil secondary granule protein gene expression.
Curr Top Microbiol Immunol
211:136,
1996
32.
Lomax KJ,
Gallin JE,
Benz EJ,
Rado TA,
Boxer LA,
Malech HL:
Selective defect in myeloid cell lactoferrin gene expression in neutrophil specific granule deficiency.
J Clin Invest
83:514,
1989
33.
Johnston J,
Boxer LA,
Berliner N:
Correlation of RNA levels with protein deficiencies in specific granule deficiency.
Blood
80:2088,
1992[Abstract/Free Full Text]
34.
Johnston J,
Rintels P,
Chung J,
Sather J,
Benz EJ,
Berliner N:
The lactoferrin gene promoter: Structural integrity and non-expression in HL60 cells.
Blood
79:2998,
1992[Abstract/Free Full Text]
35.
Lieschke GJ,
Grail D,
Hodgson G,
Metcalf D,
Stanley E,
Cheers C,
Fowler KJ,
Basu S,
Zhan YF,
Dunn AR:
Mice lacking granulocyte colony-stimulating factor have chronic neutropenia, granulocyte and macrophage progenitor cell deficiency, and impaired neutrophil mobilization.
Blood
84:1737,
1994[Abstract/Free Full Text]
36.
Liu F,
Wu HY,
Wesselschmidt R,
Komaga T,
Link DC:
Impaired production and increased apoptosis of neutrophils in granulocyte colony-stimulating factor receptor-deficient mice.
Immunity
5:491,
1996[Medline]
[Order article via Infotrieve]
37.
Stanley E,
Lieschke GJ,
Grail D,
Metcalf D,
Hodgson G,
Gall JAM,
Maher DW,
Cebon J,
Sinickas V,
Dunn AR:
Granulocyte-macrophage colony-stimulating factor-deficient mice show no major perturbation of hematopoiesis but develop a characteristic pulmonary pathology.
Proc Natl Acad Sci USA
91:5592,
1994[Abstract/Free Full Text]
38.
Nishinakamura R,
Miyajima A,
Mee PJ,
Tybulewicz VLJ,
Murray R:
Hematopoiesis in mice lacking the entire granulocyte-macrophage colony-stimulating factor/interleukin-3/interleukin-5 functions.
Blood
88:2458,
1996[Abstract/Free Full Text]
39.
Coxon A,
Rieu P,
Barkalow FJ,
Askari S,
Sharpe AH,
von Andrian UH,
Arnaout MA,
Mayadas TN:
A novel role for the 2 integrin CD11b/CD18 in neutrophil apoptosis: A homeostatic mechanism in inflammation.
Immunity
5:653,
1996[Medline]
[Order article via Infotrieve]
40.
Premack BA,
Schall TJ:
Chemokine receptors: Gateways to inflammation and infection.
Nat Med
2:1174,
1996[Medline]
[Order article via Infotrieve]
41.
Royer-Pokora B,
Kunkel LM,
Monaco AP,
Goff SC,
Newburger PE,
Baehner RL,
Cole FS,
Curnutte JT,
Orkin SH:
Cloning the gene for an inherited disorder-chronic granulomatous disease On the basis of its chromosomal location.
Nature
322:32,
1986[Medline]
[Order article via Infotrieve]
42.
Barker KA,
Orkin SH,
Newburger PE:
Expression of the X-CGD gene during induced differentiation of the myeloid leukemia cell line HL-60.
Mol Cell Biol
8:2804,
1988[Abstract/Free Full Text]
43.
Dinauer MC:
Genetic disorders of phagocyte function
, in Stamatoyannopoulos G,
Nienhuis AW,
Majerus PW,
Varmus H
(eds):
The Molecular Basis of Blood Diseases
Philadelphia, PA, Saunders
, 1994
, p 493
44.
Luo W,
Skalnik DG:
CCAAT displacement protein competes with multiple transcriptional activators for binding to four sites in the proximal gp91 promoter.
J Biol Chem
271:18203,
1996[Abstract/Free Full Text]
45.
Suzuki S,
Kumatori A,
Haagen I-A,
Fujii Y,
Sadat MA,
Jun HL,
Tsuji Y,
Roos D,
Nakamura M:
PU.1 as an essential activator for the expression of gp91phox gene in human peripheral neutrophils, monocytes and B lymphocytes.
Proc Natl Acad Sci USA
95:6085,
1998[Abstract/Free Full Text]
46.
Gresham HD,
Graham IL,
Anderson DC,
Brown EJ:
Leukocyte adhesion-deficient neutrophils fail to amplify phagocytic function in response to stimulation: Evidence for CD11b/CD18-dependent and -independent mechanisms of phagocytosis.
J Clin Invest
88:588,
1991
47.
Heyworth CM,
Hampson J,
Dexter TM,
Walker F,
Burgess AW,
Kan O,
Cook N,
Vallance SJ,
Whetton AD:
Development of multipotential hemopoietic stem cells to neutrophils is associated with increased expression of receptors for granulocyte macrophage colony-stimulating factor: Altered biological responses to GM-CSF during development.
Growth Factors
5:87,
1991[Medline]
[Order article via Infotrieve]
48.
Mucenski ML,
McLain K,
Kier AB,
Swerdlow SH,
Schreiner CM,
Miller TA,
Pietryga DW,
Scott WJ,
Potter SS:
A functional c-myb gene is required for normal murine fetal hepatic hematopoiesis.
Cell
65:677,
1991[Medline]
[Order article via Infotrieve]
49.
Okuda T,
van Deursen J,
Hiebert SW,
Grosveld G,
Downing JR:
AML1, the target of multiple chromosomal translocations in human leukemia, is essential for normal fetal liver hematopoiesis.
Cell
84:321,
1996[Medline]
[Order article via Infotrieve]
50.
Zhang D-E,
Zhang P,
Wang N,
Hetherington CJ,
Darlington GJ,
Tenen DG:
Absence of granulocyte colony-stimulating factor signaling and neutrophil development in CCAAT enhancer binding protein alpha-deficient mice.
Blood
94:569,
1997

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
L. Laricchia-Robbio, K. Premanand, C. R. Rinaldi, and G. Nucifora
EVI1 Impairs Myelopoiesis by Deregulation of PU.1 Function
Cancer Res.,
February 15, 2009;
69(4):
1633 - 1642.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. P. Dick, L. R. Prince, and I. Sabroe
Ex Vivo-Expanded Bone Marrow CD34+ Derived Neutrophils Have Limited Bactericidal Ability
Stem Cells,
October 1, 2008;
26(10):
2552 - 2563.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Lorenzo, M. Horowitz, and Y. Choi
Osteoimmunology: Interactions of the Bone and Immune System
Endocr. Rev.,
June 1, 2008;
29(4):
403 - 440.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. T. Pesce, Z. Liu, H. Hamed, F. Alem, J. Whitmire, H. Lin, Q. Liu, J. F. Urban Jr., and W. C. Gause
Neutrophils Clear Bacteria Associated with Parasitic Nematodes Augmenting the Development of an Effective Th2-Type Response
J. Immunol.,
January 1, 2008;
180(1):
464 - 474.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Khanna-Gupta, H. Sun, T. Zibello, H. M. Lee, R. Dahl, L. A. Boxer, and N. Berliner
Growth factor independence-1 (Gfi-1) plays a role in mediating specific granule deficiency (SGD) in a patient lacking a gene-inactivating mutation in the C/EBP{epsilon} gene
Blood,
May 15, 2007;
109(10):
4181 - 4190.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Oettgen
Regulation of Vascular Inflammation and Remodeling by ETS Factors
Circ. Res.,
November 24, 2006;
99(11):
1159 - 1166.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. U. Mueller, T. Pabst, J. Fos, V. Petkovic, M. F. Fey, N. Asou, U. Buergi, and D. G. Tenen
ATRA resolves the differentiation block in t(15;17) acute myeloid leukemia by restoring PU.1 expression
Blood,
April 15, 2006;
107(8):
3330 - 3338.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Anderson, M. Gries, N. Kurihara, T. Honjo, J. Anderson, V. Donnenberg, A. Donnenberg, I. Ghobrial, M. Y. Mapara, D. Stirling, et al.
Thalidomide derivative CC-4047 inhibits osteoclast formation by down-regulation of PU.1
Blood,
April 15, 2006;
107(8):
3098 - 3105.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Metcalf, A. Dakic, S. Mifsud, L. Di Rago, L. Wu, and S. Nutt
Inactivation of PU.1 in adult mice leads to the development of myeloid leukemia
PNAS,
January 31, 2006;
103(5):
1486 - 1491.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. R. Sheppard, M. R. Kelher, E. E. Moore, N. J. D. McLaughlin, A. Banerjee, and C. C. Silliman
Structural organization of the neutrophil NADPH oxidase: phosphorylation and translocation during priming and activation
J. Leukoc. Biol.,
November 1, 2005;
78(5):
1025 - 1042.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Rehli{section}, S. Sulzbacher, S. Pape, T. Ravasi, C. A. Wells, S. Heinz, L. Sollner, C. El Chartouni, S. W. Krause, E. Steingrimsson, et al.
Transcription Factor Tfec Contributes to the IL-4-Inducible Expression of a Small Group of Genes in Mouse Macrophages Including the Granulocyte Colony-Stimulating Factor Receptor
J. Immunol.,
June 1, 2005;
174(11):
7111 - 7122.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Dakic, D. Metcalf, L. Di Rago, S. Mifsud, L. Wu, and S. L. Nutt
PU.1 regulates the commitment of adult hematopoietic progenitors and restricts granulopoiesis
J. Exp. Med.,
May 2, 2005;
201(9):
1487 - 1502.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Thomas, S. Samanta, C. Wu, N. Berliner, and E. Fikrig
Anaplasma phagocytophilum Modulates gp91phox Gene Expression through Altered Interferon Regulatory Factor 1 and PU.1 Levels and Binding of CCAAT Displacement Protein
Infect. Immun.,
January 1, 2005;
73(1):
208 - 218.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. A. Clemens, S. A. Newbrough, E. Y. Chung, S. Gheith, A. L. Singer, G. A. Koretzky, and E. J. Peterson
PRAM-1 Is Required for Optimal Integrin-Dependent Neutrophil Function
Mol. Cell. Biol.,
December 15, 2004;
24(24):
10923 - 10932.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Zhu, G. Saberwal, Y. Lu, L. C. Platanias, and E. A. Eklund
The Interferon Consensus Sequence-binding Protein Activates Transcription of the Gene Encoding Neurofibromin 1
J. Biol. Chem.,
December 3, 2004;
279(49):
50874 - 50885.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. D. Cook, B. J. McCaw, C. Herring, D. L. John, S. J. Foote, S. L. Nutt, and J. M. Adams
PU.1 is a suppressor of myeloid leukemia, inactivated in mice by gene deletion and mutation of its DNA binding domain
Blood,
December 1, 2004;
104(12):
3437 - 3444.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. T. Quinn and K. A. Gauss
Structure and regulation of the neutrophil respiratory burst oxidase: comparison with nonphagocyte oxidases
J. Leukoc. Biol.,
October 1, 2004;
76(4):
760 - 781.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Mazzi, M. Donini, D. Margotto, F. Wientjes, and S. Dusi
IFN-{gamma} Induces gp91phox Expression in Human Monocytes via Protein Kinase C-Dependent Phosphorylation of PU.1
J. Immunol.,
April 15, 2004;
172(8):
4941 - 4947.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. L. Throm and M. J. Klemsz
PU.1 regulates glutathione peroxidase expression in neutrophils
J. Leukoc. Biol.,
July 1, 2003;
74(1):
111 - 117.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. D. Bjerregaard, J. Jurlander, P. Klausen, N. Borregaard, and J. B. Cowland
The in vivo profile of transcription factors during neutrophil differentiation in human bone marrow
Blood,
June 1, 2003;
101(11):
4322 - 4332.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. F. Gombart, S. H. Kwok, K. L. Anderson, Y. Yamaguchi, B. E. Torbett, and H. P. Koeffler
Regulation of neutrophil and eosinophil secondary granule gene expression by transcription factors C/EBPepsilon and PU.1
Blood,
April 15, 2003;
101(8):
3265 - 3273.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Dumortier, P. Kirstetter, P. Kastner, and S. Chan
Ikaros regulates neutrophil differentiation
Blood,
March 15, 2003;
101(6):
2219 - 2226.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Du, M. J. Stankiewicz, Y. Liu, Q. Xi, J. E. Schmitz, J. A. Lekstrom-Himes, and S. J. Ackerman
Novel Combinatorial Interactions of GATA-1, PU.1, and C/EBPepsilon Isoforms Regulate Transcription of the Gene Encoding Eosinophil Granule Major Basic Protein
J. Biol. Chem.,
November 1, 2002;
277(45):
43481 - 43494.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. U. Mueller, T. Pabst, M. Osato, N. Asou, L. M. Johansen, M. D. Minden, G. Behre, W. Hiddemann, Y. Ito, and D. G. Tenen
Heterozygous PU.1 mutations are associated with acute myeloid leukemia
Blood,
July 18, 2002;
100(3):
998 - 1007.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. W. Henkel, S. R. McKercher, and R. A. Maki
Identification of three genes up-regulated in PU.1 rescued monocytic precursor cells
Int. Immunol.,
July 1, 2002;
14(7):
723 - 732.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Akbarzadeh, A. C. Ward, D. O. M. McPhee, W. S. Alexander, G. J. Lieschke, and J. E. Layton
Tyrosine residues of the granulocyte colony-stimulating factor receptor transmit proliferation and differentiation signals in murine bone marrow cells
Blood,
February 1, 2002;
99(3):
879 - 887.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. A. Gauss, P. L. Bunger, and M. T. Quinn
AP-1 is essential for p67phox promoter activity
J. Leukoc. Biol.,
January 1, 2002;
71(1):
163 - 172.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. N. Laribee and M. J. Klemsz
Loss of PU.1 Expression Following Inhibition of Histone Deacetylases
J. Immunol.,
November 1, 2001;
167(9):
5160 - 5166.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Colucci, S. I. Samson, R. P. DeKoter, O. Lantz, H. Singh, and J. P. Di Santo
Differential requirement for the transcription factor PU.1 in the generation of natural killer cells versus B and T cells
Blood,
May 1, 2001;
97(9):
2625 - 2632.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. A. Lekstrom-Himes
The Role of C/EBP{{varepsilon}} in the Terminal Stages of Granulocyte Differentiation
Stem Cells,
February 1, 2001;
19(2):
125 - 133.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
S. K. Bliss, B. A. Butcher, and E. Y. Denkers
Rapid Recruitment of Neutrophils Containing Prestored IL-12 During Microbial Infection
J. Immunol.,
October 15, 2000;
165(8):
4515 - 4521.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Hua, T. Hasebe, A. Someya, S. Nakamura, K. Sugimoto, and I. Nagaoka
Evaluation of the expression of NADPH oxidase components during maturation of HL-60 cells to neutrophil lineage
J. Leukoc. Biol.,
August 1, 2000;
68(2):
216 - 224.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
R. P. DeKoter and H. Singh
Regulation of B Lymphocyte and Macrophage Development by Graded Expression of PU.1
Science,
May 26, 2000;
288(5470):
1439 - 1441.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
M. Centola, G. Wood, D. M. Frucht, J. Galon, M. Aringer, C. Farrell, D. W. Kingma, M. E. Horwitz, E. Mansfield, S. M. Holland, et al.
The gene for familial Mediterranean fever, MEFV, is expressed in early leukocyte development and is regulated in response to inflammatory mediators
Blood,
May 15, 2000;
95(10):
3223 - 3231.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. R. Calvo, D. B. Sykes, M. Pasillas, and M. P. Kamps
Hoxa9 Immortalizes a Granulocyte-Macrophage Colony-Stimulating Factor-Dependent Promyelocyte Capable of Biphenotypic Differentiation to Neutrophils or Macrophages, Independent of Enforced Meis Expression
Mol. Cell. Biol.,
May 1, 2000;
20(9):
3274 - 3285.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
K. L. Anderson, H. Perkin, C. D. Surh, S. Venturini, R. A. Maki, and B. E. Torbett
Transcription Factor PU.1 Is Necessary for Development of Thymic and Myeloid Progenitor-Derived Dendritic Cells
J. Immunol.,
February 15, 2000;
164(4):
1855 - 1861.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. A. Eklund and R. Kakar
Recruitment of CREB-Binding Protein by PU.1, IFN-Regulatory Factor-1, and the IFN Consensus Sequence-Binding Protein Is Necessary for IFN-{gamma}-Induced p67phox and gp91phox Expression
J. Immunol.,
December 1, 1999;
163(11):
6095 - 6105.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Verbeek, J. Lekstrom-Himes, D. J. Park, P. M.-C. Dang, P. T. Vuong, S. Kawano, B. M. Babior, K. Xanthopoulos, and H. P. Koeffler
Myeloid Transcription Factor C/EBPvarepsilon Is Involved in the Positive Regulation of Lactoferrin Gene Expression in Neutrophils
Blood,
November 1, 1999;
94(9):
3141 - 3150.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. L. Anderson, K. A. Smith, H. Perkin, G. Hermanson, C.-G. Anderson, D. J. Jolly, R. A. Maki, and B. E. Torbett
PU.1 and the Granulocyte- and Macrophage Colony-Stimulating Factor Receptors Play Distinct Roles in Late-Stage Myeloid Cell Differentiation
Blood,
October 1, 1999;
94(7):
2310 - 2318.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-M. Kim, H.-S. Kang, S.-G. Paik, K.-H. Pyun, K. L. Anderson, B. E. Torbett, and I. Choi
Roles of IFN Consensus Sequence Binding Protein and PU.1 in Regulating IL-18 Gene Expression
J. Immunol.,
August 15, 1999;
163(4):
2000 - 2007.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. S. Voo and D. G. Skalnik
Elf-1 and PU.1 Induce Expression of gp91phox Via a Promoter Element Mutated in a Subset of Chronic Granulomatous Disease Patients
Blood,
May 15, 1999;
93(10):
3512 - 3520.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. C. Wilkinson and J. Navarro
PU.1 Regulates the CXCR1 Promoter
J. Biol. Chem.,
January 1, 1999;
274(1):
438 - 443.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. T. Nguyen and E. N. Benveniste
Involvement of STAT-1 and Ets Family Members in Interferon-gamma Induction of CD40 Transcription in Microglia/Macrophages
J. Biol. Chem.,
July 28, 2000;
275(31):
23674 - 23684.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. L. Anderson, S. L. Nelson, H. B. Perkin, K. A. Smith, M. J. Klemsz, and B. E. Torbett
PU.1 Is a Lineage-specific Regulator of Tyrosine Phosphatase CD45
J. Biol. Chem.,
March 2, 2001;
276(10):
7637 - 7642.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|